Previous Article | Next Article ![]()
Applied and Environmental Microbiology, July 2000, p. 2906-2913, Vol. 66, No. 7
Laboratory of Microbial Ecology and
Technology1 and Laboratory of
Microbiology,2 Ghent University, B-9000
Ghent, Belgium
Received 10 December 1999/Accepted 17 April 2000
A strain identified as Comamonas testosteroni I2 was
isolated from activated sludge and found to be able to mineralize
3-chloroaniline (3-CA). During the mineralization, a yellow
intermediate accumulated temporarily, due to the distal
meta-cleavage of chlorocatechol. This strain was tested for
its ability to clean wastewater containing 3-CA upon inoculation into
activated sludge. To monitor its survival, the strain was chromosomally
marked with the gfp gene and designated I2gfp.
After inoculation into a lab-scale semicontinuous activated-sludge (SCAS) system, the inoculated strain maintained itself in the sludge
for at least 45 days and was present in the sludge flocs. After an
initial adaptation period of 6 days, complete degradation of 3-CA was
obtained during 2 weeks, while no degradation at all occurred in the
noninoculated control reactor. Upon further operation of the SCAS
system, only 50% 3-CA removal was observed. Denaturing gradient gel
electrophoresis (DGGE) of 16S rRNA genes revealed a dynamic change in
the microbial community structure of the activated sludge. The DGGE
patterns of the noninoculated and the inoculated reactors evolved after
7 days to different clusters, which suggests an effect of strain
inoculation on the microbial community structure. The results indicate
that bioaugmentation, even with a strain originating from that
ecosystem and able to effectively grow on a selective substrate, is not
permanent and will probably require regular resupplementation.
Bioaugmentation is the accelerated
removal of undesired compounds from contaminated hazardous waste sites
or bioreactors by using indigenous or allochthonous wild-type or
genetically modified organisms (48). These inocula usually
are highly efficient in the removal of the xenobiotic targets under
laboratory conditions. However, under natural conditions, these
laboratory strains have to compete with the established microbial
community, resulting in a decrease of the amount of inoculated cells
(15). This competition can be controlled by adding a carbon
source that the inoculant can degrade (5) or by changing
operation parameters (14). Thus far in water treatment, only
a few successful cases of small-scale bioaugmentation in activated
sludge by using natural or genetically modified microorganisms have
been described. McClure et al. (27) obtained enhanced but
incomplete degradation of 3-chlorobenzoate (3CB) in a laboratory-scale
activated-sludge unit after inoculation of activated-sludge-derived
bacteria (28) able to mineralize 3CB. Nüblein et al.
(32) inoculated a laboratory-scale activated-sludge unit
with Pseudomonas sp. strain B13 FR1(pFRC20P) and observed a
drastic decrease of 3CB and 4CB 3 days after inoculation, while in the
noninoculated reactor 8 and 15 days of adaptation, respectively, were
needed. Selvaratnam et al. (37) inoculated a sequencing batch reactor with Pseudomonas putida PP301(pO103) to remove
phenol, and ca. 85% of the phenol was degraded within 2.5 h.
Little is known about the effect of bioaugmentation of activated-sludge reactors on the microbial community of 16S rRNA genes. Eichner et al.
(10) used thermal gradient gel electrophoresis (TGGE) to
examine the effect of a pollutant shock on the activated-sludge microbial community and observed protection by the inoculation of a
genetically modified strain able to avoid formation of toxic intermediates. The addition of specialized strains to activated sludge
to enhance the removal of pollutants present in the influent is not yet
widely applied, because bioaugmentation is less predictable and
controllable than the direct destruction of contaminants, such as incineration.
Aromatic amines, such as chloroanilines, are widely used for the
production of dyes, drugs, and herbicides (22) and as a consequence of their application are released in the environment. These compounds are also introduced via the metabolism of phenylamide pesticides (17). These toxic and recalcitrant residues are
considered important environmental pollutants (30).
Therefore, many efforts were made to isolate bacteria capable of
degrading chlorinated anilines. Moraxella sp. strain G
(54) is the first isolate that was found to be able to use
4-chloroaniline as the sole source of carbon, nitrogen, and energy.
Later, more chloroaniline-metabolizing strains were isolated, such as
Pseudomonas sp. strain JL2 (23), Pseudomonas (now Brevundimonas)
diminuta INMI KS-7 (42), Pseudomonas (now Delftia) acidovorans CA28 (24),
Pseudomonas (now Delftia) acidovorans
BN3.1 (8), Aquaspirillum sp. strain 2CA, and
Paracoccus denitrificans 3CA (41). The first step
in the degradation of chloroanilines is the deamination to
chlorocatechols. These chlorinated catechols seem to be usually
degraded by a modified ortho-cleavage pathway (19,
55), but recently, the use of a meta-cleavage pathway
for the mineralization of 3-chlorocatechol has been determined (21, 26). In the past, the meta-cleavage
intermediates of chlorinated catechols, e.g., chlorohydroxymuconic
semialdehyde, were described as toxic metabolites preventing further
degradation (24).
The aims of this work were to isolate and characterize the microbial
component of activated sludge that is able to degrade 3-chloroaniline
(3-CA) and to investigate the eventual enhanced degradation of 3-CA by
the activated sludge after inoculation with the strain. In addition,
the effect of inoculation on the microbial community structure of the
sludge was examined.
Media and culture conditions.
The mineral medium MMN
(mineral medium without nitrogen and carbon) is derived from MMO
mineral medium (39) by eliminating all nitrogen. The MMN
medium contained 1,419.6 mg of Na2HPO4, 1,360.9 mg of KH2PO4, 98.5 mg MgSO4, 5.88 mg of CaCl2 · 2H2O, 1.16 mg of
H3BO4, 2.78 mg of FeSO4 · 7H2O, 1.15 mg of ZnSO4 · 7H2O, 1.69 mg of MnSO4 · H2O, 0.38 mg of CuSO4 · 5H2O, 0.24 mg of CoCl2 · 6H2O, 0.10 mg of MoO3, and 3.2 mg of EDTA in 1 liter of distilled water. The liquid mineral media were supplemented with 150 to 250 mg of aniline (Sigma-Aldrich Chemie, Steinheim, Germany) or 3-CA (Fluka AG Chemische Fabrik, Buchs, Switzerland) per
liter, while for the solidified media, aniline and 3-CA were added at a
concentration of 500 mg/liter. Luria broth (LB) medium containing
10 g of Bacto Peptone (Difco, Detroit, Mich.), 5 g of Bacto
yeast extract (Difco), and 5 g of NaCl in 1 liter of distilled
water was used as a rich medium. These media were solidified with 2%
agar for plate growth.
