INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Rhodococcus species are well known for their catabolic potential (5, 40). Several Rhodococcus species degrade natural phytosterols. Microbial phytosterol degradation proceeds via the formation of steroids as pathway intermediates (16, 21, 22), i.e., 4-androstene-3,17-dione, 1,4-androstadiene-3,17-dione, and 9-hydroxy-4-androstene-3,17-dione (Fig. 1). These steroid pathway intermediates may be used as precursors for the production of bioactive steroids (16). Degradation of the steroid ring skeleton is initiated by ¹-dehydrogenation, inactivation of which is generally considered necessary to achieve accumulation of steroid pathway intermediates from phytosterols (16, 22). Rhodococcus and Mycobacterium strains treated with mutagens and/or incubated with enzyme inhibitors have been reported to convert sterols into 4-androstene-3,17-dione and 1,4-androstadiene-3,17-dione (21, 22). The industrial performance of these strains is generally inadequate, however, due to strain instability and low conversion efficiencies.

View larger version (14K): [in this window] [in a new window]   FIG. 1.   Proposed pathway for microbial phytosterol (e.g., -sitosterol) degradation (16, 22). AD, 4-androstene-3,17-dione; ADD, 1,4-androstadiene-3,17-dione; 9OHAD, 9-hydroxy-4-androstene-3,17-dione; 9OHADD, 9-hydroxy-1,4-androstadiene-3,17-dione; KSTH, steroid 9-hydroxylase.

Steroid accumulation by strains constructed via genetic engineering has not been reported thus far, probably due to a limited knowledge of the sterol catabolic pathway and the genetics of these microorganisms. The aims of our work are to develop genetic tools for Rhodococcus species, to apply these for a detailed molecular characterization of the sterol degradation pathway, and to disrupt selected target genes in order to achieve accumulation of steroid pathway intermediates from phytosterols.

The enzyme 3-ketosteroid ¹-dehydrogenase (KSTD) [4-ene-3-oxosteroid:(acceptor)-1-ene-oxidoreductase; EC 1.3.99.4] performs the ¹-dehydrogenation of the steroid polycyclic ring structure; its inactivation thus may lead to accumulation of 9-hydroxy-4-androstene-3,17-dione from steroid compounds (Fig. 1). The enzyme has been characterized from several bacteria: Arthrobacter simplex (29), Pseudomonas spp. (19, 20), Nocardia restrictus (34), Nocardia corallina (13), Nocardia opaca (10), Mycobacterium fortuitum (41), and Rhodococcus erythropolis IMET7030 (15). Two seemingly distinct KSTD activities have been reported in M. fortuitum (41). Whether these activities actually represent separate enzymes was not elucidated. The KSTD of N. opaca has been characterized as a flavoprotein (18). Only the KSTD-encoding genes of A. simplex, Comamonas testosteroni, and Rhodococcus rhodochrous have been fully characterized (23, 24, 30). Although cloning of the gene encoding KSTD and expression of an inactive KSTD protein of R. erythropolis IMET7030 in Escherichia coli have been described (2, 38, 39) and a nucleotide sequence of the KSTD-encoding gene of N. opaca (10) (synonym, R. erythropolis IMET7030 [15]) is available (DDBJ/EMBL/GenBank accession no. U59422), no further characterization of this gene has been reported. Moreover, targeted disruption has not been carried out with either of the known KSTD-encoding genes.

Several methods for transformation of Rhodococcus cells have been developed (17). Homologous recombination events required for gene disruption are usually rare, necessitating higher transformation frequencies. Here we report an optimized electrotransformation protocol for R. erythropolis SQ1 (32), a detailed characterization of its kstD gene encoding KSTD, and the effects of a targeted kstD disruption on steroid degradation ability.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Bacterial strains, plasmids, and growth conditions. Plasmids and bacterial strains used are listed in Table 1. Rhodococcus strains were cultivated at 30°C and 250 rpm in liquid medium (LBP) containing 1% (wt/vol) Bacto Peptone (Difco, Detroit, Mich.), 0.5% (wt/vol) yeast extract (BBL Becton Dickinson and Company, Cockeysville, Md.), and 1% (wt/vol) NaCl. For growth on solid medium, LBP was supplemented with 1.5% (wt/vol) Bacto Agar (Difco). For steroid bioconversion experiments, strains were grown in YG15 medium (15 g of yeast extract · liter¹, 15 g of glucose · liter¹ [pH 7.0]) at 28°C (200 rpm). E. coli strains (Table 1) were grown in Luria-Bertani (LB) broth at 37°C. BBL agar (1.5% [wt/vol]) was added for growth on solid medium.

