Previous Article | Next Article ![]()
Applied and Environmental Microbiology, July 2000, p. 2981-2987, Vol. 66, No. 7
Laboratoire de
Biotechnologie-Bioprocédés, UMR INSA/CNRS 5504 and UMR INRA
792, Centre de Bioingénierie Gilbert Durand, Institut
National des Sciences Appliqueés, 31077 Toulouse
Cedex,1 and Institut de
Génétique et Microbiologie, UMR CNRS 8621,
Université Paris-Sud, Centre Universitaire d'Orsay, 91405 Orsay
Cedex,2 France
Received 10 March 2000/Accepted 12 May 2000
Malic enzyme is one of at least five enzymes, known to be present
in Corynebacterium glutamicum, capable of carboxylation and
decarboxylation reactions coupling glycolysis and the tricarboxylic acid cycle. To date, no information is available concerning the physiological role of the malic enzyme in this bacterium. The malE gene from C. glutamicum has been cloned
and sequenced. The protein encoded by this gene has been purified to
homogeneity, and the biochemical properties have been established.
Biochemical characteristics indicate a decarboxylation role linked to
NADPH generation. Strains of C. glutamicum in which the
malE gene had been disrupted or overexpressed showed no
detectable phenotype during growth on either acetate or glucose, but
showed a significant modification of growth behavior during lactate
metabolism. The wild type showed a characteristic brief period of
exponential growth on lactate followed by a linear growth period. This
growth pattern was further accentuated in a malE-disrupted
strain ( Corynebacterium
glutamicum is widely used in the industrial production of amino
acids, particularly L-glutamate and L-lysine. The modified carbon flux distribution during the shift from cell growth
to amino acid overproduction involves a high flux through the
anaplerotic reactions. In C. glutamicum, four carboxylating enzymes able to convert pyruvate or phosphoenolpyruvate
(PEP) to four-carbon atom dicarboxylic acids oxaloacetate (OAA) or
malate have been demonstrated, namely PEP carboxykinase (PPCk), PEP
carboxylase (PPC), pyruvate carboxylase (PC), and malic enzyme. A fifth
reaction, OAA decarboxylase, has also been demonstrated, but this
reaction is generally considered to operate only in the gluconeogenic
direction (22). To date, three of the carboxylating
anaplerotic enzymes have been characterized, although little
information exists concerning the properties of malic enzyme in
C. glutamicum. The PPCk catalyzes the reversible
carboxylation of PEP to OAA, although the strong inhibition of the
OAA-forming reaction by ATP indicates that this enzyme functions
predominantly as a gluconeogenic decarboxylase (21). The PPC
catalyzes the irreversible carboxylation of PEP to OAA. The enzyme was
purified and shown to be activated by acetylcoenzyme A (CoA) and
fructose-1,6-bisphosphate and inhibited by both aspartate and
Bacterial strains, plasmids, and growth conditions.
The
bacterial strains and plasmids used in this study, their relevant
characteristics, and their sources or references are given in Table
1. Escherichia coli strain
DH5
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Cloning of the Malic Enzyme Gene from
Corynebacterium glutamicum and Role of the Enzyme in
Lactate Metabolism
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
malE). However, the strain overexpressing
malE maintained exponential growth until all lactate had
been consumed. This strain accumulated significantly larger amounts of
pyruvate in the medium than the other strains.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-ketoglutarate (32, 33). This enzyme was initially
considered to be the major anaplerotic enzyme in C. glutamicum (51) and has been the target of genetic
engineering strategies to increase flux toward OAA (35, 46).
However, various groups (19, 37; L. Mathieu, C. Rollin, A. Guyonvarch, F. Wojeik, and N. D. Lindley, rDNA
Biotechnol. 4:Metab. Eng. I, poster abstr. 53, 1996) have demonstrated
that deletion of PPC has no significant effect on either growth or
amino acid production, except under biotin limitation. The PC catalyzes
the irreversible carboxylation of pyruvate to OAA. This activity was
first described by Tosaka et al. (50) and was postulated to
be the major anaplerotic enzyme during rapid growth on glucose
(10), although the enzyme has been notoriously difficult to
assay precisely. Recently, this biotin-dependent enzyme has been
characterized (38) and was shown to be inhibited by
acetyl-CoA, aspartate, and ADP. This enzyme was shown to be essential
for rapid growth on lactate, but deletion mutants retained their
capacity to grow on glucose (39). Double mutants lacking both PPC and PC activity were unable to grow on glucose
(39). Nuclear magnetic resonance (NMR) analysis has,
however, demonstrated that carboxylation of pyruvate accounts for
approximately 90% of the anaplerotic flux (36). Strains
lacking PPC activity grown under biotin limitation were unable to
synthesize glutamate (Mathieu et al., rDNA Biotechnol. 4:Metab. Eng. I,
poster abstr. 53, 1996), although some production of tricarboxylic acid
(TCA) intermediates did occur. This indicates that at least one other
anaplerotic reaction must be able to fuel the TCA cycle. Malic enzyme
catalyzes the reversible carboxylation of pyruvate to malate coupled
with NADPH oxidation. This activity has been measured in various
strains and under different growth conditions (9, 10, 18,
51), although the role of this activity has never been clearly
established. The fact that this enzyme can contribute to
NADP+-NADPH equilibrium has led to the suggestion that this
enzyme may play an important role in NADPH synthesis on substrates
other than glucose (9, 13). However, the role of malic
enzyme in the metabolism of C. glutamicum remains unclear,
and in view of the importance of NADP+-NADPH cycling in
this organism, it is necessary to establish the physiological role of
this enzyme. In this paper, the biochemical characterization of the
malic enzyme and the molecular analysis of the corresponding
malE gene of C. glutamicum are described. The
physiological role of malic enzyme has been investigated by studying
genetically engineered strains of C. glutamicum in which the
expression of the malE gene has been modified.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
was grown aerobically at 37°C in Luria-Bertani medium, with
the addition of ampicillin (100 µg/ml), kanamycin (25 µg/ml), and
Bacto agar when appropriate. For molecular studies, C. glutamicum 2262 was grown aerobically at 30°C in brain heart
infusion medium, with the addition of kanamycin (25 µg/ml) and Bacto
agar when appropriate. The medium and conditions for growth of C. glutamicum 2262 in 3.5-liter fermentors (Chemap) have been
described previously (8). The pH was maintained at 7.6 by
automatic addition of KOH or HCl depending on the substrate. The
cultures were inoculated with precultures grown overnight in shake
flasks at 30°C on a rotary shaker (200 rpm) with the same medium and
carbon source. The cell concentration was determined by
spectrophotometric A650 measurements after
dilution in fresh medium so as to remain within the optical linear
response range. The concentrations of glucose and organic acids in the
culture supernatant were determined as previously described
(18) by high-performance liquid chromatography with a
Bio-Rad HPX87H column at 48°C with H2SO4 (5 mM) as the eluant. Detection was performed with UV and refractometric
detectors. The C. glutamicum DNA bank used in this study was
described by Reyes et al. (42). Individual recombinant
E. coli clones were cultivated in 96-well microtitration plates and replica plated onto hybridization membranes. Membranes were
treated for colony hybridization as described by Ausubel et al.