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Bioaugmentation of Activated Sludge by an
Indigenous 3-Chloroaniline-Degrading Comamonas
testosteroni Strain, I2gfp
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Isolation and characterization of Comamonas testosteroni I2. Strain I2 was isolated from an enrichment culture obtained from activated sludge of a domestic wastewater treatment plant (Bourgoyen-Ossemeersen plant, Gent, Belgium) after repeated supplementation with 3-CA. During 6 weeks a 1-liter Erlenmeyer flask containing 200 ml of the activated sludge (4 g [dry weight] per liter) was supplemented every 7 days with 200 mg of 3-CA/liter. After 6 weeks, a 0.5-liter Erlenmeyer flask containing 200 ml of MMN with 3-CA (200 mg/liter) was inoculated with 2 ml of the activated sludge. After 6 days, 2 ml of this enrichment culture was transferred to a new 0.5-liter Erlenmeyer flask with 200 ml of MMN with 3-CA (200 mg/liter). After another 6 days, this culture was spread onto MMN-3-CA agar plates (500 mg of 3-CA/liter) and incubated at 28°C for 1 week.
Identification of the isolate. Gas chromatographic analysis of fatty acid methyl esters (FAME) was performed as described previously (49). The FAME profiles were identified using the Microbial Identification System, version 4.0 (Microbial ID, Inc., Newark, Del.).
For sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis, cells were harvested from tryptic soy agar (BBL) plates after 48 h of incubation at 37°C. Preparation of the cell extract, gel electrophoresis, and numerical comparison were performed as previously described (34) and by using the GelCompar 4.1 software package (Applied Maths, Kortrijk, Belgium). DNA was enzymatically degraded into nucleosides as described by Mesbah et al. (29). The nucleoside mixture obtained was then separated by high-performance liquid chromatography (HPLC) using a Waters SymmetryShield C8 column thermostated at 37°C. The solvent was 0.02 M NH4H2PO4 (pH 4.0) with 1.5% acetonitrile. Nonmethylated lambda phage DNA (Sigma-Aldrich Chemie) was used as the calibration reference. DNA-DNA hybridizations were performed with photobiotin-labeled probes in microplate wells as described by Ezaki et al. (13), using an HTS7000 BioAssay Reader (Perkin-Elmer, Norwalk, Conn.) for the fluorescence measurements. The hybridization temperature was 55°C.Marking with gfp.
Escherichia coli strain C118
pir(pUT-miniTn5 gfpKm) (18, 46) was obtained
by transformation (9). The pUT plasmid, comprising a
mini-Tn5 transposon with RP4 resolvase sites flanking the
nptII gene (responsible for kanamycin resistance), was used for insertion of the gfp gene into the chromosome of strain
I2. Biparental mating between the donor strain E. coli C118
pir (18) and the recipient strain I2 with selection on LB
plates with rifampin (100 mg/liter) and kanamycin (50 mg/liter)
resulted in I2gfp derivatives with the nptII and
gfp genes inserted in the chromosome. This was confirmed by
PCR with gfp primers (see below).
SCAS reactors. The experiments were conducted in duplicate with sludge freshly collected from a domestic wastewater treatment plant (Bourgoyen-Ossemeersen). The total bacterial count of the sludge was 4.4 × 108 bacteria/ml, determined with a Live/Dead Bacterial Viability Kit (L-13152; Molecular Probes, Eugene, Oreg.) as described by according to Boulos et al. (7). The reactors, with a volume of 1.1 liters, were operated according to the semicontinuous activated-sludge (SCAS) procedure at room temperature (ca. 21°C). The tests were conducted with synthetic influent consisting of skim milk powder (Gloria, Nestlé) dissolved in tap water. The use of skim milk powder allowed the use of a constant wastewater that was rich in nutrients, with a chemical oxygen demand (COD)/N/P ratio equal to 100:6:1. The reactors were fed every day after wastage of excess sludge and settling. The SCAS reactors were operated at a volumetric loading rate of 1 g of COD/liter · day, with a hydraulic retention time of 4 days and a sludge retention time of 11 days. All four reactors had a loading rate of 40 mg of 3-CA/liter · day, added as a daily single dose. One liter of the mixed liquor was subjected to a half-hour period of settling in an Imhoff cone to analyze the sludge volume (SV) (16). On days 1, 3, and 5 of each week, the settling was followed by decantation of 400 ml of the supernatant and addition of 500 ml of fresh influent. The wasted sludge was used for analyze as follows: at day 1 of the week, a DNA extraction of the sludge was performed, and the pH, oxygen uptake rate (OUR), and concentration of strain I2gfp were determined; daily, an HPLC sample was taken and the suspended solids (SS) and sludge volume index (SVI) were measured (16). Two duplicate reactors were inoculated with C. testosteroni I2gfp (reactors A), and two duplicate reactors were used as noninoculated controls (reactors B). No important differences could be observed between the two duplicate reactors. Hence, unless otherwise indicated, the data reported are averages for both duplicates. The reactors were operated without 3-CA for 12 days to allow the microbial community to adapt to the changed environment and growth conditions. After this period, reactors A were inoculated with C. testosteroni I2gfp to a final concentration of 3 × 106 cells/ml. The cells were pregrown overnight in LB medium containing 100 mg of 3-CA/liter, washed twice with saline, and finally resuspended in saline.
