Previous Article | Next Article ![]()
Applied and Environmental Microbiology, August 2000, p. 3481-3486, Vol. 66, No. 8
Division of Applied Life Sciences, Graduate
School of Agriculture, Kyoto University, Kitashirakawa, Sakyo-ku,
Kyoto 606-8502, Japan
Received 28 March 2000/Accepted 31 May 2000
A long-chain aldehyde dehydrogenase, Ald1, was found in a soluble
fraction of Acinetobacter sp. strain M-1 cells grown on n-hexadecane as a sole carbon source. The gene
(ald1) was cloned from the chromosomal DNA of the
bacterium. The open reading frame of ald1 was 1,512 bp
long, corresponding to a protein of 503 amino acid residues (molecular
mass, 55,496 Da), and the deduced amino acid sequence showed high
similarity to those of various aldehyde dehydrogenases. The
ald1 gene was stably expressed in Escherichia coli, and the gene product (recombinant Ald1 [rAld1]) was
purified to apparent homogeneity by gel electrophoresis. rAld1 showed
enzyme activity toward n-alkanals (C4 to
C14), with a preference for longer carbon chains within the
tested range; the highest activity was obtained with tetradecanal. The
ald1 gene was disrupted by homologous recombination on the
Acinetobacter genome. Although the ald1
disruptant (ald1 The microbial degradation of
petrochemicals has attracted much interest due to its potential for the
development of bioremediation processes for oil spill environments, as
well as for the production of fine and moderately priced chemicals.
Acinetobacter spp. are known to utilize long-chain
n-alkanes and to accumulate intracellular wax esters
(8), which are enveloped by a single membrane
(25) and serve as cell reserves. The composition of
intracellular wax esters as to carbon chain length or the degree of
unsaturation can be controlled by altering the growth substrate or
temperature (5, 16, 17). Therefore, Acinetobacter
spp. are expected to have great potential for industrial utilization.
Recently, the hydroxylation of n-alkanes, involving
rubredoxin and rubredoxin reductase, has been found to be indispensable for n-alkane degradation by Acinetobacter sp.
strain ADP1 (9, 19). From these facts, together with this
evidence of the existence of a membrane-bound aldehyde dehydrogenase
(2, 12, 27), the main pathway of n-alkane
oxidation to acyl coenzyme A (acyl-CoA) via carboxylic acid is assumed
to proceed through the membrane-bound enzymes in these
Acinetobacter strains. This pathway is analogous to that
confirmed in the alkBAC operon of Pseudomonas
oleovorans (29), although the genetic organization of
the alk genes is different from that in
Acinetobacter spp. (9, 19). On the other hand, a
variety of enzymes that catalyze the oxidation of n-alkanes
and related compounds have also been found in soluble fractions of cell
extracts of Acinetobacter spp. (1, 11, 7, 30),
but their physiological significance in n-alkane metabolism
has not been confirmed.
In this study, we found a long-chain aldehyde dehydrogenase, Ald1, in a
soluble fraction of Acinetobacter sp. strain M-1 cells. In
order to determine the physiological role of Ald1 in
Acinetobacter sp. strain M-1, we cloned the Ald1-encoding
gene, ald1, and expressed and characterized the recombinant
enzyme. From these results together with those of investigation of an
ald1 disruptant strain, Ald1 was confirmed to play a
significant role in n-alkane utilization, especially in
intracellular wax ester synthesis.
Chemicals and enzymes.
Tetradecanal was purchased from
Aldrich Chemical Co., Inc. (Milwaukee, Wis.). Achromobacter
lysyl endopeptidase (EC 3.4.21.50) was from Wako Pure Chemical
Industries, Ltd. (Osaka, Japan). Restriction enzymes, alkaline
phosphatase (calf intestine), T4 DNA ligase, and Ex Taq DNA
polymerase were products of Takara Shuzo Co. (Kyoto, Japan). A dye
deoxy terminator cycle sequencing kit was purchased from Applied
Biosystems, Inc. (Foster City, Calif.), and [ Microorganisms, culture conditions, and vectors.
Acinetobacter sp. strain M-1, which utilizes
n-alkanes of carbon chain lengths from C13 to
C44 as sole carbon sources, was cultured in a salt medium
containing an n-alkane as described previously
(22). Escherichia coli JM109 (23) was
used for gene cloning and expression. E. coli cells are
usually grown on 2× yeast-Tryptone (YT) medium (pH 7.0) containing
Bacto Yeast extract (10 g/liter), Bacto Tryptone (16 g/liter), and NaCl
(5 g/liter), in the presence of ampicillin (10 mg/ml), 1.0 mM
isopropyl- Analysis.