(1), and master microtitration plates were stored at
80°C until used.
TABLE 1.
Bacterial strains and plasmids used in this study
DNA preparation and transformation. Plasmids from E. coli were isolated by the method of Birnboim (2). Plasmids and chromosomal DNA from C. glutamicum were obtained as described elsewhere (42). E. coli was transformed by electroporation (14) or by the CaCl2 method (44). C. glutamicum was transformed by electroporation (4). Oligonucleotide synthesis was performed as described by Caruthers et al. (6) with the Gene Assembler Plus from Pharmacia (Freiburg, Germany).
DNA manipulations. Restriction enzymes, T4 DNA ligase, Klenow polymerase, proteinase K, DNase I, and RNase A, were obtained from Boehringer (Mannheim, Germany) or from Promega (Madison, Wis.) and used as instructed by the manufacturers. DNA labelling and Southern and colony hybridization experiments were performed as previously described (1). PCR experiments were performed in a Crocodile II microprocessor controlled incubation system (Appligene Oncor, Illkirch, France) with Ampli Taq Gold polymerase and its buffer from Perkin-Elmer (Foster City, Calif.). PCR consisted of a 10-min incubation at 94°C, followed by 35 amplification cycles (1 min at 94°C, 1 min at 50°C, 1 min at 72°C for each cycle). Plasmid pMF12 was sequenced by the dideoxy chain termination method (45) on a model 373 DNA sequencing system from Applied Biosystems. Sequencing was performed by a DNA walking approach, with pMF12 as the matrix and designed oligonucleotides as primers. Sequence data were compiled and analyzed by the Gene Jockey II, sequence processor program (Biosoft, Cambridge, United Kingdom).
Inactivation of the chromosomal malE gene.
The
chromosomal malE gene of C. glutamicum was
disrupted as described by Reyes et al. (42). A 0.8-kb
BamHI-StuI DNA fragment was cloned into the
pCGL243 shuttle vector to give pMF14. From pMF14, an
XbaI-XbaI integron was obtained as described by
Reyes et al. (42) and used to disrupt the chromosomal
malE gene from C. glutamicum. The resulting
malE strain was then tested for malic enzyme activity and
displayed no detectable activity. Gene disruption was confirmed by
Southern analysis.
Overexpression of the malE gene. Overexpression of the malE gene in C. glutamicum was achieved by cloning the malE open reading frame (ORF) under the control of the Ptrc promoter, which promotes a high level of inducible gene expression in C. glutamicum (12). The resulting in-frame fusion was transferred into the E. coli-C. glutamicum shuttle vector pCGL243 (42). The malE ORF was obtained by PCR with C. glutamicum chromosomal DNA as the template and oligonucleotides 5' GGCTAAATGTCATGACCATCGACC 3' (corresponding to nucleotides 714 to 737, which allows the creation of an RcaI restriction site overlapping the ATG codon) and 5'GTTTGATTTAAAGGTCTGGTCTCG 3' (reverse complement of nucleotides 2025 to 2048, located downstream of the putative terminator and containing a DraI restriction site) as primers. After PCR, the amplified DNA fragment was submitted to restriction with RcaI and DraI, and the product was cloned into NcoI- and SmaI-restricted plasmid pKK388-1 to give plasmid pMF21. The in-phase fusion was controlled by DNA sequencing. From pMF21, a SalI-SalI DNA fragment, encompassing the Ptrc promoter, the malE ORF, and the malE terminator, was isolated and cloned into pCGL243 at the SalI site to give pMF22. This plasmid was then introduced into C. glutamicum strains by electroporation. The overexpression was confirmed by direct measurement of enzyme activity.
Enzyme activity assay.
Malic enzyme activity was determined
spectrophotometrically by measuring the change in the absorbance of
NADPH at 340 nm (
= 6,223 M
1 · cm
1) at 30°C. The reaction mixture for the oxidative
decarboxylation of malate contained potassium phosphate buffer (100 mM,
pH 7.8), MgCl2 (5 mM), NADP+ (0.6 mM), and
sodium L-malate (40 mM). The reaction mixture for the
reductive carboxylation of pyruvate contained Tris-HCl buffer (100 mM,
pH 7.0), MgCl2 (5 mM), NADPH (0.3 mM), NH4Cl (8 mM), NaHCO3 (50 mM), and sodium pyruvate (30 mM). Specific
activity was expressed relative to the protein content of the cell
extract as determined by the Lowry method.