Bacterial counts. Sludge flocs were dispersed by purging a 1-ml sample five times through a sterile syringe of 1 ml with a needle (1.2 by 40 mm). LB agar medium, supplemented with rifampin (100 mg/liter) and kanamycin (50 mg/liter) was used to count the I2gfp cells. By using green fluorescent protein fluorescence, it was possible to detect 10 CFU of strain I2gfp per ml against the background of about 103 CFU of total kanamycin- and rifampin-resistant microorganisms per ml.
UV-light microscopy. The sludge samples were analyzed by UV-light microscopy using a Reichert-Jung Polyvar microscope equipped with an Mercury short arc lamp HBO (200 W). Samples were examined with 40× and 100× objectives, using very-low-fluorescence immersion oil.
Respirometric activity measurements. The metabolic activity of the activated sludge in general was expressed as OUR. Therefore, activated-sludge samples (200 ml) were transferred to the vessel and saturated with oxygen by bubbling air with a pump. Once oxygen saturation (ca. 8 mg of O2/liter) was reached, the aeration was ceased and the oxygen electrode (Oxyguard Probe; Kelma, Niel, Belgium) was placed in such a way that the opening of the vessel was barely closed. Sodium acetate was added to a final concentration of 50 mg/liter. Samples were mixed with a magnetic stirrer during measurements. The method was further performed as described by Surmacz-Gorska et al. (40), calculating the activity from the constant slope of oxygen concentration over time. The activity measurements resulted in the OUR (grams of O2 per liter per day).
Analytical methods. The supernatants of cultures were analyzed for 3-CA content by reversed-phase HPLC after centrifugation of the cells at 5,000 × g for 10 min. The HPLC system consisted of a Kontron liquid chromatograph with a DEGASYS DG-1310 system to degas the mobile phase, three Kontron 325 high-pressure pumps, a Kontron MSI 660 injector with a 20-µl loop, a Kontron DAD 495 diode array detector, and a 450 MT2/DAD software system. An Alltima C18 reversed-phase column (250 by 8 mm [inner diameter], 5-µm particle size; Alltech, Deerfield, Ill.) was used. The mobile phase consisted of CH3OH-NH4H2PO4 (0.1 M, pH 3.8)-H2O (70:25:5), with a flow rate of 0.75 ml/min. The UV detector was used at 210 nm. Quantitative data for 3-CA were obtained by comparing the peak areas of unknown concentrations with the peak areas of standards of known concentrations.
The absorption spectra were recorded on a Kontron Uvikon spectrophotometer (model 932).DNA extraction and purification.
Total DNA was extracted
from the sludge samples by a method based on the protocols described
previously (11, 12). This protocol was modified as follows.
Two milliliters of sludge was added to a 14-ml polypropylene
round-bottom tube (Falcon). To this, 3 g of beads (0.10- to
0.11-mm-diameter) (B. Braun Biotech International, Melsungen, Germany)
and 4 ml of 10 mM Tris-HCl (pH 9) were added. The mixture was beaten
three times for 90 s using a bead beater (B. Braun Biotech
International) at 2,000 rpm. Then, 2 ml of 4 mg of lysozyme per ml in
10 mM Tris-HCl (pH 9) was added, followed by incubation of the samples
for 15 min at 28°C on a rotary shaker. Subsequently, 300 µl of 20%
SDS was added, and samples were slowly mixed for 5 to 10 min. After
this, 1 ml of 8 M ammonium acetate was added. The supernatant was
collected after centrifugation at 7,000 × g for 15 min
at 4°C. A chloroform-isoamyl alcohol (24:1) purification was done,
followed by centrifugation at 7,000 × g for 15 min at
4°C. The aqueous phase was transferred to a new tube, and 0.8 volume
of isopropanol was added. The precipitation was performed for 1 h
at
20°C. Alternatively, 2.5 volumes of ethanol (100%) were added
for overnight precipitation. The pellet (crude extract) was obtained by
centrifugation at 12,000 × g for 25 min and was
resuspended in 250 µl of distilled water. A 100-µl aliquot of the
crude extract was further purified using Wizard PCR preps (Promega,
Madison, Wis.), and the purified DNA was finally recovered in 50 µl
of distilled water.
20°C. Two microliters of the lysed cells was
used in the PCR.
PCR conditions. Two microliters of the extracted DNA was amplified by PCR with a 9600 thermal cycler (Perkin-Elmer). The PCR mixture used contained 0.5 µM each primer, 200 µM each deoxynucleoside triphosphate, 1.5 mM MgCl2, 10 µl of thermophilic DNA polymerase 10× reaction buffer (MgCl2 free), 2.5 U of Taq DNA polymerase (Promega), 400 ng of bovine serum albumin (Boehringer) per µl, and DNase- and RNase-free filter-sterilized water (Sigma-Aldrich Chemie) to a final volume of 100 µl.
Repetitive extragenic palindromic (REP)-PCR was done as described by Versalovic et al. (50) to distinguish identical isolates. The gfp gene was amplified by PCR with a set of primers based on specific regions of the gfp sequence (GenBank accession number M62653). The set consisted of the primer gfpF (5'CCATGGCCAACACTTGTCAC3' [forward]) and gfpR (5'CTTTCGAAAGGGCAGATTGT3' [reverse]). The 16S rRNA genes from sludge microbial communities were amplified by PCR as suggested by El Fantroussi et al. (12), using the forward primer P63f (5'CAGGCCTAACACATGCAAGTC3') and the reverse primer P518r (5'ATTACCGCGGCTGCTGG3') (31, 33). A GC clamp of 40 bp (31, 33) was added to the forward primer. The length of the expected amplified fragment with the GC clamp was 530 bp.DGGE. Denaturing gradient gel electrophoresis (DGGE) based on the protocol of Muyzer et al. (31) was performed using the D Gene System (Bio-Rad, Hercules, Calif.). PCR samples were loaded onto 6% (wt/vol) polyacrylamide gels in 1× TAE (20 mM Tris, 10 mM acetate, 0.5 mM EDTA, pH 7.4). The polyacrylamide gels were made with a denaturing gradient ranging from 40 to 60% (where 100% denaturant contains 7 M urea and 40% formamide). The electrophoresis was run for 14 h at 60°C and 50 V. After the electrophoresis, the gels were soaked for 5 min in fixation buffer (10% ethanol, 0.5% acetic acid) and subsequently for 10 min in SYBR GreenI nucleic acid gel stain (1:10,000 dilution; FMC BioProducts, Rockland, Maine). The stained gel was immediately photographed on a UV transillumination table with a video camera module (Vilbert Lourmat, Marne-la Vallé, France).