General cloning techniques. Recombinant DNA techniques were used according to standard protocols (33). DNA isolation procedures for Rhodococcus plasmid DNA were performed as described by Vogt-Singer and Finnerty (37). DNA-modifying enzymes were purchased from Boehringer (Mannheim, Germany), New England Biolabs (Beverly, Mass.), or Amersham Pharmacia Biotech AB (Uppsala, Sweden) and were used as described by the manufacturer. Transformation of E. coli was performed as described by Chung et al. (6).

Electrotransformation of Rhodococcus. LBP broth (300 ml) supplemented with 3% (wt/vol) glycine was inoculated with 5 ml of a 24-h Rhodococcus LBP culture and incubated until late-exponential phase (optical density at 600 nm [OD₆₀₀], 2 to 3). Addition of 3% (wt/vol) glycine to the growth medium increased transformation frequencies 2.2-fold, and growth of R. erythropolis SQ1 was slightly inhibited. The cells were harvested by centrifugation for 10 min at 4,000 × g (4°C) and washed twice with cold distilled water. The pellet was resuspended in 2 to 3 ml of cold 30% (vol/vol) polyethylene glycol 1450 (PEG 1450). Higher-molecular-weight PEG compounds were also tested but resulted in lower transformation frequencies. Competent cells were divided into 100-µl portions and frozen at 80°C until use. Prior to transformation experiments, cells were thawed on ice. Plasmid DNA (1 µg) was added, and cells were kept on ice for 1 min. Electrotransformation was performed on a BTX600 electroporation apparatus (Biotechnology & Experimental Research Inc., San Diego, Calif.) in 2-mm gapped cuvettes with a single pulse. Both field strength and resistance influenced transformation efficiency, showing optima of 8.75 kV · cm¹ and 186  (50 µF), respectively. These settings generally resulted in an observed field strength of 6.7 kV · cm¹ and time-pulse constants of approximately 8 ms. LBP medium (1 ml) was added immediately after the electropulse. The cell suspension was incubated for 4.5 h with shaking. Appropriate dilutions were plated on LBP agar supplemented with either 40 µg · ml¹ of chloramphenicol · ml¹ (pDA71) or 10 µg of thiostrepton · ml¹ (pMVS301). Transformants appeared after 3 days. The highest transformation frequencies were obtained for R. erythropolis SQ1 with pMVS301 (10⁶ transformants · µg of DNA¹). The same protocol was used in the gene disruption experiment with pSDH420 (Fig. 2), using the antibiotic kanamycin at a concentration of 200 µg · ml¹.

Colony PCR. A Rhodococcus colony was resuspended in 25 µl of TE buffer (10 mM Tris-1 mM EDTA) and heated for 10 min in boiling water. A kstD PCR product (1,551 bp) was obtained with the kstD forward primer (5' GCGCATATGCAGGACTGGACCAGCGAGTGC) and reverse primer (5' GCGGGATCCGCGTTACTTCGCCATGTCCTG), annealing to the 5' end (including start codon) and 3' end (including stop codon) of the kstD gene, respectively. Primers were originally designed to include NdeI and BamHI restriction sites for KSTD expression in the T7 RNA polymerase pET3 expression system (Novagen, Madison, Wis.). PCR was performed using 5 cycles of 1 min at 95°C, 1.5 min at 60°C, and 1.5 min at 72°C, followed by 25 cycles of 1 min at 95°C, 1.5 min at 55°C, and 1.5 min at 72°C.

Southern hybridization. Rhodococcus total DNA was isolated according to the procedure of Verhasselt et al. (36) as modified by Nagy et al. (26). Digested chromosomal DNA from R. erythropolis SQ1 was separated on a 1% (wt/vol) agarose gel and blotted onto a high-bond nylon membrane supplied by Qiagen (Basel, Switzerland), via an alkaline transfer method (33). Southern hybridizations were done at 68°C with a degenerate kstD oligonucleotide [5' TTCGG (C/G)GG(C/G)AC(C/G)TC(C/G)GC(C/G)TACTC(C/G)GG(C/G)GC(C/G) TC(C/G)ATCTGG] labeled with the digoxigenin (DIG) oligonucleotide tailing kit from Boehringer. The kstD oligonucleotide was based on an amino acid sequence alignment of known KSTD proteins. The membrane was subsequently washed at 68°C with 2× SSC (1× SSC is 0.15 M NaCl and 0.015 M sodium citrate) containing 0.1% (wt/vol) sodium dodecyl sulfate (SDS) for 15 min and twice with 0.1× SSC containing 0.1% (wt/vol) SDS for 10 min. Labeling of the complete kstD gene obtained by PCR was done using the random primed labeling kit from Boehringer. Hybridization was performed at 60°C. Stringent washing (60°C) was done in 2× SSC containing 0.1% (wt/vol) SDS (twice for 5 min each time) and in 0.1× SSC with 0.1% (wt/vol) SDS (twice for 5 min each time).