Purification of malic enzyme. Bacterial cells were washed twice in KCl (0.2% [wt/vol]) and resuspended in Tris-tricarballylate buffer (270 mM, pH 7.8) containing MgCl2 (4.5 mM) and glycerol (22% [vol/vol]). Cells were disrupted by sonication (8 cycles of 30 s with 90-s cooling intervals) and were maintained on ice during sonication. The suspension was centrifuged at 10,000 × g for 15 min to remove cell debris. The supernatant was used to determine the specific activity of malic enzyme and for the protein purification process described below.
In step I, polyethyleneimine (PEI) was added to the crude extract with constant stirring to a final concentration of 0.04%. The mixture was stirred for 30 min at 4°C, and the precipitate was removed by centrifugation at 5,000 × g for 15 min. In step II, the enzyme solution was applied to a Sepharose Q anion-exchange column (1.6 by 20 cm) (Pharmacia) previously equilibrated with Tris-HCl buffer (40 mM, pH 8.5) containing 5 mM MgCl2, 10 mM KCl, and 1 mM EDTA (buffer A). Malic enzyme was eluted with this buffer solution containing 0.34 M NaCl at a flow rate of 1 ml/min. The fractions containing the malic enzyme activity were pooled and desalted with a PD-10 column (Amersham Pharmacia Biotech). In step III, the enzyme fraction was passed through a Blue-Sepharose CL-6B (Amersham Pharmacia Biotech) column (20 ml) which had been equilibrated with buffer A. The malic enzyme was eluted at 0.7 ml/min in buffer A for 30 min, followed by 30 min in buffer A containing 200 mM NaCl, and finally 30 min in buffer A containing 300 mM NaCl. (Malic enzyme was recovered in this last elution.) Fractions containing the enzyme activity were pooled and desalted. In step IV, the protein extract from step III was run on a Red-Sepharose CL-6B (Amersham Pharmacia Biotech) column (10 ml) equilibrated with buffer A. The malic enzyme was eluted at 0.5 ml/min with buffer A for 30 min followed by the same buffer containing 200 mM NaCl for 30 min (malic enzyme was eluted during this period). The fractions exhibiting malic enzyme activity were combined, desalted, and stored at 4°C prior to enzymatic characterization.Electrophoretic analysis of proteins.
Electrophoresis was
carried out with the PHAST system (Amersham Pharmacia Biotech). Under
denaturing conditions, the sample was diluted with denaturing buffer
Tris-HCl (10 mM) containing EDTA (1 mM), sodium dodecyl sulfate (SDS;
2.5% [wt/vol]),
-mercaptoethanol (5% [wt/vol]), and
bromophenol blue (0.01% [wt/vol]) and heated to 90°C for 1 min
before being loaded on a polyacrylamide PhastGel gradient 8-25 (Amersham Pharmacia Biotech). The buffer system in PhastGel SDS buffer
was tricine (0.2 M trailing ion)-Tris (0.2 M)-SDS (0.55%) at pH 8.1.
Nucleotide sequence accession number. The nucleotide sequence reported in this work has been assigned GenBank accession no. AF234535.
| |
RESULTS |
|---|
|
|
|---|
Isolation of the malE gene from C. glutamicum.
Cloning of the malE gene from C. glutamicum was initiated by DNA-DNA hybridization with a designed
DNA probe. Comparison of deduced amino acid sequences of NADP-dependent
malic enzymes from the gram-positive bacteria Bacillus
stearothermophilus (24) and Streptococcus
bovis (23) revealed the presence of two highly conserved regions (AAMPVMEGKA and HDDQHGTAIV), which are located at the
N and C termini, respectively, of these malic enzymes. From these
peptide sequences, two degenerated oligonucleotides were designed,
taking into account the codon bias index for moderately expressed genes
of C. glutamicum (28) and the Wobble rule. These two oligonucleotides (5' GCGATGCCWGTCATGGAAGGRAARGTK 3' and
5' GTRCTACTRGTYGTRCCRTGYCG 3') were used for PCR
amplification of C. glutamicum chromosomal DNA. The
resulting 220-bp DNA fragment was cloned in the pGEMT cloning vector
and sequenced. Comparison of the deduced polypeptide with known malic
enzyme sequences highlighted a strong similarity between the cloned
fragment and malE genes from various organisms. The
amplified DNA fragment was isolated, radioactively labeled, and used as
a probe against C. glutamicum-issued DNA fragments within
the DNA bank. Three plasmids were isolated, namely pMF11, pMF12, and
pMF13. NADP+-dependent malic enzyme activity was then
tested in E. coli cells harboring either pMF11, pMF12, or
pMF13. Plasmid pMF12 was chosen for further experiments, since it
encodes a functional malE gene as estimated from enzyme
measurements (malic enzyme specific activity of 0.127 µmol/mg of
protein
1 · min
1 as compared to
activities of <0.01 µmol/mg of protein
1 · min
1 in the other strains).
Nucleotide sequence of the malE gene.