Analysis of DGGE patterns. The statistical comparison of the DGGE patterns on the same gel was done with the GelCompar software 4.1 (Applied Maths). The calculation of the matrix of similarities is based on the Pearson product-moment correlation coefficient. The clustering algorithm of Ward (51) was used to calculate dendrograms.
| |
RESULTS |
|---|
|
|
|---|
Characterization of C. testosteroni I2. The enrichment culture described above was plated on MMN medium to obtain single colonies. The purified colonies were tested in liquid MMN medium with 3-CA (200 mg/liter) and on plates with 3-CA (500 mg/liter) as the sole source of carbon, nitrogen, and energy. By further selection, five strains (named I2, I5, I6, I8, and I9) which could use 3-CA as the sole source of carbon, nitrogen, and energy were isolated. These five strains had nucleotide compositions of between 61.6 and 61.9 mol% guanosine plus cytosine and identical SDS-polyacrylamide gel electrophoresis and REP-PCR profiles (data not shown) and were identified via FAME analysis (using the commercial MIS database) as C. testosteroni. In DNA-DNA hybridization experiments, these five strains showed a DNA reassociation of between 68 and 76% with C. testosteroni LMG 1800T (25), while reassociation values within these five isolates were between 88 and 100%. The isolates were therefore identified as C. testosteroni. Since none of the techniques used could differentiate between the strains, they probably have a clonal origin.
During the growth of these 3-CA-assimilating strains in MMN medium (both liquid and solid) with 3-CA as the sole carbon, nitrogen, and energy source, a yellow coloration of the medium developed and disappeared again after prolonged incubation. On LB agar plates, the strains showed phenotypic instability, resulting in two types of colonies with different morphologies. Further purification of both types of colonies continued to yield a mixture of both types.Degradation of 3-CA and aniline by C. testosteroni I2
in pure culture.
When a 0.1% inoculum is used, C. testosteroni strain I2 can metabolize aniline and 3-CA as the sole
source of carbon, nitrogen, and energy in ca. 80 h (Fig.
1). In order to quantify the yellow intermediate, a wavelength scan of the medium between 200 and 400 nm
was performed at different times of incubation of the growth culture.
During the first 48 h, no visual changes were observed and no 3-CA
was degraded. After 48 h, the culture ended the lag phase and the
medium began to become yellow (Fig. 1). One day later, the cells were
in the logarithmic phase and the intensity of the yellow color was
high. Until 77 h, this metabolite accumulated and at the same time
the concentration of 3-CA decreased equally. Once the absorption peak
at 380 nm had disappeared (82 h) (Fig. 1), the total 3-CA was
metabolized. An equimolar amount of chloride ions was released during
the degradation of 3-CA by strain I2 (data not shown).
|
Survival and activity of C. testosteroni
I2gfp in the SCAS reactors.
In order to monitor the
survival of strain I2 in activated sludge, it was chromosomally marked
with the gfp gene, which was expressed constitutively by a
PpsbA-promoter (46). The insertion of the
gfp gene in several transconjugants was confirmed by PCR with the gfp-specific primers gfpF and gfpR. The
gfp-marked strain I2gfp showed the same
degradation characteristics as the original strain in MMN medium (data
not shown). Before strain I2gfp was inoculated into the
sludge reactors (reactors A) and before 3-CA was added, the sludge was
adapted for 12 days to the operating SCAS system. At this point (day 0 in Fig. 2), the daily supplementation with 3-CA started. During the first 3 days, no degradation was observed
in any of the reactors. In the inoculated reactors A, enhanced
degradation was observed from day 4 until day 7, and during the next 12 days complete degradation of 3-CA was achieved. After 3 weeks, however,
the concentration of 3-CA increased and stabilized at a level
corresponding with ca. 50% degradation. A mass balance calculation of
3-CA in a reactor (with 0% degradation) showed that the concentration
of 3-CA fluctuated weekly, based on the daily addition and the washout.
No significant removal of 3-CA occurred in the control reactors B
during the first 30 days. However, from day 30, enhanced degradation
was observed in reactor B1, comparable to that in the inoculated
reactors. The other control duplicate, B2, did not show any enhanced
degradation.
|
Reactor performance characteristics.
At the beginning of the
3-CA supplementation, all reactors showed the same performance
parameters (OUR = 74 mg O2/liter · h; SS = 4.2 g/liter; SV = 250 ml/liter; SVI = 60 ml/liter; pH = 7.6). The OUR and pH of both reactor sets did not significantly differ
during the experiment (two-tailed t test;
= 0.05).
The OUR variability of different days of one week was rather high, but
the values were in the same range when the same days of different weeks
were compared. After a week, the concentration of SS in the control
reactors B decreased about 0.6 g/liter in comparison to that in
reactors A. The SV after 30 min in both reactors was significantly
different after ca. 1 week (two-tailed t test;
= 0.05). During the first week, the SV of reactors A increased from 300 to 500 ml, and it remained at 500 ml for the rest of the experiment.
The SV of the control reactors B was stable at 300 ml during the first
40 days, and it increased only slightly during the last week. This
resulted in a significant difference between the SVI values of the
reactors (two-tailed t test;
= 0.05) (data not shown).
DGGE.
In order to monitor the changes within the microbial
community of the SCAS reactors, the diversity of a 16S rRNA fragment was examined. Each week, a sample was taken from the four reactors, and
after DNA extraction and purification, the PCR-amplified product was
analyzed on a DGGE gel (Fig. 3A and B).
The patterns of the four reactors were compared with each other after
normalization. To determine the information content of the banding
patterns in terms of structural diversity, they were analyzed by
clustering (Fig. 3C). The cluster analysis revealed three major groups.
