Previous Article | Next Article ![]()
Applied and Environmental Microbiology, May 2000, p. 2029-2036, Vol. 66, No. 5
Department of Microbiology, Groningen
Biomolecular Sciences and Biotechnology Institute (GBB), University of
Groningen, 9750 AA Haren,1 and Diosynth
bv, AkzoNobel, 5340 BH Oss,2 The Netherlands
Received 28 December 1999/Accepted 25 February 2000
Microbial phytosterol degradation is accompanied by the formation
of steroid pathway intermediates, which are potential precursors in the
synthesis of bioactive steroids. Degradation of these steroid intermediates is initiated by Rhodococcus species are
well known for their catabolic potential (5, 40). Several
Rhodococcus species degrade natural phytosterols. Microbial
phytosterol degradation proceeds via the formation of steroids as
pathway intermediates (16, 21,
22), i.e., 4-androstene-3,17-dione, 1,4-androstadiene-3,17-dione, and 9
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Targeted Disruption of the kstD Gene Encoding a
3-Ketosteroid
1-Dehydrogenase Isoenzyme of
Rhodococcus erythropolis Strain SQ1

![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
1-dehydrogenation of the
steroid ring structure. Characterization of a 2.9-kb DNA fragment of
Rhodococcus erythropolis SQ1 revealed an open reading frame
(kstD) showing similarity with known 3-ketosteroid
1-dehydrogenase genes. Heterologous expression of
kstD yielded 3-ketosteroid
1-dehydrogenase
(KSTD) activity under the control of the lac promoter in
Escherichia coli. Targeted disruption of the
kstD gene in R. erythropolis SQ1 was achieved,
resulting in loss of more than 99% of the KSTD activity. However,
growth on the steroid substrate 4-androstene-3,17-dione or
9
-hydroxy-4-androstene-3,17-dione was not abolished by the
kstD gene disruption. Bioconversion of phytosterols was
also not blocked at the level of
1-dehydrogenation in
the kstD mutant strain, since no accumulation of steroid
pathway intermediates was observed. Thus, inactivation of
kstD is not sufficient for inactivation of the
1-dehydrogenase activity. Native polyacrylamide gel
electrophoresis of cell extracts stained for KSTD activity showed that
R. erythropolis SQ1 in fact harbors two activity bands, one
of which is absent in the kstD mutant strain.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-hydroxy-4-androstene-3,17-dione (Fig.
1). These steroid pathway intermediates
may be used as precursors for the production of bioactive steroids
(16). Degradation of the steroid ring skeleton is initiated
by
1-dehydrogenation, inactivation of which is generally
considered necessary to achieve accumulation of steroid pathway
intermediates from phytosterols (16, 22).
Rhodococcus and Mycobacterium strains treated
with mutagens and/or incubated with enzyme inhibitors have been
reported to convert sterols into 4-androstene-3,17-dione and
1,4-androstadiene-3,17-dione (21, 22). The industrial performance of these strains is generally inadequate, however, due to
strain instability and low conversion efficiencies.

View larger version (14K):
[in a new window]
FIG. 1.
Proposed pathway for microbial phytosterol (e.g.,
-sitosterol) degradation (16, 22). AD,
4-androstene-3,17-dione; ADD, 1,4-androstadiene-3,17-dione; 9OHAD,
9
-hydroxy-4-androstene-3,17-dione; 9OHADD,
9
-hydroxy-1,4-androstadiene-3,17-dione; KSTH, steroid
9
-hydroxylase.
Steroid accumulation by strains constructed via genetic engineering has not been reported thus far, probably due to a limited knowledge of the sterol catabolic pathway and the genetics of these microorganisms. The aims of our work are to develop genetic tools for Rhodococcus species, to apply these for a detailed molecular characterization of the sterol degradation pathway, and to disrupt selected target genes in order to achieve accumulation of steroid pathway intermediates from phytosterols.
The enzyme 3-ketosteroid
1-dehydrogenase (KSTD)
[4-ene-3-oxosteroid:(acceptor)-1-ene-oxidoreductase; EC 1.3.99.4] performs the
1-dehydrogenation of the steroid polycyclic ring
structure; its inactivation thus may lead to accumulation of
9
-hydroxy-4-androstene-3,17-dione from steroid compounds (Fig. 1).
The enzyme has been characterized from several bacteria:
Arthrobacter simplex (29), Pseudomonas spp. (19, 20), Nocardia restrictus
(34), Nocardia corallina (13),
Nocardia opaca (10), Mycobacterium
fortuitum (41), and Rhodococcus
erythropolis IMET7030 (15). Two seemingly distinct KSTD
activities have been reported in M. fortuitum
(41). Whether these activities actually represent separate
enzymes was not elucidated. The KSTD of N. opaca has
been characterized as a flavoprotein (18). Only
the KSTD-encoding genes of A. simplex, Comamonas testosteroni, and Rhodococcus rhodochrous have been
fully characterized (23, 24, 30). Although cloning of the
gene encoding KSTD and expression of an inactive KSTD protein of
R. erythropolis IMET7030 in Escherichia coli have
been described (2, 38, 39) and a nucleotide sequence of
the KSTD-encoding gene of N. opaca
(10) (synonym, R. erythropolis IMET7030
[15]) is available (DDBJ/EMBL/GenBank accession
no. U59422), no further characterization of this gene has been
reported. Moreover, targeted disruption has not been carried out with
either of the known KSTD-encoding genes.