The
nucleotide sequence of a 2,226-bp fragment from pMF12 was determined
from both strands by the dideoxy chain termination method. The sequence
has been deposited in GenBank under accession no. AF234535. Computer
analysis revealed a main ORF extending from bp 725 to 1900. This ORF
exhibited a codon usage (P/T = 0.725) indicative of a highly
expressed gene of C. glutamicum (28). Database
searches with the deduced polypeptides of this ORF revealed similarities to sequences stored in the GenBank and SwissProt databases
with significant identity to known malic enzymes. These results
indicate that this ORF represents the malE gene from
C. glutamicum. From comparison data, the predicted
translational initiation site at nucleotide 212 is an ATG codon. The
malE gene is not preceded by a typical ribosome binding site
(AAGGAG), but is followed by a structure resembling a
rho-independent transcription terminator (43). According to
the rules of Tinoco et al. (49), a
G value of
23.7 kcal/mol at 37°C can be predicted for the predicted mRNA
hairpin loop sequence. The predicted malE gene product
consists of 392 amino acids with a molecular weight of 40,950, which is
in agreement with the subunit molecular weight of 42,000 determined by
SDS-polyacrylamide gel electrophoresis (PAGE) for the purified enzyme
from C. glutamicum (see below).
Analysis of the deduced amino acid sequence from C. glutamicum.
GenBank and SwissProt database searches with the
deduced amino acid sequence of the C. glutamicum malic
enzyme revealed close matches to the complete amino acid sequences of
malic enzymes from a number of gram-positive and gram-negative
bacteria. In an alignment, the C. glutamicum enzyme shows
69, 68, 63, 64, and 63% identity to the enzymes from B. stearothermophilus (24), S. bovis
(23), Bacillus subtilis (26), E. coli (3), and Haemophilus influenzae
(16), respectively. The alignment showed that identical
residues are scattered throughout the sequence. A secondary structure
prediction was made for the deduced amino acid sequence of the C. glutamicum malic enzyme with the ProDom domain search program
(11). The calculated secondary structure of C. glutamicum malic enzyme indicates a compact, globular structure for the subunits. From these data, regions of functional significance could be highlighted. Region Y44 to C52 could
be assigned to the binding site for malate (25). The
sequence from K193 to D223 matches perfectly
the consensus sequence for ADP-binding sites, with a predicted


secondary structure (52), and can be assigned to
the binding site of the ADP ring of NADP+.
Biochemical characteristics of malic enzyme. (i) Purification of
malic enzyme.
The results of the purification procedure are
summarized in Table 2. The four-step
procedure led to an 88-fold purification with a 17% recovery of
initial activity. A single band was obtained on SDS-PAGE, demonstrating
the homogeneity of the purified enzyme (Fig.
1). The molecular weight of the subunit
was estimated to be 42,000, in close agreement with the molecular
weight estimated from the gene sequence. From the purification data,
the malic enzyme protein represents about 1% of total cytoplasmic
proteins. This value is in full accordance with the calculated P/T
value (28), estimated from the codon usage in the
malE sequence, indicating a high abundance for the malic
enzyme in C. glutamicum. Under native conditions, the
estimated molecular weight was 105,000. This result suggested that the
malic enzyme of C. glutamicum was a dimer.
|
|
(ii) Effect of pH and temperature. The optimum pH for the oxidative decarboxylation activity with regard to L-malate was 7.8 when using potassium phosphate or Tris-HCl buffer. This is similar to the optimum pH of other malic enzymes. In the reverse direction, the optimum pH was 7.5. The same value was found for the malic enzyme of S. bovis (23), although an optimal pH of 6.0 has been reported for the enzyme of B. stearothermophilus (24). The highest specific activity of the purified enzyme was obtained at 50°C, and no measurable activity could be detected at 60°C. Malic enzyme of C. glutamicum was stable for at least 120 min at 4°C, whereas incubation at temperatures between 33 and 40°C led to progressive inactivation of the enzyme. After a 120-min preincubation at 33 and 40°C, only 76 and 30%, respectively, of the initial activity was detected.
(iii) Kinetic parameters.
The C. glutamicum malic
enzyme was strictly NADP+ dependent; no activity could be
measured with NAD+ as a cofactor. Moreover, no measurable
activity was detected with D-malate. The kinetics constants
(Km and Vmax) of the
purified enzyme were calculated by the double reciprocal plot for both directions. Kms of 3.8 ± 0.6 and 13.8 ± 3.5 mM were determined for malate and pyruvate, respectively. The
Km for pyruvate is similar to values determined
for the malic enzymes of E. coli (Km = 16 mM) (48) and S. bovis
(Km = 11.4 mM) (23), but
somewhat lower than that reported for Ascaris suum
(Km = 45 mM) (27). The
Kms for NADP+ and NADPH were
estimated to be 0.083 ± 0.017 and 0.06 ± 0.015 mM,
respectively. The Vmax for the carboxylating
activity (2.25 µmol/min
1 · mg of
protein
1) was fivefold lower than the
Vmax for decarboxylating activity (10.9 µmol/min
1 · mg of protein
1).
(iv) Effect of NH4+ and K+. Malic enzyme activity from various microorganisms has been shown to be activated by NH4+ and K+ (15, 17, 23, 24). This was shown to also be the case for the malic enzyme of C. glutamicum. Addition of NH4+ or K+ increased the measured activity in both the oxidative decarboxylation and the reductive carboxylation directions. The Kds determined were 13 mM for K+ and 1.25 mM for NH4+.
(v) Divalent cation requirements.
Malic enzyme activity was
demonstrated to be dependent on the presence of divalent metal cations.