The fingerprints showed several very strong bands, some bands of lower intensity, and an additional number of weak bands, resulting in a
smear. Before the adaptation period started (day
12) and at the day
of the inoculation and feeding with 3-CA (day 0), the DGGE patterns of
both reactors at both times clustered together. After the first week
(day 7), each reactor series began to develop a different microbial
community, which was clearly separated from that of the other reactor
series and from the earlier days of the experiment. On some bands,
corresponding with a bacterial species, the applied treatment and the
inoculation had no influence. Some bands became dominant in the
reactors, while other bands vanished. The intensity of some fragments
seems to be enhanced by the presence of strain I2gfp, while
other species were disfavored by the inoculation.
|
| |
DISCUSSION |
|---|
|
|
|---|
Several bacterial species capable of degrading 3-CA are known (8, 23, 24, 41, 42, 54). Strain I2, isolated and described in this study, is to our knowledge the first reported strain of C. testosteroni that is able to use 3-CA as the sole source of carbon and nitrogen. This species, which is often isolated from activated sludge, is resistant to starvation (28) and has been reported to be involved in the degradation of many aromatic products, such as (chloro)phenols (1, 2), p-toluenesulfonic acid (3), polychlorinated biphenyls (4), arylsulfonates (20), 1-(2-chlorobenzoyl)-3-(4-chlorophenyl)urea (38), and chlorinated benzenes (45).
In pure culture, complete degradation was achieved at 3-CA
concentration of 200 mg/liter and was coupled with quantitative liberation of chloride. During the degradation of 3-CA, a yellow intermediate accumulated temporarily, which was further metabolized, thus indicating total metabolism of the aromatic amines. The
chlorinated catechols seem to usually be degraded by a modified
ortho-cleavage pathway (19, 55). Recently, the
use of a meta-cleavage pathway for the mineralization of
3-chlorocatechol as central metabolite of chlorobenzene has been
determined (21, 26). Riegert et al. (35) observed
a yellow distal meta-cleavage product of 3-chlorocatechol with a strongly pH-dependent absorption maximum at 378 nm and found
that this was a chlorohydroxymuconic semialdehyde. In our study, the
max values at the different pHs were very similar. This
comparison suggests that the degradation of 3-CA by C. testosteroni I2 also occurs by means of a distal
meta-cleavage pathway for chlorocatechol. This is in
contrast with the case for most other chloroaniline degraders, which
have been shown to degrade 3-CA via a modified
ortho-cleavage pathway (19, 55). Only one study, by Surovtseva et al. (43), mentioned a
meta-cleavage of monochloroanilines by Alcaligenes
faecalis; however, it is not clear if this cleavage was metabolic
or cometabolic.
In this paper, the 3-CA degrading indigenous activated-sludge bacterium C. testosteroni I2 was used to accelerate the removal of 3-CA from wastewater by reinoculating the strain at high density into the same sludge system. The initial sludge microbial community was not able to effectively degrade 3-CA, although strain I2 was probably present, since it was isolated from the same activated-sludge plant. Apparently the natural level of the indigenous strain C. testosteroni I2 was too low to effect the degradation of 3-CA. To distinguish the inoculated strain from identical or similar indigenous sludge bacteria, the strain was chromosomally marked with the gfp gene. The plating method, combined with the gfp visualization with UV light, allowed sensitive and reliable monitoring of the survival of the inoculated strain and was preferred over PCR amplification of the gfp gene, which was not as reliable and sensitive. Similar difficulties with PCR-based strain detection were described by Tchelet et al. (45), who used specific primers for the 16S rRNA gene and chlorobenzene degradation (tcb) genes to monitor an inoculated Pseudomonas strain in activated sludge. Their study and ours thus show that plating can still be a reliable method when the strain has natural or inserted (gfp-Km) specific phenotypes. It is not known, however, if this culturable fraction (CFU of I2gfp) resembles the total viable count of I2gfp in the sludge.
Successful bioaugmentation depends mainly on the behavior of the inoculated strain in the environment where it is introduced. Therefore, a first criterion is good survival and retention of the strain in the system. The growth rate of the organism may be lower than washout (52) and the rate of predation, for example, by protozoa, so that the activity of grazers reduces the cell density of the inoculum species (15). In our experiment, an equilibrium seemed to be reached between washout, predation, and growth rate after 3 weeks with an inoculum concentration of ca. 5 × 105 CFU of strain I2gfp per ml. The origin and the type of inoculated strain also can play an important role in the survival of the strain. Tchelet et al. (45) used Pseudomonas sp. strain P51, originally isolated from sediments, for a bioaugmentation experiment in a soil column and sewage sludge. The survival and activity of strain P51 in the soil column were successful, but the strain was not able to maintain itself in the sludge reactors and thus no degradation was observed. McClure et al. (27) showed that a sludge isolate, AS2, was able to reach a stable level after inoculation, in contrast to other inocula tested. Strain AS2 had a characteristic flocculation, which may have been an important factor in the survival. C. testosteroni I2gfp, used in this study, also maintained a stable population in the activated-sludge system. The original strain I2, also isolated from a sludge environment, tends to form clusters within the sludge flocs. This observation, together with the unstable colony morphology on agar plates, suggests the formation of exopolysaccharide production, which was described by Bossier and Verstraete (6). Those authors described C. testosteroni A20, which expresses a phenotypic shift between mucoid-colony-forming (MCF) cells and non-MCF cells under different conditions. When the strains were cultured under unfavorable conditions, the cells shifted to the hydrophobic non-MCF-form and dense flocs were formed, providing cellular protection. Under favorable conditions, MCF cells were formed and resulted in loose associations. The possibility that strain I2gfp changes phenotype under unfavorable conditions may be an important factor in the maintenance of a stable population in the SCAS reactor.