Several methods for transformation of Rhodococcus cells have been developed (17). Homologous recombination events required for gene disruption are usually rare, necessitating higher transformation frequencies. Here we report an optimized electrotransformation protocol for R. erythropolis SQ1 (32), a detailed characterization of its kstD gene encoding KSTD, and the effects of a targeted kstD disruption on steroid degradation ability.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Bacterial strains, plasmids, and growth conditions.
Plasmids
and bacterial strains used are listed in Table
1. Rhodococcus strains were
cultivated at 30°C and 250 rpm in liquid medium (LBP) containing 1%
(wt/vol) Bacto Peptone (Difco, Detroit, Mich.), 0.5% (wt/vol) yeast
extract (BBL Becton Dickinson and Company, Cockeysville, Md.), and 1%
(wt/vol) NaCl. For growth on solid medium, LBP was supplemented with
1.5% (wt/vol) Bacto Agar (Difco). For steroid bioconversion
experiments, strains were grown in YG15 medium (15 g of yeast
extract · liter
1, 15 g of glucose · liter
1 [pH 7.0]) at 28°C (200 rpm). E. coli strains (Table 1) were grown in Luria-Bertani (LB) broth at
37°C. BBL agar (1.5% [wt/vol]) was added for growth on solid
medium.
|
General cloning techniques. Recombinant DNA techniques were used according to standard protocols (33). DNA isolation procedures for Rhodococcus plasmid DNA were performed as described by Vogt-Singer and Finnerty (37). DNA-modifying enzymes were purchased from Boehringer (Mannheim, Germany), New England Biolabs (Beverly, Mass.), or Amersham Pharmacia Biotech AB (Uppsala, Sweden) and were used as described by the manufacturer. Transformation of E. coli was performed as described by Chung et al. (6).
Electrotransformation of Rhodococcus.
LBP broth (300 ml) supplemented with 3% (wt/vol) glycine was inoculated with 5 ml of
a 24-h Rhodococcus LBP culture and incubated until
late-exponential phase (optical density at 600 nm
[OD600], 2 to 3). Addition of 3% (wt/vol) glycine to the
growth medium increased transformation frequencies 2.2-fold, and growth
of R. erythropolis SQ1 was slightly inhibited. The cells
were harvested by centrifugation for 10 min at 4,000 × g (4°C) and washed twice with cold distilled water. The
pellet was resuspended in 2 to 3 ml of cold 30% (vol/vol) polyethylene
glycol 1450 (PEG 1450). Higher-molecular-weight PEG compounds were also
tested but resulted in lower transformation frequencies. Competent
cells were divided into 100-µl portions and frozen at
80°C until
use. Prior to transformation experiments, cells were thawed on ice.
Plasmid DNA (1 µg) was added, and cells were kept on ice for 1 min.
Electrotransformation was performed on a BTX600 electroporation
apparatus (Biotechnology & Experimental Research Inc., San Diego,
Calif.) in 2-mm gapped cuvettes with a single pulse. Both field
strength and resistance influenced transformation efficiency, showing
optima of 8.75 kV · cm
1 and 186
(50 µF),
respectively. These settings generally resulted in an observed field
strength of 6.7 kV · cm
1 and time-pulse constants
of approximately 8 ms. LBP medium (1 ml) was added immediately after
the electropulse. The cell suspension was incubated for 4.5 h with
shaking. Appropriate dilutions were plated on LBP agar supplemented
with either 40 µg · ml
1 of chloramphenicol
· ml
1 (pDA71) or 10 µg of thiostrepton · ml
1 (pMVS301). Transformants appeared after 3 days. The
highest transformation frequencies were obtained for R. erythropolis SQ1 with pMVS301 (106 transformants
· µg of DNA
1). The same protocol was used in the gene
disruption experiment with pSDH420 (Fig. 2), using the antibiotic
kanamycin at a concentration of 200 µg · ml
1.
Colony PCR. A Rhodococcus colony was resuspended in 25 µl of TE buffer (10 mM Tris-1 mM EDTA) and heated for 10 min in boiling water. A kstD PCR product (1,551 bp) was obtained with the kstD forward primer (5' GCGCATATGCAGGACTGGACCAGCGAGTGC) and reverse primer (5' GCGGGATCCGCGTTACTTCGCCATGTCCTG), annealing to the 5' end (including start codon) and 3' end (including stop codon) of the kstD gene, respectively. Primers were originally designed to include NdeI and BamHI restriction sites for KSTD expression in the T7 RNA polymerase pET3 expression system (Novagen, Madison, Wis.). PCR was performed using 5 cycles of 1 min at 95°C, 1.5 min at 60°C, and 1.5 min at 72°C, followed by 25 cycles of 1 min at 95°C, 1.5 min at 55°C, and 1.5 min at 72°C.