Steroid bioconversion and steroid analysis. Steroid bioconversions were done with Rhodococcus cultures grown in 75 ml of YG15 medium at 28°C (200 rpm). After growth overnight to late-exponential phase (OD₆₀₀, 5 to 9), Generol (5 g · liter¹) or 4-androstene-3,17-dione (5 g · liter¹ in 0.1% [vol/vol] Tween 80) was added and bioconversion was monitored for several days. Steroids were extracted from the medium by methylene chloride extraction (for analysis by gas chromatography [GC]) or by methylene chloride-methanol (9:1) extraction (for analysis by thin-layer chromatography [TLC]). For high-performance liquid chromatography (HPLC) analysis, samples were diluted 5 times with methanol-water (70:30) and filtered (pore size, 0.45 µm). Steroids were analyzed by either HPLC (with a 250- by 3-mm reversed-phase Lichrosorb 10RP18 column [Varian Chrompack International, Middelburg, The Netherlands], UV detection at 254 nm, and a liquid phase of methanol-water [60:40] at 35°C), GC (with a J&W DB-5MS column measuring 30 m by 0.25 mm [inner diameter] with 0.25-µm film [Alltech, Deerfield, Ill.], a precolumn measuring 2 m by 0.25 mm [inner diameter], [InterSciences, Markham, Canada], and FID-40 detection at 300°C), or TLC (with a Kieselgel 60 F₂₅₄ 10- by 20-cm sheet [Merck, Darmstadt, Germany] in toluene-ethyl acetate [7:3]). The substrates used, 4-androstene-3,17-dione, 9-hydroxy-4-androstene-3,17-dione, 1,4-androstadiene-3,17-dione, and Generol (sterol content, 82.7%, comprising mainly -sitosterol [40.4%], stigmasterol [16.3%], and campesterol [22.4%]; Henkel, Düsseldorf, Germany), were supplied by Diosynth bv. (Oss, The Netherlands).

Preparation of cell extracts of Rhodococcus and KSTD activity staining on native PAGE. Overnight cultures (250 ml) grown in YG15 medium were induced with 4-androstene-3,17-dione (0.25 g in 5 ml of dimethyl sulfoxide) for an additional 5 h. Cell pellets (30 min; 7,300 g; 4°C) were washed with 200 ml of phosphate buffer (KH₂PO₄, 2.72 g · liter¹; K₂HPO₄, 3.48 g · liter¹; MgSO₄ · 7H₂O, 2.46 g · liter¹ [pH 7.2]). Pellets were suspended in phosphate buffer in a 1:2 (wt/wt) ratio and sonicated 7 times for 10 s each time with 2-min cooling intervals. Cell extracts were centrifuged for 1 min at 14,000 rpm in an Eppendorf 5415C centrifuge to remove cell debris. The resulting supernatants (10 to 15 mg of protein · ml¹) either were used for analysis on native polyacrylamide gel electrophoresis (PAGE) gels (12.5% acrylamide) or for KSTD activity assays or were stored at 20°C. KSTD activity was visualized by incubating native PAGE gels in 100 ml of 66.7 mM Tris buffer containing 3.1 mg of phenazine methosulfate (PMS), 2.9 mg of a steroid (4-androstene-3,17-dione or 9-hydroxy-4-androstene-3,17-dione dissolved in 500 µl of ethanol), and 41 mg of nitroblue tetrazolium (NBT) dissolved in 70% dimethyl formamide. Staining was allowed to proceed for several hours until clear activity bands were visible. The reaction was stopped by replacing the staining solution with 10% acetic acid. No KSTD activity staining was found in controls with 1,4-androstadiene-3,17-dione. 4-Androstene-3,17-dione and 9-hydroxy-4-androstene-3,17-dione were equally good steroid substrates for visualizing activity bands.