The second criterion for successful bioaugmentation is the activity of the inoculum. In our experiment, after an initial adaptation period of 6 days, complete degradation of 3-CA was obtained during 2 weeks, while no degradation at all occurred in the noninoculated control reactor. Upon further operation of the SCAS system, 50% 3-CA removal was observed. It seems that there is a correlation between the declining population density of C. testosteroni I2gfp and the lower 3-CA removal of the inoculated reactors. Although McClure et al. (27) could establish a stable population of the introduced strain in the sludge environment, no enhanced degradation of chlorobenzoate was observed. Different authors proposed that the inability of the inoculated strains to degrade the xenobiotics may have been due to the availability of alternative substrates (5, 15, 27, 28, 36, 44). However, C. testosteroni I2gfp received daily only 40 mg of 3-CA/liter together with 1 g of COD per liter (diluted milk powder) and performed its specific activity within 2 weeks. Two preliminary SCAS experiments with the same strain I2gfp showed a very similar positive effect on 3-CA degradation during at least 2 weeks (data not shown). This observation was corroborated by the findings that when the pure culture was grown in LB medium supplemented with 100 mg of 3-CA/liter, 3-CA was not detectable after 1 day (data not shown). The degradation of 3-CA by strain I2gfp therefore is not repressed by additional nutrients. Compared with the calculated 0% degradation curve, no degradation of 3-CA was observed in either of the noninoculated control reactors B within 4 weeks. However, during the fifth week, enhanced degradation was observed in one of the reactors, probably due to the enrichment of indigenous bacteria with degradative capacities. It has been reported that in some cases indigenous bacteria become capable of removing xenobiotics after a long exposure time, either by metabolism or by cometabolism (28, 32, 47, 53). However, in our parallel SCAS reactors, the differences in degradation rates between the inoculated and control reactors were striking and stable over a prolonged time period, suggesting that the bioaugmentation was effective and not ephemeral.
The microbial community structure of the SCAS reactors was monitored by DGGE of 16S rRNA genes. The changes of the patterns over time suggest that the structure of the microbial communities was not static but rather was dynamic. After 7 days, the microbial communities in both series of reactors evolved into separate clusters. The inoculated strain could not be seen in the DGGE patterns, most probably because its proportion of the total bacterial cell count was too small and a DGGE pattern reveals only the numerically dominant populations. Eichner et al. (10) investigated the bioprotection of activated sludge from pollutant shocks by the related method TGGE. Those authors observed subtle shifts in community structure during adaptation to laboratory conditions. In their tests, the microbiota of the noninoculated control reactor collapsed after the shock load of xenobiotics, resulting in both a lower OUR and a decrease in bands in the TGGE pattern. In our studies, the diversity of bands in the pattern of the control reactor did not decrease visibly, and no drastic changes in the reactor performance were observed during the experiment. This was confirmed by the OUR measurements, where no significant differences could be observed with the inoculated reactor. In contrast to a shock load, as applied by Eichner et al. (10), the continuous supplementation of low concentrations of 3-CA in our experiment gave the sludge time to adapt. Remarkably, the DGGE technique combined with clustering analysis revealed subtle responses to the inoculation of strain I2gfp. Indeed, some species seemed to be enriched after the inoculation, while others tended to be less abundant.
This work indicates that bioaugmentation of activated-sludge systems for specific trace organics, such as 3-CA, can be achieved successfully. Moreover, this work corroborates what is often experienced in the use of activated sludge systems, i.e., that inoculation with a specific strain generally has only a transient effect. The fact that even an indigenous strain is only temporarily effective in activated-sludge communities substantiates the experience that biological supplements for such systems have to be added on a regular basis in order to assure continuous treatment efficacy. Further research will be performed to try to prolong the period of efficient degradation by the inoculum.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by project grant G.O.A. (1997-2002) from the Ministerie van de Vlaamse Gemeenschap, Bestuur Wetenschappelijk Onderzoek (Belgium), by a research grant from the Flemish Fund for Scientific Research (F.W.O. Vlaanderen), and by the EU-concerted action MAREP. E.M. Top and P. De Vos are also indebted to F.W.O. Vlaanderen for positions as Research Associate and Research Director, respectively.
We thank S. Blomme and H. Lievens for their assistance during the preliminary experiments, J. Kielemoes for microscopic analysis, and W. Dejonghe, R. Wouters, S. De Wildeman, and I. Dhaese for critically reading the manuscript.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Ghent University, Faculty of Agricultural and Applied Biological Sciences, Laboratory of Microbial Ecology and Technology, Coupure Links 653, B-9000 Ghent, Belgium. Phone: 32 (0)9 264 59 76. Fax: 32 (0)9 264 62 48. E-mail: Eva.Top{at}rug.ac.be.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Arai, H., S. Akahira, T. Ohishi, M. Maeda, and T. Kudo. 1998. Adaptation of Comamonas testosteroni TA441 to utilize phenol: organization and regulation of the genes involved in phenol degradation. Microbiology 10:2895-2903. |
| 2. | Bae, H. S., J. M. Lee, Y. B. Kim, and S. T. Lee. 1997. Biodegradation of the mixtures of 4-chlorophenol and phenol by Comamonas testosteroni CPW301. Biodegradation 7:463-469. |
| 3. | Balashov, S. V., N. V. Balashova, and A. M. Boronin. 1997. Plasmid control of p-toluenesulfonic acid degradation in Comamonas testosteroni BS1310. Microbiology 66:52-56. |
| 4. | Barriault, D., and M. Sylvestre. 1993. Factors affecting PCB degradation by an implanted bacterial strain in soil microcosms. Can. J. Microbiol. 39:594-602[Medline]. |
| 5. | Blumenroth, P., and I. Wagner-Döbler. 1998. Survival of inoculants in polluted sediments: effect of strain origin and carbon source competition. Microb. Ecol. 35:279-288[CrossRef][Medline]. |
| 6. | Bossier, P., and W. Verstraete. 1996. Comamonas testosteroni colony phenotype influences exopolysaccharide production and coaggregation with yeast cells. Appl. Environ. Microbiol. 62:2687-2691[Abstract]. |
| 7. | Boulos, L., M. Prevost, B. Barbeau, J. Coallier, and R. Desjardins. 1999. LIVE/DEAD (R) BacLight (TM): application of a new rapid staining method for direct enumeration of viable and total bacteria in drinking water. J. Microbiol. Methods 37:77-86[CrossRef][Medline]. |
| 8. | Brunsbach, F. R., and W. Reineke. 1993. Degradation of chloroanilines in soil slurry by specialized organisms. Appl. Microbiol. Biotechnol. 40:2-3. |
| 9. |
Chung, C. T.,
S. L. Niemela, and R. H. Miller.
1989.