Southern hybridization. Rhodococcus total DNA was isolated according to the procedure of Verhasselt et al. (36) as modified by Nagy et al. (26). Digested chromosomal DNA from R. erythropolis SQ1 was separated on a 1% (wt/vol) agarose gel and blotted onto a high-bond nylon membrane supplied by Qiagen (Basel, Switzerland), via an alkaline transfer method (33). Southern hybridizations were done at 68°C with a degenerate kstD oligonucleotide [5' TTCGG (C/G)GG(C/G)AC(C/G)TC(C/G)GC(C/G)TACTC(C/G)GG(C/G)GC(C/G) TC(C/G)ATCTGG] labeled with the digoxigenin (DIG) oligonucleotide tailing kit from Boehringer. The kstD oligonucleotide was based on an amino acid sequence alignment of known KSTD proteins. The membrane was subsequently washed at 68°C with 2× SSC (1× SSC is 0.15 M NaCl and 0.015 M sodium citrate) containing 0.1% (wt/vol) sodium dodecyl sulfate (SDS) for 15 min and twice with 0.1× SSC containing 0.1% (wt/vol) SDS for 10 min. Labeling of the complete kstD gene obtained by PCR was done using the random primed labeling kit from Boehringer. Hybridization was performed at 60°C. Stringent washing (60°C) was done in 2× SSC containing 0.1% (wt/vol) SDS (twice for 5 min each time) and in 0.1× SSC with 0.1% (wt/vol) SDS (twice for 5 min each time).
Steroid bioconversion and steroid analysis.
Steroid
bioconversions were done with Rhodococcus cultures grown in
75 ml of YG15 medium at 28°C (200 rpm). After growth overnight to
late-exponential phase (OD600, 5 to 9), Generol (5 g
· liter
1) or 4-androstene-3,17-dione (5 g · liter
1 in 0.1% [vol/vol] Tween 80) was added and
bioconversion was monitored for several days. Steroids were extracted
from the medium by methylene chloride extraction (for analysis by gas
chromatography [GC]) or by methylene chloride-methanol (9:1)
extraction (for analysis by thin-layer chromatography [TLC]). For
high-performance liquid chromatography (HPLC) analysis, samples were
diluted 5 times with methanol-water (70:30) and filtered (pore size,
0.45 µm). Steroids were analyzed by either HPLC (with a 250- by 3-mm
reversed-phase Lichrosorb 10RP18 column [Varian Chrompack
International, Middelburg, The Netherlands], UV detection at 254 nm,
and a liquid phase of methanol-water [60:40] at 35°C), GC (with a
J&W DB-5MS column measuring 30 m by 0.25 mm [inner diameter]
with 0.25-µm film [Alltech, Deerfield, Ill.], a precolumn measuring
2 m by 0.25 mm [inner diameter], [InterSciences, Markham,
Canada], and FID-40 detection at 300°C), or TLC (with a Kieselgel 60 F254 10- by 20-cm sheet [Merck, Darmstadt, Germany] in
toluene-ethyl acetate [7:3]). The substrates used,
4-androstene-3,17-dione, 9
-hydroxy-4-androstene-3,17-dione, 1,4-androstadiene-3,17-dione, and Generol (sterol content, 82.7%, comprising mainly
-sitosterol [40.4%], stigmasterol [16.3%], and campesterol [22.4%]; Henkel, Düsseldorf, Germany), were
supplied by Diosynth bv. (Oss, The Netherlands).
Preparation of cell extracts of Rhodococcus and KSTD
activity staining on native PAGE.
Overnight cultures (250 ml)
grown in YG15 medium were induced with 4-androstene-3,17-dione (0.25 g
in 5 ml of dimethyl sulfoxide) for an additional 5 h. Cell pellets
(30 min; 7,300 g; 4°C) were washed with 200 ml of phosphate buffer
(KH2PO4, 2.72 g · liter
1;
K2HPO4, 3.48 g · liter
1;
MgSO4 · 7H2O, 2.46 g · liter
1 [pH 7.2]). Pellets were suspended in phosphate
buffer in a 1:2 (wt/wt) ratio and sonicated 7 times for 10 s each
time with 2-min cooling intervals. Cell extracts were centrifuged for 1 min at 14,000 rpm in an Eppendorf 5415C centrifuge to remove cell
debris. The resulting supernatants (10 to 15 mg of protein · ml
1) either were used for analysis on native
polyacrylamide gel electrophoresis (PAGE) gels (12.5% acrylamide) or
for KSTD activity assays or were stored at
20°C. KSTD activity was
visualized by incubating native PAGE gels in 100 ml of 66.7 mM Tris
buffer containing 3.1 mg of phenazine methosulfate (PMS), 2.9 mg of a
steroid (4-androstene-3,17-dione or
9
-hydroxy-4-androstene-3,17-dione dissolved in 500 µl of ethanol), and 41 mg of nitroblue tetrazolium (NBT) dissolved in 70% dimethyl formamide. Staining was allowed to proceed for several hours until clear activity bands were visible. The reaction was stopped by replacing the staining solution with 10% acetic acid. No KSTD activity
staining was found in controls with 1,4-androstadiene-3,17-dione. 4-Androstene-3,17-dione and 9-hydroxy-4-androstene-3,17-dione were
equally good steroid substrates for visualizing activity bands.