Heterologous expression of kstD in E. coli cells. Recombinant E. coli cells were grown overnight and diluted 100-fold in LB broth (250 ml) supplemented with ampicillin (100 µg · ml¹). Isopropyl--D-thiogalactopyranoside (IPTG) was added after 3.5 h at a final concentration of 1 mM. After a 4-h induction period, cells were collected by centrifugation and E. coli cell extracts were prepared by sonic treatment as described above for Rhodococcus cell extracts. The resulting supernatants (10 to 15 mg of protein · ml¹) were used for KSTD activity staining.

KSTD enzyme activity assay. Enzyme activities were measured spectrophotometrically at 25°C using PMS and NBT. The reaction mixture (1 ml) consisted of 0.86 M Tris (pH 9), 150 µM PMS, 550 µM NBT, cell extract, and 200 µM 4-androstene-3,17-dione in 2% methanol. Activities are expressed as milliunits per milligram of protein; 1 mU is defined as the formation of 1 nmol of diformazan · min¹ (₅₇₀ = 13 cm² · µmol¹) from NBT. No activity was observed in reaction mixtures without 4-androstene-3,17-dione.

DNA sequencing. Nucleotide sequencing was done using dye primers by the cycle sequencing method (25) with the Thermosequenase kit RPN 2538 from Amersham Pharmacia Biotech AB. The samples were run on the ALF-Express sequencing robot. The nucleotide sequence was analyzed using CloneManager, version 4.01.

DDBJ/EMBL/GenBank database accession number. Nucleotide sequence data have been submitted to the DDBJ/EMBL/GenBank database under accession number AF096929.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Rhodococcus strain selection. R. erythropolis SQ1 (Table 1) was selected for these studies because it exhibits the highest transformation frequencies, maximizing the probability for successful targeted gene disruption, and is able to degrade phytosterols at a relatively high rate (Table 2). Electrotransformation of R. erythropolis SQ1 with pMVS301 DNA under optimized conditions generally resulted in 10⁶ CFU · µg¹. Lower frequencies were found for pDA71 (Table 2). Evidently, pDA71 has a narrow host range, whereas pMVS301 is able to maintain itself in all Rhodococcus strains tested (Table 2). Vector pDA71, carrying several unique cloning sites within the ecoRI positive selection marker, was used in further work.

Cloning and characterization of the kstD gene. Alignment of the N-terminal parts of known KSTD protein sequences of A. simplex (23), C. testosteroni (30), and N. opaca (10) allowed development of a kstD oligonucleotide probe (see Materials and Methods). The known gene sequence of kstD of N. opaca was used as the primary template.

View larger version (27K): [in this window] [in a new window]   FIG. 2.   Cloning strategies for the construction of pSDH205 and the nonreplicative vector pSDH420 used for kstD targeted gene disruption. `kstD' in pSDH420 indicates the internal 741-bp Asp718/SalI fragment of the kstD gene used for targeted gene disruption of kstD in R. erythropolis SQ1. A 1,756-bp ClaI/BamHI fragment of pSDH205 (sites marked with asterisks) was used for the construction of pSDH101 (for complementation of the kstD mutant phenotype [Table 1]) and pSDH305 (heterologous kstD expression) [Table 1]). ORFs are indicated with arrows. Solid curved lines represent R. erythropolis SQ1 DNA. Open curved lines represent regions of the Rhodococcus-E. coli shuttle vector pDA71, encoding replication in Rhodococcus (rep) and chloramphenicol resistance (cat).

Targeted disruption of the kstD gene. Construct pSDH420 (Table 1; Fig. 2), a nonreplicative vector in Rhodococcus containing the aphII marker of Tn5 (4) and a 741-bp Asp718/SalI internal DNA fragment of the kstD gene, was made for targeted gene disruption of kstD. After electrotransformation, a preliminary screening for integration of the vector at the kstD locus of R. erythropolis SQ1 was performed by colony PCR. Individual transformants were checked for loss of the wild-type kstD PCR fragment (1,551 bp) using forward and reverse kstD primers (Fig. 3). For 9 out of 13 transformants, no wild-type kstD PCR fragment was obtained, suggesting targeted disruption of kstD. Three of these nine transformants were used for further analysis. Confirmation of genuine targeted kstD gene disruption was obtained from Southern analysis (Fig. 4). Genomic DNA of the wild-type strain and three individual transformants was digested with ClaI and hybridized with the complete kstD gene (Fig. 4). A 2,095 bp DNA fragment of wild-type genomic DNA hybridizing with the kstD probe (Fig. 4, lane 4) was replaced by two DNA fragments of 1.06 and 6.06 kb in all three transformants (Fig. 4, lanes 1 to 3). This corresponds with what would be expected from integration of pSDH420 into the kstD gene by a single recombination event (Fig. 3). The kstD gene disruption mutant strain was designated R. erythropolis SDH420.