For growth measurement, Acinetobacter
sp. strain M-1 cells were washed with a solvent mixture
(ethanol-butanol-chloroform, 10:10:1 [vol/vol]) to remove the
residual oily substance and were suspended in 0.85% NaCl; then the
optical density at 610 nm (OD610) was measured. The protein
concentration was determined with a protein assay kit (Japan Bio-Rad
Laboratories, Tokyo, Japan), with bovine serum albumin as the standard.
The relative molecular mass of the native enzyme was determined by gel
filtration with a Fast Protein Liquid Chromatography system (Pharmacia
Biotech, Uppsala, Sweden), using a Superdex 200 column equilibrated
with 50 mM Tris-Cl buffer (pH 7.5) containing 0.1 M KCl. The standard protein markers were from Oriental Yeast Co., Ltd. (Tokyo,
Japan). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) was performed on a 12.5% polyacrylamide gel
(13), and Bio-Rad standard proteins (Low Range) were used
for molecular mass measurement.
Extraction and analysis of wax esters.
Acinetobacter
sp. strain M-1 was cultured on a nitrogen-limiting medium
(20) containing n-hexadecane (0.5%, vol/vol).
After a 72-h cultivation, the cells were collected by centrifugation, washed three times with 0.85% NaCl, and then resuspended in 10 mM
Tris-Cl (pH 8.0) containing 1.0 mM EDTA. The cells were disrupted with
zirconia-silica beads (diameter, 0.5 mm; Biospec Products, Bartlesville, Okla.), and then wax esters were extracted with an equal
volume of chloroform-methanol (2:1, vol/vol). After centrifugation at
2,000 × g at room temperature for 10 min, the
chloroform phase was subjected to gas chromatography (with a GC7-A;
Shimadzu, Kyoto, Japan) under the following conditions: glass column
(0.5 m by 3.2 mm) packed with Silicone OV-17 (Shimadzu); gas phase, He
(50 ml/min); column temperature, 250°C; injection port temperature, 280°C; flame ionization detector temperature, 280°C.
Enzyme assay.
The reaction mixture was composed of 50 mM
glycine-NaOH buffer (pH 9.5), 2.5 mM NAD+, and 1.0 mM
tetradecanal. Before addition to the mixture, the substrate, i.e.,
tetradecanal or another insoluble substrate, was homogenized in 50 mM
glycine-NaOH buffer containing 3% (wt/wt of substrate) Plysurf A210G
(a detergent; Daiichi Kogyo Seiyaku, Tokyo, Japan) by heating in
boiling water for 3 min and subsequent sonication at 20 kHz for 1 min.
An appropriate quantity of the enzyme was added to initiate the
reaction. The mixture without the substrate was used as a reference.
One unit of enzyme was defined as the amount of the enzyme that
catalyzed the reaction of 1.0 µmol of NAD+ per min at
43°C. Calculations were based on a molar extinction coefficient at
340 nm for NADH of 6.22 × 103.
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Long-Chain Aldehyde Dehydrogenase That Participates
in n-Alkane Utilization and Wax Ester Synthesis in
Acinetobacter sp. Strain M-1
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
) strain still had the ability to grow on n-hexadecane to some extent, its aldehyde dehydrogenase
activity toward n-tetradecanal was reduced to half the
level of the wild-type strain. Under nitrogen-limiting conditions, the
accumulation of intracellular wax esters in the ald1
strain became much lower than that in the wild-type strain. These and
other results imply that a soluble long-chain aldehyde dehydrogenase
indeed plays important roles both in growth on n-alkane and
in wax ester formation in Acinetobacter sp. strain M-1.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-32P]dCTP
was from Amersham Corp. (Arlington Heights, Ill.).
-D-(
)-thiogalactopyranoside, and 0.05 mM
5-bromo-4-chloro-3-indolyl-
-D-galactoside when
necessary. pT7Blue (Novagen, Madison, Wis.) was used for the subcloning
of PCR products. pBluescript II SK(+) (Toyobo, Osaka, Japan) was used
as a cloning vector, pUC118 (Takara Shuzo Co.) was used as an
expression vector, and pKT231 (3) was used for construction of the ald1 disruptant.
Enzyme purification and amino acid sequence analysis. All the procedures for enzyme purification were performed at 4°C. An NAD+-dependent long-chain aldehyde dehydrogenase was partially purified from Acinetobacter sp. strain M-1 as described previously (22) and was then further chromatographed on a Resource Q column (Amersham Pharmacia Biotech, Tokyo, Japan). The purified preparation was subjected to SDS-PAGE and then electroblotted onto a polyvinylidene difluoride (PVDF) membrane (Millipore Corp., Bedford, Mass.). The band corresponding to the enzyme was cut out, subjected to fragmentation with lysyl endopeptidase, and then fractionated by high-performance liquid chromatography (HPLC) (33). The amino acid sequence of each fraction was determined by Edman's method with a Perkin-Elmer Protein Sequencer 476A.