Maximum activity was observed in the presence of 5 mM Mn2+
(Table 3), although other divalent
cations (Mg2+, Co2+, and Ni2+, but
not Ca2+) also had a positive effect on enzyme activity. In
the absence of such divalent cations, a residual activity of 12% was
measured, due probably to the presence of trace amounts of
MgCl2 in the enzyme preparation. This positive response of
malic enzyme to the presence of divalent cations appears to be a
conserved feature of this enzyme.
|
(vi) Effect of various compounds on malic enzyme activity. The possible effect of phosphorylated glycolytic intermediates on malic enzyme activity was examined by using concentrations corresponding to the in vivo concentrations seen during both the exponential growth phase and the amino acid overproduction phase associated with glutamate accumulation (18). None of these metabolites exerted a significant effect on malic enzyme activity at the following concentrations: 6-phosphogluconate (2.5 and 5 mM), glucose-6-phosphate (10, 20, and 40 mM), fructose-6-phosphate (2, 4, and 8 mM), fructose-1,6-bisphosphate (10 and 20 mM), glyceraldehyde-3-phosphate (2 and 4 mM), PEP (1.5 and 10 mM), acetyl-CoA (0.02, 0.2, and 0.4 mM), ATP (0.5 and 1 mM), and ADP (0.5 and 1 mM). However, addition of OAA or glutamate provoked some, although limited, inhibition (Table 3). With respect to OAA, the malic enzyme of C. glutamicum was less sensitive than others (7, 17, 23), while sensitivity to inhibition by glutamate has not been examined previously.
Effect of modified expression of the malE gene in
C. glutamicum.
To study whether C. glutamicum
requires the malE gene for growth on various carbon sources,
and to what extent the malE gene is of metabolic
significance, the malE-overexpressing wild-type strain
carrying the pMF22 plasmid [WT(pMF22)] and the
malE-deficient (
malE) strain were constructed
(see Materials and Methods). Malic enzyme measurements in transformed
cells shows that such strains showed the appropriate levels of enzyme
activity (Table 4). The
malE strain had no detectable malic enzyme activity,
while the WT(pMF22) strain had high and constitutive malic enzyme
activity during growth on various carbon substrates.
|
(i) Malic enzyme activity. For the wild-type strain, the highest activity was found in cells grown on lactate as the carbon source (Table 4). On glucose, the activity was slightly lower, whereas on acetate, only low measurable activity was detected. These results suggest that the C. glutamicum malic enzyme is regulated by the carbon source and might therefore be expected to have a physiological role during growth on those substrates for which high activity was measured, i.e., glucose and lactate. In light of the low level of malE expression during growth on acetate, any significant physiological role during acetate metabolism would seem unlikely.
(ii) Growth behavior.
The growth behaviors of the C. glutamicum wild-type,
malE, and WT(pMF22) strains
were determined on minimal media containing glucose, lactate, or
acetate as the sole carbon source. The
malE strain is
able to grow on all three substrates, indicating that malic enzyme is
not an essential enzyme during growth on any of these substrates.
Indeed, on both glucose and acetate, the genetically engineered strains
showed identical specific growth rates to the wild-type strain (results
not shown). However, significant differences were observed during
growth on lactate (Fig. 2), for which the extent of the exponential growth period was dependent upon the level of
malic enzyme activity. The
malE strain showed a
significantly diminished rate of growth after 8 h of
fermentation compared to the wild type, while the WT(pMF22) strain
maintained exponential growth throughout the entire fermentation.
During the initial hours of the culture, all strains showed an
exponential growth rate of 0.5 h
1, but after 8 h,
the growth rates were 0.3, 0.4, and 0.5 h
1 for the
malE, wild-type, and WT(pMF22) strains, respectively. The
maintained exponential growth phase was seen to be correlated to the
more rapid rate of lactate consumption during this period of the
fermentation. Diminished growth rates of C. glutamicum on
lactate have previously been attributed to pyruvate accumulation (9). When this was examined in the three strains used in
this study, the WT(pMF22) strain was shown to have a profile of
pyruvate accumulation different from those of the other strains.
Pyruvate accumulation was somewhat delayed, but then increased to
significantly higher levels than those seen for the other strains (Fig.
2).
|
| |
DISCUSSION |
|---|
|
|
|---|
The malE gene, encoding malic enzyme from C. glutamicum, has been cloned and studied at the molecular level.
The cloned malE gene exhibits classical features for a
highly expressed gene from C. glutamicum, and the
corresponding protein is clearly homologous to other
NADP+-dependent malic enzymes. Malic enzyme was purified
from C. glutamicum, and its biochemical characteristics were
shown to be similar to those of other microbial malic enzymes. The
enzyme exhibits similar requirements for divalent cations, is activated
by NH4+ and K+, and has typical pH
and temperature optima. When the two anaplerotic enzymes involving
pyruvate (malic enzyme and pyruvate carboxylase) are compared, it can
be seen that affinity for pyruvate was approximately 10-fold lower for
the malic enzyme (Km = 13.4 mM) than for
the pyruvate carboxylase activity (Km = 1.3
mM) (38). In order for malic enzyme to contribute to TCA
cycle replenishment, pyruvate would need to accumulate to high
intracellular concentrations. This was observed for
ppc
strains grown under biotin limitation (Mathieu et al., rDNA Biotechnol.
4: Metab. Eng. I, poster abstr. 53, 1996), indicating that malic enzyme
can fulfill such a function, but such a role in wild-type cells growing
on sugars seems highly improbable. Recent NMR studies have indicated
some degree of back flux from the TCA cycle to pyruvate during both
growth and lysine overproduction (29, 47), and in view of
the kinetic characteristics of the malic enzyme, the implication of
this enzyme in such a back flux would seem feasible. This exchange
reaction can occur as a deviation of the TCA cycle flux, bypassing
cytoplasmic malate dehydrogenase activity or via the recently described
membrane-bound flavoprotein which can reduce OAA to malate
(31). The presence of this ubiquinone-dependent enzyme makes
possible a cycle involving pyruvate carboxylation to OAA followed by
reduction to malate and then decarboxylation back to pyruvate. The
operation of such a cycle would generate additional NADPH without
carbon loss via CO2 production and has been proposed
previously for growth on substrates known to have a relatively low flux
through the pentose pathway (9, 13). Such a role may explain
the high level of expression on glucose and also the difficulty in
obtaining evidence from simple analysis of the growth response. As
shown recently, C. glutamicum is capable of modulating NADPH
production in response to demand in various ways (30). These
authors significantly diminished the NADPH requirement during lysine
production by replacing the NADPH-dependent glutamate dehydrogenase
with the NADH-dependent enzyme from Peptostreptococcus
asaccharolyticus, but did not improve lysine production. Instead,
the flux through the NADPH-generating pentose pathway was significantly
diminished. The absence of a phenotype on glucose for the strains used
here might therefore indicate that other pathways generating NADPH were
modified in the strains used, indicating a certain degree of redundancy
in the metabolic pathway network.