Heterologous expression of kstD in E. coli cells.
Recombinant E. coli cells were grown
overnight and diluted 100-fold in LB broth (250 ml) supplemented with
ampicillin (100 µg · ml
1).
Isopropyl-
-D-thiogalactopyranoside (IPTG) was added
after 3.5 h at a final concentration of 1 mM. After a 4-h
induction period, cells were collected by centrifugation and E. coli cell extracts were prepared by sonic treatment as described
above for Rhodococcus cell extracts. The resulting
supernatants (10 to 15 mg of protein · ml
1) were
used for KSTD activity staining.
KSTD enzyme activity assay.
Enzyme activities were measured
spectrophotometrically at 25°C using PMS and NBT. The reaction
mixture (1 ml) consisted of 0.86 M Tris (pH 9), 150 µM PMS, 550 µM
NBT, cell extract, and 200 µM 4-androstene-3,17-dione in 2%
methanol. Activities are expressed as milliunits per milligram of
protein; 1 mU is defined as the formation of 1 nmol of diformazan
· min
1 (
570 = 13 cm2 · µmol
1) from NBT. No activity
was observed in reaction mixtures without 4-androstene-3,17-dione.
DNA sequencing. Nucleotide sequencing was done using dye primers by the cycle sequencing method (25) with the Thermosequenase kit RPN 2538 from Amersham Pharmacia Biotech AB. The samples were run on the ALF-Express sequencing robot. The nucleotide sequence was analyzed using CloneManager, version 4.01.
DDBJ/EMBL/GenBank database accession number. Nucleotide sequence data have been submitted to the DDBJ/EMBL/GenBank database under accession number AF096929.
| |
RESULTS |
|---|
|
|
|---|
Rhodococcus strain selection.
R.
erythropolis SQ1 (Table 1) was selected for these studies because
it exhibits the highest transformation frequencies, maximizing the
probability for successful targeted gene disruption, and is able to
degrade phytosterols at a relatively high rate (Table
2). Electrotransformation of R. erythropolis SQ1 with pMVS301 DNA under optimized conditions
generally resulted in 106 CFU · µg
1.
Lower frequencies were found for pDA71 (Table 2). Evidently, pDA71 has
a narrow host range, whereas pMVS301 is able to maintain itself in all
Rhodococcus strains tested (Table 2). Vector pDA71, carrying
several unique cloning sites within the ecoRI positive selection marker, was used in further work.
|
Cloning and characterization of the kstD gene. Alignment of the N-terminal parts of known KSTD protein sequences of A. simplex (23), C. testosteroni (30), and N. opaca (10) allowed development of a kstD oligonucleotide probe (see Materials and Methods). The known gene sequence of kstD of N. opaca was used as the primary template.
Southern analysis with the kstD oligonucleotide probe was performed on chromosomal DNA of strain SQ1 digested with several restriction enzymes. Following sucrose gradient centrifugation, a 6-kb BglII DNA fragment, hybridizing with the kstD oligonucleotide, was selected for cloning. This DNA fragment was cloned in the BglII site of pDA71 (pSDH100) and subsequently subcloned into BamHI-digested pBluescript(II) KS (pSDH200) (Fig. 2). Restriction mapping analysis and Southern hybridization showed that an approximately 2.9-kb EcoRV fragment of pSDH200 contained sequences homologous to that of the kstD oligonucleotide. Subcloning (pSDH205) and subsequent nucleotide sequencing of this fragment revealed two open reading frames (ORFs) of 1,533 nt (kstD) and 627 nt (ORF2) encoding putative proteins of 510 and 208 amino acids (aa), respectively. An overall GC content of 63.9% was found; this is relatively high but somewhat lower than previously reported for Rhodococcus spp. (67 to 73%) (11).
|
Targeted disruption of the kstD gene.
Construct
pSDH420 (Table 1; Fig. 2), a nonreplicative vector in
Rhodococcus containing the aphII marker of
Tn5 (4) and a 741-bp
Asp718/SalI internal DNA fragment of the
kstD gene, was made for targeted gene disruption of
kstD. After electrotransformation, a preliminary screening
for integration of the vector at the kstD locus of R. erythropolis SQ1 was performed by colony PCR. Individual transformants were checked for loss of the wild-type kstD
PCR fragment (1,551 bp) using forward and reverse kstD
primers (Fig. 3). For 9 out of 13 transformants, no wild-type kstD PCR fragment was obtained,
suggesting targeted disruption of kstD. Three of these nine
transformants were used for further analysis. Confirmation of genuine
targeted kstD gene disruption was obtained from Southern analysis (Fig. 4). Genomic DNA of the
wild-type strain and three individual transformants was digested with
ClaI and hybridized with the complete kstD gene
(Fig. 4). A 2,095 bp DNA fragment of wild-type genomic DNA
hybridizing with the kstD probe (Fig. 4, lane 4) was
replaced by two DNA fragments of 1.06 and 6.06 kb in all three
transformants (Fig. 4, lanes 1 to 3). This corresponds with what
would be expected from integration of pSDH420 into the kstD
gene by a single recombination event (Fig. 3). The kstD gene disruption mutant strain was designated R. erythropolis
SDH420.
|
|
Characterization of R. erythropolis strain
SDH420.