One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution.
Proc. Natl. Acad. Sci. USA
86:2172-2175 |
| 10. |
Eichner, C. A.,
R. W. Erb,
K. N. Timmis, and I. Wagner-Döbler.
1999.
Thermal gradient gel electrophoresis analysis of bioprotection from pollutant shocks in the activated sludge microbial community.
Appl. Environ. Microbiol.
65:102-109 |
| 11. | El Fantroussi, S., J. Mahillon, H. Navaeu, and S. N. Agathos. 1997. Introduction and PCR detection of Desulfomonile tiedjei in soil slurry microcosms. Biodegradation 8:125-133[CrossRef][Medline]. |
| 12. |
El Fantroussi, S.,
L. Verschuere,
W. Verstraete, and E. M. Top.
1999.
Effect of phenylurea herbicides on soil microbial communities estimated by analysis of 16S rRNA gene fingerprints and community-level physiological profiles.
Appl. Environ. Microbiol.
65:982-988 |
| 13. |
Ezaki, T.,
Y. Hashimoto, and E. Yabuuchi.
1989.
Fluorometric deoxyribonucleic acid-deoxyribonucleic acid hybridization in microdilution wells as an alternative to membrane filter hybridization in which radioisotopes are used to determine genetic relatedness among bacterial strains.
Int. J. Syst. Bacteriol.
39:224-229 |
| 14. | Fujita, M., M. Ike, and K. Uesugi. 1994. Operation parameters affecting the survival of genetically engineered microorganisms in activated sludge processes. Wat. Res. 28:1667-1672[CrossRef]. |
| 15. |
Goldstein, M. G.,
L. M. Mallory, and M. Alexander.
1985.
Reasons for possible failure of inoculation to enhance biodegradation.
Appl. Environ. Microbiol.
50:977-983 |
| 16. | Greenberg, A. E., L. S. Clesceri, and A. D. Eaton (ed.). 1992. Standard methods for the examination of water and wastewater, 18th ed. American Public Health Association, Washington, D.C. |
| 17. | Häggblom, M. M. 1992. Microbial breakdown of halogenated aromatic pesticides and related compounds. FEMS Microbiol. Rev. 9:29-71[Medline]. |
| 18. |
Herrero, M.,
V. de Lorenzo, and K. N. Timmis.
1990.
Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in gram-negative bacteria.
J. Bacteriol.
172:6557-6567 |
| 19. | Hinteregger, C., M. Loidl, and F. Streichsbier. 1992. Characterization of isofunctional ring-leaving enzymes in aniline and 3-chloroaniline degradation by Pseudomonas acidovorans CA28. FEMS Microbiol. Lett. 97:261-266[CrossRef]. |
| 20. | Junker, F., and A. M. Cook. 1997. Conjugative plasmids and the degradation of arylsulfonates in Comamonas testosteroni. Appl. Environ. Microbiol. 63:2403-2410[Abstract]. |
| 21. |
Kashabek, S. R.,
T. Kasberg,
D. Müller,
A. E. Mars,
D. B. Janssen, and W. Reineke.
1998.
Degradation of chloroaromatics: purification and characterization of a novel type of chlorocatechol 2,3-dioxygenase of Pseudomonas putida GJ31.
J. Bacteriol.
180:296-302 |
| 22. | Kearny, P. C., and D. D. Kaufman. 1975. Herbicides: chemistry, degradation and mode of action. Marcel Dekker, Inc., New York, N.Y. |
| 23. | Latorre, J., W. Reineke, and H. J. Knackmuss. 1984. Microbial metabolism of chloroanilines: enhanced evolution by natural genetic exchange. Arch. Microbiol. 140:159-165[CrossRef]. |
| 24. | Loidl, M., C. Hinteregger, G. Ditzelmueller, A. Ferschl, and F. Streichsbier. 1990. Degradation of aniline and monochlorinated anilines by soil-borne Pseudomonas acidovorans strains. Arch. Microbiol. 155:56-61[CrossRef]. |
| 25. |
Marcus, P., and P. Talalay.
1956.
Induction and purification of alpha- and beta-hydroxysteroid dehydrogenases.
J. Biol. Chem.
218:661-674 |
| 26. |
Mars, A. E.,
J. Kingma,
S. R. Kaschabek,
W. Reineke, and D. B. Janssen.
1999.
Conversion of 3-chlorocatechol by various catechol 2,3-dioxygenases and sequence analysis of the chlorocatechol dioxygenase region of Pseudomonas putida GJ31.
J. Bacteriol.
181:1309-1318 |
| 27. |
McClure, N. C.,
J. C. Fry, and A. J. Weightman.
1991.
Survival and catabolic activity of natural and genetically engineered bacteria in a laboratory-scale activated-sludge unit.
Appl. Environ. Microbiol.
57:366-373 |
| 28. |
McClure, N. C.,
A. J. Weightman, and J. C. Fry.
1989.
Survival of Pseudomonas putida UWC1 containing cloned catabolic genes in a model activated-sludge unit.
Appl. Environ. Microbiol.
55:2627-2634 |
| 29. | Mesbah, M., U. Premachandran, and W. B. Whitman. 1989. Precise measurement of the G+C content of deoxyribonucleic acid by high-performance liquid chromatography. Int. J. Syst. Bacteriol. 39:159-167. |
| 30. | Meyer, U. 1981. Biodegradation of synthetic organic colorants. Academic Press Inc., London, United Kingdom. |
| 31. |
Muyzer, G.,
E. C. de Waal, and A. Uitterlinden.
1993.
Profiling of complex microbial populations using denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA.
Appl. Environ. Microbiol.
59:695-700 |
| 32. |
Nüßlein, K.,
D. Maris,
K. Timmis, and D. F. Dwyer.
1992.
Expression and transfer of engineered catabolic pathways harbored by Pseudomonas spp. introduced into activated sludge microcosms.
Appl. Environ. Microbiol.