The absence of a phenotype during growth on acetate is not surprising, since malic enzyme is present at only low intracellular concentrations indicative of low expression of malE on this substrate. This is indicative of some carbon source-related regulation of malE expression, and a more detailed molecular characterization of the promoter sequence may facilitate the identification of the underlying mechanism. On acetate, the glyoxylate cycle was found to be the essential anaplerotic pathway (40, 41).
The modified growth behavior of the
malE strain and the
WT(pMF22) strain on lactate compared to that of the wild-type strain indicates a more important role for malic enzyme during growth on
lactate. A C. glutamicum strain lacking both pyruvate and
PPCs was unable to grow on lactate (39), so again, an
anaplerotic function can be excluded, despite the high pyruvate pool
associated with lactate metabolism (8). A more probable role
here is the NADPH-generating reaction, discussed above and postulated
to be a potential manner of NADPH generation during lactate metabolism by Cocaign-Bousquet and Lindley (9), who used stoichiometric flux analysis to formulate their hypothesis. The higher activities of
both malic enzyme and pyruvate carboxylase (38) on lactate add supportive evidence to this model. This bacterium appears to have
evolved an extremely complex network of reactions linking glycolysis to
the TCA cycle. Malic enzyme offers one such possibility and is
probably physiologically important as a means of supplying NADPH
availability on gluconeogenic substrates unable to orientate a high carbon flux through alternative NADPH-generating pathways, such
as the pentose pathway. Presumably, the high pyruvate concentration in
the WT(pMF22) strain during growth on lactate is observed because of
the maintenance of a high rate of lactate consumption, although the
reasons for pyruvate accumulation during the prolonged exponential growth phase will require a more detailed analysis of the central pathways. It will be interesting to see whether modulation of this
activity will be a useful genetic engineering strategy to increase
NADPH availability so as to improve the production yields of compounds
requiring significant amounts of NADPH for their biosynthetic pathways.
| |
ACKNOWLEDGMENTS |
|---|
We thank Pierre Escalier for valuable technical assistance.
This work received financial support from ORSAN-Amylum, the CNRS, and the European Union Cell Factory program (BIO4-CT96-0145).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Laboratoire de Biotechnologie Bioprocedes, Centre de Bioingénierie Gilbert Durand, Institut National des Sciences Appliquées, 135 Ave. de Rangueil, 31077 Toulouse Cedex 4, France. Phone: (33) 561 559 489. Fax: (33) 561 559 400. E-mail: lindley{at}insa-tlse.fr.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1987. Current protocols in molecular biology. John Wiley and Sons, New York, N.Y. |
| 2. | Birnboim, H. C. 1983. A rapid alkaline extraction method for the isolation of plasmid DNA. Methods Enzymol. 100:243-255[Medline]. |
| 3. |
Blattner, F. R.,
G. Plunkett,
C. A. Bloch,
N. T. Perna,
V. Burland,
M. Riley,
J. Collado-Vides,
F. D. Glasner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Man, and Y. Shao.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1474 |
| 4. | Bonamy, C., A. Guyonvarch, O. Reyes, F. David, and G. Leblon. 1990. Interspecies electro-transformation in Corynebacteria. FEMS Microbiol. Lett. 66:263-270[CrossRef]. |
| 5. | Brosius, J. 1988. A survey of molecular cloning vectors and their uses, p. 205-225. In R. L. Rodriguez, and D. T. Denhardt (ed.), Vectors. Butterworth, Boston, Mass. |
| 6. |
Caruthers, M. H.,
A. D. Barone,
S. L. Beaucage,
D. R. Dodds,
E. F. Fischer,
L. J. McBride,
M. Matteuci,
Z. Staninsky, and J. Y. Tang.
1985.
Chemical synthesis of deoxynucleotides by the phosphoramidite method.
Science
230:281 |
| 7. | Chen, F., Y. Okabe, K. Osano, and S. Tajima. 1997. Purification and characterization of the NADP-malic enzyme from Bradyrhizobium japonicum A1017. Biosci. Biotechnol. Biochem. 61:384-386[Medline]. |
| 8. | Cocaign-Bousquet, M., C. Monnet, and N. D. Lindley. 1993. Batch kinetics of Corynebacterium glutamicum during growth on various substrates: use of substrate mixtures to localise metabolic bottlenecks. Appl. Microbiol. Biotechnol. 40:526-530[CrossRef]. |
| 9. | Cocaign-Bousquet, M., and N. D. Lindley. 1995. Pyruvate overflow and carbon flux within the central metabolic pathways of Corynebacterium glutamicum during growth on lactate. Enzyme Microb. Technol. 17:260-267[CrossRef]. |
| 10. | Cocaign-Bousquet, M., A. Guyonvarch, and N. D. Lindley. 1996. Growth rate-dependent modulation of carbon flux through central metabolism and the kinetic consequences for glucose-limited chemostat cultures of Corynebacterium glutamicum. Appl. Environ. Microbiol. 62:429-436[Abstract]. |
| 11. |
Corpet, F.,
J. Gouzy, and D. Kahn.
1998.