View larger version (22K): [in this window] [in a new window]   FIG. 3.   Schematic overview of targeted gene disruption of kstD by integration of pSDH420 into the R. erythropolis SQ1 chromosome. Single homologous recombination between the wild-type kstD gene on the R. erythropolis SQ1 chromosome and a 741-bp Asp718/SalI internal kstD fragment located on pSDH420 divides the wild-type ClaI DNA fragment (2,095 bp) into two ClaI DNA fragments of 1.06 and 6.05 kb. ORF2, encoding a TetR type of repressor protein, was identified upstream of kstD. Forward and reverse kstD primers, used for screening of potential kstD gene disruption mutants with colony PCR, are indicated by arrows.

View larger version (38K): [in this window] [in a new window]   FIG. 4.   Southern analysis of genomic DNA digested with ClaI of three individual kstD mutants (lanes 1 to 3) and wild-type R. erythropolis SQ1 (lane 4). The complete kstD gene, obtained with PCR using forward and reverse kstD primers, was used as a DIG-labeled probe.

Characterization of R. erythropolis strain SDH420. Wild-type KSTD activity obtained after induction with 4-androstene-3,17-dione (855 ± 104 mU · mg¹) had become reduced significantly in the kstD mutant (2.7 ± 0.8 mU · mg¹). Targeted gene disruption of kstD thus does not result in complete loss of KSTD activity in R. erythropolis SDH420. Growth of the kstD mutant on mineral agar plates supplemented with either 4-androstene-3,17-dione or 9-hydroxy-4-androstene-3,17-dione as a sole carbon source was not blocked. Also, bioconversion of phytosterols by R. erythropolis SDH420 remained virtually unaffected, and no accumulation of either of the expected steroid pathway intermediates 4-androstene-3,17-dione and 9-hydroxy-4-androstene-3,17-dione from phytosterols (Fig. 1) was observed.

1

Heterologous expression of the kstD gene. Exponential-phase cells of E. coli DH5 harboring pSDH305 (Table 1) expressed the kstD gene (1383 ± 140 mU · mg¹) under the control of the lac promoter (Fig. 5). No KSTD activity could be detected when the kstD gene was cloned in the direction opposite that of the lac promoter (pSDH309 [Table 1]), indicating that the kstD promoter is not functional in E. coli.

View larger version (38K): [in this window] [in a new window]   FIG. 5.   KSTD activity staining, using 4-androstene-3,17-dione as a substrate, on native PAGE gels loaded with cell extracts (approximately 35 µg of protein) of noninduced wild-type R. erythropolis SQ1 (lane 1), 4-androstene-3,17-dione-induced wild-type R. erythropolis SQ1 (lane 2), 4-androstene-3,17-dione-induced SDH420 (a kstD mutant) (lane 3), E. coli DH5/pBlueScript(II) KS (lane 4), and E. coli DH5/pSDH305 (lane 5). No activity bands could be visualized in controls using 1,4-androstadiene-3,17-dione as a substrate for staining.

KSTD activity staining. The possible presence of additional KSTD enzymatic activities in R. erythropolis SQ1 was subsequently investigated. Staining for KSTD activity on native PAGE gels loaded with extracts of noninduced cells revealed two weak activity bands (Fig. 5, lane 1). The band with the highest electrophoretic mobility was expressed in E. coli DH5/pSDH305 (KSTD; Fig. 5, lane 5). Cells of strain SQ1 induced with 4-androstene-3,17-dione showed induction of both activity bands (Fig. 5, lane 2). Targeted disruption of kstD abolished only the activity band with the highest electrophoretic mobility (KSTD), while the second activity band remained intact (Fig. 5, lane 3), indicating the presence of an additional KSTD enzymatic activity.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

The ability to degrade phytosterols is widespread in nocardioform actinomycetes and requires a set of enzymes degrading the phytosterol aliphatic side chain and the steroid polycyclic ring structure (Fig. 1). Accumulation of steroids from phytosterols can be achieved only when the steroid skeleton is not enzymatically attacked. Steroid degradation may be blocked in mutants with inactivated KSTD and/or steroid 9-hydroxylase enzymes isolated following UV irradiation or treatment with chemical mutagens. Alternatively, specific chelating agents may be used to inhibit steroid 9-hydroxylase activity. Both these approaches, however, have some drawbacks. Chelating compounds are known to be inhibitory to sterol side chain cleavage as well (22), and mutagenized strains generally suffer from genetic instability during bioconversion processes. In our view, a molecular approach, in which stable and well-defined mutations are introduced by targeted disruption of selected genes involved in steroid ring degradation, will allow construction of Rhodococcus strains accumulating steroid pathway intermediates in efficient phytosterol bioconversion processes.