Wild-type KSTD activity obtained after induction with
4-androstene-3,17-dione (855 ± 104 mU · mg
1) had become reduced significantly in the
kstD mutant (2.7 ± 0.8 mU · mg
1).
Targeted gene disruption of kstD thus does not result in
complete loss of KSTD activity in R. erythropolis SDH420.
Growth of the kstD mutant on mineral agar plates
supplemented with either 4-androstene-3,17-dione or
9
-hydroxy-4-androstene-3,17-dione as a sole carbon source was not blocked. Also, bioconversion of phytosterols by R. erythropolis SDH420 remained virtually unaffected, and no
accumulation of either of the expected steroid pathway intermediates
4-androstene-3,17-dione and 9
-hydroxy-4-androstene-3,17-dione from
phytosterols (Fig. 1) was observed.
1, excluding the possibility that the
KSTD-negative phenotype was due to some polar effect caused by
genomic integration of the pSDH420 vector.
Heterologous expression of the kstD gene.
Exponential-phase cells of E. coli DH5
harboring pSDH305
(Table 1) expressed the kstD gene (1383 ± 140 mU
· mg
1) under the control of the lac promoter
(Fig. 5). No KSTD activity could be
detected when the kstD gene was cloned in the direction opposite that of the lac promoter (pSDH309 [Table 1]),
indicating that the kstD promoter is not functional in
E. coli.
|
KSTD activity staining.
The possible presence of additional
KSTD enzymatic activities in R. erythropolis SQ1 was
subsequently investigated. Staining for KSTD activity on native PAGE
gels loaded with extracts of noninduced cells revealed two weak
activity bands (Fig. 5, lane 1). The band with the highest
electrophoretic mobility was expressed in E. coli
DH5
/pSDH305 (KSTD; Fig. 5, lane 5). Cells of strain SQ1 induced with
4-androstene-3,17-dione showed induction of both activity bands (Fig.
5, lane 2). Targeted disruption of kstD abolished only the
activity band with the highest electrophoretic mobility (KSTD), while
the second activity band remained intact (Fig. 5, lane 3), indicating
the presence of an additional KSTD enzymatic activity.
| |
DISCUSSION |
|---|
|
|
|---|
The ability to degrade phytosterols is widespread in nocardioform
actinomycetes and requires a set of enzymes degrading the phytosterol
aliphatic side chain and the steroid polycyclic ring structure (Fig.
1). Accumulation of steroids from phytosterols can be achieved
only when the steroid skeleton is not enzymatically attacked.
Steroid degradation may be blocked in mutants with inactivated KSTD
and/or steroid 9
-hydroxylase enzymes isolated following UV
irradiation or treatment with chemical mutagens. Alternatively, specific chelating agents may be used to inhibit steroid
9
-hydroxylase activity. Both these approaches, however, have some
drawbacks. Chelating compounds are known to be inhibitory to
sterol side chain cleavage as well (22), and mutagenized
strains generally suffer from genetic instability during bioconversion
processes. In our view, a molecular approach, in which stable and
well-defined mutations are introduced by targeted disruption of
selected genes involved in steroid ring degradation, will allow
construction of Rhodococcus strains accumulating steroid
pathway intermediates in efficient phytosterol bioconversion processes.
To our knowledge this is the first report on targeted disruption of an
actinomycete kstD gene encoding a steroid catabolic enzyme,
KSTD, and one of the first examples of targeted gene disruption in the
genus Rhodococcus (17, 31). Disruption of the
R. erythropolis SQ1 kstD gene resulted in a
strong reduction in, but not in complete loss of, KSTD activity. Native
PAGE of cell extracts stained for KSTD activity revealed that the
remaining activity was not due to incomplete inactivation of the
kstD-encoded KSTD activity. Instead, these studies provided
evidence for the presence of two enzyme activities, one of which is
responsible for the remaining activity observed in the kstD
mutant strain (Fig. 5). This remaining activity appears to be more
pronounced on native PAGE gels than in a direct KSTD assay. We believe
this is due to the fact that native PAGE gel slabs are stained for
several hours to visualize both activity bands. Activity staining does
not proceed linearly during this period of time: when staining of KSTD
is maximal, further staining of the other activity band still occurs.