58:3380-3386 |
| 33. | Øvreås, L., L. Forney, F. L. Daae, and V. Torsvik. 1997. Distribution of bacterioplankton in meromictic Lake Saelevannet, as determined by denaturing gradient gel electrophoresis of PCR-amplified gene fragments coding for 16S rRNA. Appl. Environ. Microbiol. 63:3367-3373[Abstract]. |
| 34. | Pot, B., P. Vandamme, and K. Kersters. 1994. Analysis of electrophoretic whole organism protein fingerprints, p. 493-521. In M. Goodfellow, and A. G. O'Donnel (ed.), Modern microbial methods. Chemical methods in prokaryotic systematics. Wiley, Chichester, United Kingdom. |
| 35. |
Riegert, U.,
G. Heiss,
P. Fischer, and A. Stoltz.
1998.
Distal cleavage of 3-chlorocatechol by an extradiol dioxygenase to 3-chloro-2-hydromuconic semialdehyde.
J. Bacteriol.
180:2849-2853 |
| 36. |
Schmidt, S. K., and M. Alexander.
1985.
Effects of dissolved organic carbon and second substrates on the biodegradation of organic compounds at low concentrations.
Appl. Environ. Microbiol.
49:822-827 |
| 37. | Selvaratnam, S., B. A. Schoedel, B. L. McFarland, and C. F. Kulpa. 1995. Application of reverse transcriptase PCR for monitoring expression of the catabolic dmpN gene in a phenol-degrading sequencing batch reactor. Appl. Environ. Microbiol. 61:3981-3985[Abstract]. |
| 38. | Shi, G. H. 1992. Study on degradation and transformation of 1-(2-chlorobenzoyl)-3-(4-chlorophenyl) urea insecticide by soil microorganisms under needle and broad leaf forest. J. Environ. Sci. 4:37-45. |
| 39. | Stanier, R. Y., N. J. Palleroni, and M. Douderoff. 1966. The aerobic Pseudomonads: a taxonomic study. J. Gen. Microbiol. 43:159-271[Medline]. |
| 40. | Surmacz-Gorska, J., K. Gernaey, C. Demuynck, P. Vanrolleghem, and W. Verstraete. 1995. Nitrification process control in activated sludge using oxygen uptake rate measurements. Environ. Technol. 16:568-577. |
| 41. | Surovtseva, E. G., V. S. Ivoilov, G. K. Vasileva, and S. S. Belyaev. 1996. Degradation of chlorinated anilines by certain representatives of the genera Aquaspirillum and Paracoccus. Microbiology 65:553-559. |
| 42. | Surovtseva, G., V. S. Ivoilov, Y. N. Karasevich, and G. K. Vacileva. 1985. Chlorinated anilines, a source of carbon, nitrogen and energy for Pseudomonas diminuta. Microbiologiya 54:948-952. |
| 43. | Surovtseva, G., G. K. Vasileva, A. I. Vol Nova, and B. P. Baskunov. 1980. Destruction of monochloroanilines by the meta-cleavage by Alcaligenes faecalis. Doklady Akademii Nauk SSSR 254:226[Medline]. |
| 44. |
Swindoll, C. M.,
C. M. Aelion, and F. K. Pfaender.
1988.
Influence of inorganic and organic nutrients on aerobic biodegradation and on the adaptation response of subsurface microbial communities.
Appl. Environ. Microbiol.
54:212-217 |
| 45. | Tchelet, R., R. Meckenstock, P. Steinle, and J. R. van der Meer. 1999. Population dynamics of an introduced bacterium degrading chlorinated benzenes in a soil column and in sewage sludge. Biodegradation 10:113-125[CrossRef][Medline]. |
| 46. | Tombolini, R., A. Unge, M. E. Davey, F. J. De Bruijn, and J. K. Jansson. 1997. Flow cytometric and microscopic analysis of GFP-tagged Pseudomonas fluorescens bacteria. FEMS Microbiol. Ecol. 22:17-28. |
| 47. |
van der Meer, J. R.,
C. Werlen,
S. F. Nishino, and J. C. Spain.
1998.
Evolution of a pathway for chlorobenzene metabolism leads to natural attenuation in contaminated groundwater.
Appl. Environ. Microbiol.
64:4185-4193 |
| 48. | Van Limbergen, H., E. M. Top, and W. Verstraete. 1998. Bioaugmentation in activated sludge: current features and future perspectives. Appl. Microbiol. Biotechnol. 50:16-23[CrossRef]. |
| 49. |
Vauterin, L.,
P. Yang,
B. Hoste,
M. Vancanneyt,
E. L. Civerolo,
J. Swings, and K. Kersters.
1991.
Differentiation of Xanthomonas campestris pv. citri strains by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of proteins, fatty acid analysis, and DNA-DNA hybridization.
Int. J. Syst. Bacteriol.
41:535-542 |
| 50. | Versalovic, J., T. Koeuth, and J. Lupski. 1991. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res. 24:6823-6831. |
| 51. | Ward, J. H. 1963. Hierarchial grouping to optimize an objective function. J. Am. Stat. Assoc. 58:236-244[CrossRef]. |
| 52. |
Watanabe, K.,
S. Yamamoto,
S. Hino, and S. Harayama.
1998.
Population dynamics of phenol-degrading bacteria in activated sludge determined by gyrB-targeted quantitative PCR.
Appl. Environ. Microbiol.
64:1203-1209 |
| 53. | Weber, W. J. J., and H. X. Corseuil. 1994. Inoculation of contaminated subsurface soils with enriched indigenous microbes to enhance bioremediation rates. Wat. Res. 28:1407-1414[CrossRef]. |
| 54. | Zeyer, J., and P. C. Kearny. 1982. Microbial degradation of para-chloroaniline as sole source of carbon and nitrogen. Pestic. Biochem. Phys. 17:215-233[CrossRef]. |
| 55. |
Zeyer, J.,
A. Wasserfallen, and K. N. Timmis.
1985.
Microbial mineralization of ring-substituted anilines through an ortho-cleavage pathway.
Appl. Environ. Microbiol.
50:447-453 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | Microbiol. Mol. Biol. Rev. | Eukaryot. Cell | All ASM J |
|---|