To our knowledge this is the first report on targeted disruption of an actinomycete kstD gene encoding a steroid catabolic enzyme, KSTD, and one of the first examples of targeted gene disruption in the genus Rhodococcus (17, 31). Disruption of the R. erythropolis SQ1 kstD gene resulted in a strong reduction in, but not in complete loss of, KSTD activity. Native PAGE of cell extracts stained for KSTD activity revealed that the remaining activity was not due to incomplete inactivation of the kstD-encoded KSTD activity. Instead, these studies provided evidence for the presence of two enzyme activities, one of which is responsible for the remaining activity observed in the kstD mutant strain (Fig. 5). This remaining activity appears to be more pronounced on native PAGE gels than in a direct KSTD assay. We believe this is due to the fact that native PAGE gel slabs are stained for several hours to visualize both activity bands. Activity staining does not proceed linearly during this period of time: when staining of KSTD is maximal, further staining of the other activity band still occurs. In addition, the remaining activity may be enhanced by electrophoresis, separating the enzyme from inhibitory factors. Disruption of kstD alone thus is insufficient for complete inactivation of KSTD activity in R. erythropolis strain SQ1 and explains why accumulation of steroid pathway intermediates from bioconversion of phytosterols did not occur in the kstD mutant strain. The absence of steroid accumulation in the kstD mutant, however, seems contradictory with the loss of more than 99% of KSTD activity (remaining KSTD activity, 2.7 mU · mg¹) observed in this mutant. This may imply that ¹-dehydrogenation is not the rate-limiting step in phytosterol degradation, although alternative pathways of sterol degradation may very well exist. The observed growth of the kstD mutant on agar plates supplemented with the steroid substrate 4-androstene-3,17-dione or 9-hydroxy-4-androstene-3,17-dione can also be explained by the presence of a second KSTD activity. These two KSTD enzymes in vivo could be responsible for the ¹-dehydrogenation of either 4-androstene-3,17-dione or 9-hydroxy-4-androstene-3,17-dione. KSTD activity staining of native PAGE gels showed, however, that 4-androstene-3,17-dione and 9-hydroxy-4-androstene-3,17-dione are substrates of both enzymatic activities (data not shown), which suggests that these enzymes function as isoenzymes in vivo.

Upstream of the kstD gene a second, divergently transcribed putative regulatory gene (ORF2) was found that carries the consensus sequence of repressor proteins of the TetR family (1). Members of this family are generally transcribed divergently from the genes under their control, which suggests that the ORF2-encoded protein acts as a repressor of kstD expression. The ORF2-encoded protein shows no similarity with the putative DNA-binding regulator protein encoded by ksdR of A. simplex preceding ksdD (23). No regulatory gene has been found near ksdD in R. rhodochrous (24). No cotranscribed sequences were found downstream of kstD in R. erythropolis SQ1, as is the case in R. rhodochrous (24). Clustering of a few genes involved in steroid degradation has been reported for both A. simplex and C. testosteroni. The ksdD gene of A. simplex is thought to be translationally coupled to ksdI, which encodes a putative 3-ketosteroid-⁵-isomerase (KS5IS). In C. testosteroni the gene encoding KSTD (¹dh) is cotranscribed with the gene encoding 3-ketosteroid ⁴-(5)-dehydrogenase [⁴-(5)dh] (12). The molecular organization of steroid catabolic genes in R. erythropolis SQ1 thus differs from that in other microorganisms studied.

In this report we have shown that inactivation of KSTD activity, attempting to block steroid degradation with the aim of accumulating valuable steroid pathway intermediates, cannot be achieved by the inactivation of a single gene encoding this activity. Evidence is presented that a KSTD isoenzyme is present that prevents accumulation of steroid pathway intermediates from microbial phytosterol bioconversion. A more detailed understanding of the biological significance of the presence of KSTD isoenzymes in sterol-degrading bacteria clearly is of both scientific and applied interest. The effects of inactivation of both these enzymes will be investigated in more detail in further work.