In addition, the remaining activity may be enhanced by electrophoresis,
separating the enzyme from inhibitory factors. Disruption of
kstD alone thus is insufficient for complete inactivation of
KSTD activity in R. erythropolis strain SQ1 and explains why
accumulation of steroid pathway intermediates from bioconversion of
phytosterols did not occur in the kstD mutant strain. The
absence of steroid accumulation in the kstD mutant, however,
seems contradictory with the loss of more than 99% of KSTD activity
(remaining KSTD activity, 2.7 mU · mg
1) observed
in this mutant. This may imply that
1-dehydrogenation is
not the rate-limiting step in phytosterol degradation, although
alternative pathways of sterol degradation may very well exist. The
observed growth of the kstD mutant on agar plates
supplemented with the steroid substrate 4-androstene-3,17-dione or
9
-hydroxy-4-androstene-3,17-dione can also be explained by the
presence of a second KSTD activity. These two KSTD enzymes in vivo
could be responsible for the
1-dehydrogenation of either
4-androstene-3,17-dione or 9
-hydroxy-4-androstene-3,17-dione. KSTD
activity staining of native PAGE gels showed, however, that 4-androstene-3,17-dione and 9
-hydroxy-4-androstene-3,17-dione are
substrates of both enzymatic activities (data not shown), which
suggests that these enzymes function as isoenzymes in vivo.
Upstream of the kstD gene a second, divergently transcribed
putative regulatory gene (ORF2) was found that carries the consensus sequence of repressor proteins of the TetR family (1).
Members of this family are generally transcribed divergently from the genes under their control, which suggests that the ORF2-encoded protein
acts as a repressor of kstD expression. The ORF2-encoded protein shows no similarity with the putative DNA-binding regulator protein encoded by ksdR of A. simplex
preceding ksdD (23). No regulatory gene has been
found near ksdD in R. rhodochrous
(24). No cotranscribed sequences were found downstream of
kstD in R. erythropolis SQ1, as is the case in
R. rhodochrous (24). Clustering of a few
genes involved in steroid degradation has been reported for both
A. simplex and C. testosteroni. The
ksdD gene of A. simplex is thought to be
translationally coupled to ksdI, which encodes a
putative 3-ketosteroid-
5-isomerase (KS5IS). In C. testosteroni the gene encoding KSTD (
1dh) is cotranscribed with the gene
encoding 3-ketosteroid
4-(5
)-dehydrogenase
[
4-(5
)dh] (12). The molecular
organization of steroid catabolic genes in R. erythropolis
SQ1 thus differs from that in other microorganisms studied.
In this report we have shown that inactivation of KSTD activity, attempting to block steroid degradation with the aim of accumulating valuable steroid pathway intermediates, cannot be achieved by the inactivation of a single gene encoding this activity. Evidence is presented that a KSTD isoenzyme is present that prevents accumulation of steroid pathway intermediates from microbial phytosterol bioconversion. A more detailed understanding of the biological significance of the presence of KSTD isoenzymes in sterol-degrading bacteria clearly is of both scientific and applied interest. The effects of inactivation of both these enzymes will be investigated in more detail in further work.
| |
ACKNOWLEDGMENTS |
|---|
Thanks are due to I. Nagy and R. de Mot (University of Leuven, Leuven, Belgium) for their contributions in the early stages of the work on transformation of Rhodococcus. We are indebted to E. R. Dabbs (University of Witwatersrand, Johannesburg, South Africa) for providing R. erythropolis SQ1 and pDA71. We also thank Jörn Kalinowski for providing pWJ5.
This work was funded by the Programma Bedrijfsgerichte Technologie Stimulering (PBTS) grant BIO94049 in cooperation with Diosynth bv.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: L. Dijkhuizen, Department of Microbiology, University of Groningen, Kerklaan 30, 9751 NN, Haren, The Netherlands. Phone: 31 (50) 3632153. Fax: 31 (50) 3632154. E-mail: L.Dijkhuizen{at}biol.rug.nl.
Present address: Organic-Chemistry Institute, University
Zürich, CH-8057 Zürich, Switzerland.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Amaraki, H.,
N. Yagi, and M. Suzuki.
1995.
Residues important for the function of a multihelical DNA binding domain in the new transcription factor family of Cam and Tet repressors.
Protein Eng.
8:1259-1266 |
| 2. | Atrat, P., R. Curtiss, and J. E. Clark-Curtiss. 1991. High yield recombinant steroid-1-dehydrogenase production by culturing E. coli carrying plasmid containing rhodococcal gene for the enzyme under control of lac promoter. German patent DD285995. |
| 3. |
Barnes, M. R.,
W. A. Duetz, and P. A. Williams.
1997.
A 3-(3-hydroxyphenyl)propionic acid catabolic pathway in Rhodococcus globerulus PWD1: cloning and characterization of the hpp operon.