The ProDom database of protein domain families.
Nucleic Acids Res.
26:323-326 |
| 12. | Delaunay, S., D. Uy, M. F. Baucher, J. M. Engasser, A. Guyonvarch, and J. L. Goergen. 1999. Importance of phosphoenolpyruvate carboxylase of Corynebacterium glutamicum during the temperature triggered glutamic acid fermentation. Metab. Eng. 1:334-343[CrossRef][Medline]. |
| 13. | Dominguez, H., C. Rollin, A. Guyonvarch, J.-L. Guerquin-Kern, and N. D. Lindley. 1998. Carbon flux distribution in the central metabolic pathways of Corynebacterium glutamicum during growth on fructose. Eur. J. Biochem. 254:96-102[Medline]. |
| 14. | Dower, W. J., J. F. Miller, and C. W. Ragsdale. 1988. High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res. 1:6127-6145. |
| 15. |
Driscoll, B. T., and T. M. Finan.
1997.
Properties of NAD+- and NADP+-dependent malic enzymes of Rhizobium (Sinorhizobium) meliloti and differential expression of their genes in nitrogen-fixing bacteroids.
Microbiology
143:489-498 |
| 16. |
Fleishmann, R. D.,
M. D. Adams,
O. White,
R. A. Clayton,
E. F. Kirkness,
A. R. Kerlavage,
C. J. Bult,
J. F. Tomb,
B. A. Dougherty,
J. M. Merrick,
K. McKenney,
G. Sutton,
W. Fitzhugh,
C. A. Fields,
J. D. Gocayne,
J. D. Scott,
R. Shirley,
L. I. Liu,
A. Glodek,
J. M. Kelley,
J. F. Weidman,
C. A. Phillips,
T. Spriggs,
E. Hedblom,
M. D. Cotton,
T. R. Utterback,
M. C. Hanna,
D. T. Nguyen,
D. M. Saudek,
R. C. Brandon,
L. D. Fine,
J. L. Fritschman,
J. L. Fuhrmann,
N. S. M. Geoghagen,
C. L. Gnehm,
L. A. McDonald,
K. V. Small,
C. M. Fraser,
H. O. Smith, and J. C. Venter.
1995.
Whole-genome random sequencing and assembly of Haemophilus influenzae Rd.
Science
269:496-512 |
| 17. | Garrido-Pertierra, A., C. Martinez Marcos, M. Martin Fernandez, and M. Ruiz-Amil. 1983. Properties and function of malate enzyme from Pseudomonas putida. Biochimie 65:629-635[Medline]. |
| 18. | Gourdon, P., and N. D. Lindley. 1999. Metabolic analysis of glutamate production by Corynebacterium glutamicum. Metab. Eng. 1:224-231[CrossRef][Medline]. |
| 19. | Gubler, M. E., M. S. M. Jetten, S. H. Lee, and A. J. Sinskey. 1994. Effects of phosphoenol pyruvate carboxylase deficiency on metabolism and lysine production in Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 40:857-863[CrossRef]. |
| 20. | Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580[Medline]. |
| 21. | Jetten, M. S. M., and A. J. Sinskey. 1993. Characterization of phosphoenolpyruvate carboxykinase from Corynebacterium glutamicum. FEMS Microbiol. Lett. 111:183-188[CrossRef]. |
| 22. | Jetten, M. S. M., and A. J. Sinskey. 1995. Purification and properties of oxaloacetate decarboxylase from Corynebacterium glutamicum. Antonie Leeuwenhoek 67:221-227. |
| 23. | Kawai, S., H. Suzuki, K. Yamamoto, M. Inui, H. Yakawa, and H. Kumagai. 1996. Purification and characterization of a malic enzyme from the ruminal bacterium Streptococcus bovis ATCC 15352 and cloning and sequencing of its gene. Appl. Environ. Microbiol. 62:2692-2700[Abstract]. |
| 24. | Kobayashi, K., S. Doi, S. Negoro, I. Urabe, and H. Okada. 1989. Structure and properties of malic enzyme from Bacillus stearothermophilus. J. Biol. Chem. 6:3200-3205. |
| 25. | Kulkarni, G., P. F. Cook, and B. G. Harris. 1993. Cloning and nucleotide sequence of a full-length cDNA encoding Ascaris suum malic enzyme. Arch. Biochem. Biophys. 300:231-237[CrossRef][Medline]. |
| 26. |
Lapidus, A.,
N. Galleron,
A. Sorokin, and S. D. Ehrlich.
1997.
Sequencing and functional annotation of the Bacillus subtilis genes in the 200 kb rrnB-dnaB region.
Microbiology
143:3431-3441 |
| 27. |
Mallick, S.,
B. G. Harris, and P. F. Cook.
1991.
Kinetic mechanism of NAD:malic enzyme from Ascaris suum in the direction of reductive carboxylation.
J. Biol. Chem.
266:2732-2738 |
| 28. | Malumbres, M., J. A. Gil, and J. F. Martin. 1993. Codon preference in Corynebacteria. Gene 134:15-24[CrossRef][Medline]. |
| 29. | Marx, A., K. Striegel, A. A. de Graaf, H. Sahm, and L. Eggeling. 1997. Response of the central metabolism of Corynebacterium glutamicum to different flux burdens. Biotechnol. Bioeng. 56:168-180[CrossRef]. |
| 30. | Marx, A., B. J. Eikmanns, H. Sahm, A. A. de Graaf, and L. Eggeling. 1999. Response of the central metabolism in Corynebacterium glutamicum to the use of an NADH-dependent glutamate dehydrogenase. Metab. Eng. 1:35-48[CrossRef][Medline]. |
| 31. | Molenaar, D., M. E. van der Reste, and S. Petrovic. 1998. Biochemical and genetic characterization of the membrane associated malate dehydrogenase (acceptor) from Corynebacterium glutamicum. Eur. J. Biochem. 254:395-403[Medline]. |
| 32. |
Mori, M., and I. Shiio.