J. Bacteriol.
179:6145-6153 |
| 4. | Beck, E., G. Ludwig, E. A. Auerswald, B. Reiss, and H. Schaller. 1982. Nucleotide sequence and exact localization of the neomycin phosphotransferase gene from Tn5. Gene 19:327-336[CrossRef][Medline]. |
| 5. | Bell, K. S., J. C. Philp, D. W. J. Aw, and N. Christofi. 1998. The genus Rhodococcus. J. Appl. Microbiol. 85:195-210[CrossRef][Medline]. |
| 6. |
Chung, C. T.,
S. L. Niemela, and R. H. Miller.
1989.
One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution.
Proc. Natl. Acad. Sci. USA
86:2172-2175 |
| 7. | Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V. Gordon, K. Eiglmeier, S. Gas, C. E. Barry III, F. Tekaia, K. Badcock, D. Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin, S. Holroyd, T. Hornsby, K. Jagels, A. Krogh, J. McLean, S. Moule, L. Murphy, K. Oliver, J. Osborne, M. A. Quail, M.-A. Rajandream, J. Rogers, S. Rutter, K. Seeger, J. Skelton, R. Squares, S. Squares, J. E. Sulston, K. Taylor, S. Whitehead, and B. G. Barrell. 1998. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393:537-544[CrossRef][Medline]. |
| 8. | Dabbs, E. R., B. Gowan, S. Quan, and S. J. Andersen. 1995. Development of improved Rhodococcus plasmid vectors and their use in cloning genes of potential commercial and medical importance. Biotechnologia 7-8:129-135. |
| 9. | Desomer, J., M. Crespi, and M. Van Montagu. 1991. Illegitimate integration of non-replicative vectors in the genome of Rhodococcus fascians upon electrotransformation as an insertional mutagenesis system. Mol. Microbiol. 5:2115-2124[Medline]. |
| 10. |
Drobni , K.,
L. Kri aj,
F. Guben ek, and R. Komel.
1993.
Improved purification of steroid 1:2-dehydrogenase from Nocardia opaca and partial characterization of its cloned gene sequence.
Biochem. Biophys. Res. Commun.
190:509-515[CrossRef][Medline].
|
| 11. | Finnerty, W. R. 1992. The biology and genetics of the genus Rhodococcus. Annu. Rev. Microbiol. 46:193-218[CrossRef][Medline]. |
| 12. |
Florin, C.,
T. Köhler,
M. Grandguillot, and P. Plesiat.
1996.
Comamonas testosteroni 3-ketosteroid- 4(5 )-dehydrogenase: gene and protein characterization.
J. Bacteriol.
178:3322-3330 |
| 13. |
Itagaki, E.,
T. Wakabayashi, and T. Hatta.
1990.
Purification and characterization of 3-ketosteroid- 1-dehydrogenase from Nocardia corallina.
Biochim. Biophys. Acta
1038:60-67[CrossRef][Medline].
|
| 14. |
Jäger, W.,
A. Schäfer,
A. Pühler,
G. Labes, and W. Wohlleben.
1992.
Expression of the Bacillus subtilis sacB gene leads to sucrose sensitivity in the gram-positive bacterium Corynebacterium glutamicum but not in Streptomyces lividans.
J. Bacteriol.
174:5462-5465 |
| 15. | Kaufmann, G., H. Thole, R. Kraft, and P. Atrat. 1992. Steroid-1-dehydrogenase of Rhodococcus erythropolis: purification and N-terminal amino acid sequence. J. Steroid Biochem. Mol. Biol. 43:297-301[CrossRef][Medline]. |
| 16. | Kieslich, K. 1985. Microbial side-chain degradation of sterols. J. Basic Microbiol. 25:461-474[Medline]. |
| 17. | Larkin, M. J., R. De Mot, L. A. Kulakov, and I. Nagy. 1998. Applied aspects of Rhodococcus genetics. Antonie Leeuwenhoek 74:133-153. |
| 18. | Lestrovaja, N. N., S. Dänhardt, and C. Hörhold. 1978. Steroidumwandelnde Enzyme aus Mikroorganismen. V. Reinigung einer 4-En-3-oxosteroid: (Akzeptor)-1-en-oxidoreductase aus Nocardia opaca und Charakterisierung der prosthetischen Gruppe. Z. Allg. Mikrobiol. 18:189-196[Medline]. |
| 19. |
Levy, H. R., and P. Talalay.
1959.
Bacterial oxidation of steroids. I. Ring A dehydrogenations by intact cells.
J. Biol. Chem.
234:2009-2013 |
| 20. |
Levy, H. R., and P. Talalay.
1959.
Bacterial oxidation of steroids. II. Studies on the enzymatic mechanism of ring A dehydrogenation.
J. Biol. Chem.
234:2014-2021 |
| 21. | Mahato, S. B., and S. Garai. 1997. Advances in microbial steroid biotransformation. Steroids 62:332-345[CrossRef][Medline]. |
| 22. | Martin, C. K. A. 1977. Microbial cleavage of sterol side chains. Adv. Appl. Microbiol. 22:29-58[Medline]. |
| 23. |
Molnár, I.,
K.-P. Choi,
M. Yamashita, and Y. Murooka.
1995.