1985.
Purification and some properties of phosphoenolpyruvate carboxylase from Brevibacterium flavum and its aspartate-overproducing mutant.
J. Biochem.
97:1119-1128 |
| 33. |
Mori, M., and I. Shiio.
1985.
Synergistic inhibition of phosphoenolpyruvate carboxylase by aspartate and 2-oxoglutarate in Brevibacterium flavum.
J. Biochem.
98:1621-1630 |
| 34. |
Nilsson, B.,
M. Uhlen,
S. Josephson,
S. Gatenbeck, and L. Philipson.
1983.
An improved positive selection vector constructed by oligonucleotide mediated mutagenesis.
Nucleic Acids Res.
11:8019-8030 |
| 35. | O'Regan, M., G. Thierbach, B. Bachmann, D. Villeval, P. Lepage, J. F. Viret, and Y. Lemoine. 1989. Cloning and nucleotide sequence of phosphoenolpyruvate carboxylase-coding gene of Corynebacterium glutamicum ATCC13032. Gene 77:237-251[CrossRef][Medline]. |
| 36. | Park, S. M., C. Shaw-Reid, A. J. Sinskey, and G. Stephanopoulos. 1997. Elucidation of anaplerotic pathways in Corynebacterium glutamicum via 13C-NMR spectroscopy and GC-MS. Appl. Microbiol. Biotechnol. 47:430-440[CrossRef]. |
| 37. | Peters-Wendisch, P. G., B. J. Eikmanns, G. Thierbach, B. Bachmann, and H. Sahm. 1993. Phosphoenolpyruvate carboxylase in Corynebacterium glutamicum is dispensable for growth and lysine production. FEMS Microbiol. Lett. 112:269-274[CrossRef]. |
| 38. | Peters-Wendisch, P. G., W. F. Wendisch, S. Paul, B. J. Eikmanns, and H. Sahm. 1997. Pyruvate carboxylase as an anaplerotic enzyme in Corynebacterium glutamicum. Microbiology 143:1095-1103. |
| 39. |
Peters-Wendisch, P. G.,
C. Kreutzer,
J. Kalinowski,
M. Patek,
H. Sahm, and B. J. Eikmanns.
1998.
Pyruvate carboxylase from Corynebacterium glutamicum: characterisation, expression and inactivation of the pyc gene.
Microbiology
144:915-927 |
| 40. |
Reinscheid, D. J.,
B. J. Eikmanns, and H. Sahm.
1994.
Characterization of the isocitrate lyase gene from Corynebacterium glutamicum and biochemical analysis of the enzyme.
J. Bacteriol.
176:3474-3483 |
| 41. |
Reinscheid, D. J.,
B. J. Eikmanns, and H. Sahm.
1994.
Malate synthase from Corynebacterium glutamicum: sequence analysis of the gene and biochemical characterization of the enzyme.
Microbiology
140:3099-3108 |
| 42. | Reyes, O., A. Guyonvarch, C. Bonamy, V. Salti, F. David, and G. Leblon. 1991. Integron-bearing vectors: a method suitable for stable chromosomal integration in highly restrictive Corynebacteria. Gene 107:61-68[CrossRef][Medline]. |
| 43. | Rosenberg, M., and D. Court. 1979. Regulatory sequences involved in the promotion and termination of RNA transcription. Annu. Rev. Genet. 13:319-353[CrossRef][Medline]. |
| 44. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 45. |
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467 |
| 46. | Sano, K., K. Ito, K. Miwa, and S. Nakamori. 1987. Amplification of the phosphoenolpyruvate carboxylase gene of Brevibacterium glutamicum to improve amino acid production. Agric. Biol. Chem. 51:597-599. |
| 47. | Sonntag, K., J. Schwinde, A. A. de Graaf, A. Marx, B. J. Eikmanns, and H. Sahm. 1995. 13C NMR studies of the fluxes in the central metabolism of Corynebacterium glutamicum during growth and overproduction of amino acids in batch cultures. Appl. Microbiol. Biotechnol. 44:489-495[CrossRef]. |
| 48. | Stols, L., and M. I. Donnelly. 1997. Production of succinic acid through overexpression of NAD+-dependent malic enzyme in an Escherichia coli mutant. Appl. Environ. Microbiol. 63:2695-2701[Abstract]. |
| 49. | Tinoco, I., P. N. Borer, B. Dengler, M. D. Levine, O. C. Uhlenbeck, D. M. Crothers, and J. Gralla. 1973. Improved estimation of secondary structure in ribonucleic acid. Nat. New Biol. 246:40-41[Medline]. |
| 50. | Tosaka, O., H. Morioka, and K. Takinami. 1979. The role of biotin-dependent pyruvate carboxylase in L-lysine production. Agric. Biol. Chem. 43:1513-1519. |
| 51. | Vallino, J. J., and G. Stephanopoulos. 1993. Metabolic flux distributions in Corynebacterium glutamicum during growth and lysine overproduction. Biotechnol. Bioeng. 41:633-646[CrossRef][Medline]. |
| 52. |
Wierenga, R. K.,
P. Terpstra, and W. G. J. Hol.
1986.
Prediction of the occurrence of the ADP-binding ![]() ![]() fold in proteins, using an amino acid sequence fingerprint.
J. Mol. Biol.
187:101-107[CrossRef][Medline].
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»