Molecular cloning, expression in Streptomyces lividans, and analysis of a gene cluster from Arthrobacter simplex encoding 3-ketosteroid- 1-dehydrogenase, 3-ketosteroid- 5-isomerase and a hypothetical regulatory protein.
Mol. Microbiol.
15:895-905[CrossRef][Medline].
|
| 24. |
Morii, S.,
C. Fujii,
T. Miyoshi,
M. Iwami, and E. Itagaki.
1998.
3-Ketosteroid- 1-dehydrogenase of Rhodococcus rhodochrous: sequencing of the genomic DNA and hyperexpression, purification, and characterization of the recombinant enzyme.
J. Biochem.
124:1026-1032 |
| 25. |
Murray, V.
1989.
Improved double-stranded DNA sequencing using the linear polymerase chain reaction.
Nucleic Acids Res.
17:8889 |
| 26. |
Nagy, I.,
G. Schoofs,
F. Compernolle,
P. Proost,
J. Vanderleyden, and R. De Mot.
1995.
Degradation of the thiocarbamate herbicide EPTC (S-ethyl dipropylcarbamothioate) and biosafening by Rhodococcus sp. strain NI86/21 involve an inducible cytochrome P-450 system and aldehyde dehydrogenase.
J. Bacteriol.
177:676-687 |
| 27. | Nishiya, Y., and T. Imanaka. 1996. Analysis of interaction between the Arthrobacter sarcosine oxidase and the coenzyme flavin adenine dinucleotide by site-directed mutagenesis. Appl. Environ. Microbiol. 62:2405-2410[Abstract]. |
| 28. | Pealing, S. L., A. C. Black, F. D. C. Manson, B. Ward, S. K. Chapman, and G. A. Reid. 1992. Sequence of the gene encoding flavocytochrome c from Shewanella putrefaciens: a tetraheme flavoenzyme that is a soluble fumarate reductase related to the membrane-bound enzymes from other bacteria. Biochemistry 31:12132-12140[CrossRef][Medline]. |
| 29. |
Penasse, L., and M. Peyre.
1968.
Studies of 3-oxo steroid 1-oxidoreductase of Arthrobacter simplex.
Steroids
12:525-544[CrossRef][Medline].
|
| 30. |
Plesiat, P.,
M. Grandguillot,
S. Harayama,
S. Vragar, and Y. Michel-Briand.
1991.
Cloning, sequencing, and expression of the Pseudomonas testosteroni gene encoding 3-oxosteroid 1-dehydrogenase.
J. Bacteriol.
173:7219-7227 |
| 31. | Powell, J. A. C., and J. A. C. Archer. 1998. Molecular characterisation of a Rhodococcus oph operon. Antonie Leeuwenhoek 74:175-188[CrossRef][Medline]. |
| 32. | Quan, S., and E. R. Dabbs. 1993. Nocardioform arsenic resistance plasmid characterization and improved Rhodococcus cloning vectors. Plasmid 29:74-79[CrossRef][Medline]. |
| 33. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 34. | Sih, C. J., and R. E. Bennet. 1962. Steroid 1-dehydrogenase of Nocardia restrictus. Biochim. Biophys. Acta 56:587-592[CrossRef]. |
| 35. |
Strohl, W. R.
1992.
Compilation and analysis of DNA sequences associated with apparent streptomycete promoters.
Nucleic Acids Res.
20:961-974 |
| 36. |
Verhasselt, P.,
F. Poncelet,
K. Vits,
A. Van Gool, and J. Vanderleyden.
1989.
Cloning and expression of a Clostridium acetobutylicum -amylase gene in Escherichia coli.
FEMS Microbiol. Lett.
59:135-140.
|
| 37. |
Vogt-Singer, M. E., and W. R. Finnerty.
1988.
Construction of an Escherichia coli-Rhodococcus shuttle vector and plasmid transformation in Rhodococcus spp.
J. Bacteriol.
170:638-645 |
| 38. | Wagner, B., P. G. Atrat, J. E. Clark-Curtiss, and M. Wagner. 1992. Localization of the steroid 1-dehydrogenase in Rhodococcus erythropolis IMET 7030 by immunoelectron microscopy. J. Basic Microbiol. 32:65-71[Medline]. |
| 39. | Wagner, M., P. G. Atrat, B. Wagner, V. Hanemann, and J. E. Clark-Curtiss. 1992. Overexpression of a Rhodococcus erythropolis protein in Escherichia coli with immunological identity to the Rhodococcus steroid 1-dehydrogenase. Immunoelectron microscopic localization and electrophoretic studies. J. Basic Microbiol. 32:269-277[Medline]. |
| 40. | Warhurst, A. M., and C. A. Fewson. 1994. Biotransformations catalyzed by the genus Rhodococcus. Crit. Rev. Biotechnol. 14:29-73[Medline]. |
| 41. | Wovcha, M. G., K. E. Brooks, and L. A. Kominek. 1979. Evidence for two steroid 1,2-dehydrogenase activities in Mycobacterium fortuitum. Biochim. Biophys. Acta 574:471-479[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»