Recombinant Ald1 (rAld1) was purified from cells of the transformant E. coli JM109(pCM1) (see below) as follows. The cells were harvested by centrifugation, washed twice with 0.85% NaCl, disintegrated with a Kubota Isonator model 200M at 150 W for 30 min, and then centrifuged at 18,000 × g for 10 min. After further centrifugation at 100,000 × g for 60 min, the clear supernatant was applied to a DEAE-Toyopearl column (Tosoh Co., Tokyo, Japan) equilibrated with buffer A (50 mM Tris-Cl, pH 8.5, containing 0.5 mM EDTA and 2 mM dithiothreitol). The enzyme was eluted with a linear gradient of increasing KCl concentration (0.1 to 0.3 M). The active fractions were collected, dialyzed against buffer A, and then applied to a Q-Sepharose column (Pharmacia Biotech) equilibrated with buffer A. The enzyme was eluted with a linear gradient of increasing KCl concentration (0.1 to 0.5 M). The active fractions were dialyzed against buffer A and then concentrated. The purified preparation, which gave a single protein band on SDS-PAGE and a single activity band on native PAGE, was stored at 0°C until use.Cloning of the ald1 gene from the genome of
Acinetobacter sp. strain M-1.
To amplify the fragment
of DNA encoding Ald1 from the chromosomal DNA of
Acinetobacter sp. strain M-1 by PCR, upstream and downstream
primers were designed from the internal amino acid sequences of K-5 and
K-12 (see Results). The primers used were K-12N
[5'-TT(T/C)AT(A/C/T)GG(A/C/T)GG(A/C/T)CA(A/G)TGGGT-3'] and K-5C [5'-TT(A/G/T/C)GT(T/C)TG(T/C)TG(A/G)TA(A/G)TG(A/G)TC-3']. The conditions for PCR were principally the same as described by
Sakai et al. (21). The PCR product was approximately 1.4 kb
in length and was used as a probe. Through Southern hybridization (28) and colony hybridization (21), one positive
clone which contained the 5.7-kb HindIII fragment of
pBluescript II SK(+) was isolated; this plasmid was named pSH6. A
restriction map of pSH6 is shown in Fig.
1A. The 3.5-kb PstI fragment
was subcloned from pSH6 into pBluescript II SK(+) and sequenced.
|
Nucleotide sequencing. Nucleotide sequencing was performed by the dideoxy chain termination method of Sanger et al. (24) using a DNA Sequencing Kit and an ABI 373A Sequencer (Applied Biosystems, Inc.). The sequencing reaction was performed as described in the manual. The sequence data were analyzed with the BLAST program (by using the GenBank, EMBL, and Swissprot databases).
Expression of the ald1 gene in E. coli JM109. To obtain the open reading frame (ORF) of the Acinetobacter sp. strain M-1 ald1 gene, PCR primers with an EcoRI site and the ribosomal binding sequence were synthesized as follows: aldN, 5' - GGAAT TCC TAAGGAGG T T T T TATATGCACTATGT TGATCCGAAT - 3' (the translation start codon is underlined), and aldC, 5'-GGAATTCCTTAGAAAAAGCCCATGGCTTT-3'. The PCR product was ligated with the pT7Blue vector and then with pUC118. A pUC118-derived plasmid, designated pCM1, was introduced into E. coli JM109. Expression of ald1 in the E. coli transformant cells was confirmed by the activity and protein bands on SDS-PAGE.
Northern hybridization. Acinetobacter sp. strain M-1 was grown on a salt medium containing various carbon sources, i.e., sodium acetate (1.0%) or an n-alkane (0.5%, vol/vol). The total RNA of the cells in the early-exponential growth phase was obtained by the acid-guanidinium thiocyanate-phenol-chloro-form (AGPC) method using ISOGEN (Nippon Gene Co., Ltd.), and total RNA was electrophoresed on a 0.7% agarose gel in 20 mM morpholinepropanesulfonic acid (MOPS) buffer containing 1.0 mM EDTA and 2.2 M formaldehyde and was then transferred to a nylon membrane filter (Gene Screen Plus; NEN Life Science Products, Boston, Mass.) in 20× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). Hybridization was carried out using AlkPhos DIRECT (Amersham Pharmacia Biotech) according to the manufacturer's protocol, using the pCM1-derived ald1 gene as a probe. rRNA was used as a standard for loaded total RNA and was visualized by ethidium bromide staining.
Transformation method.
E. coli was transformed by the
method of Hanahan (10). Acinetobacter sp. strain
M-1 was transformed by electroporation using a Gene Pulser II (Bio-Rad
Laboratories, Richmond, Calif.) under the following conditions: a
0.1-cm cuvette, 200
, 50 µF, and 16 kV/cm. Competent cells for
electroporation were prepared by the method of Leahy (14).
After the pulse, 800 µl of prewarmed 2× YT was added immediately,
followed by incubation at 30°C for 4 h and then plating.
Construction of the ald1 disruptant. The kanamycin resistance gene (Km) including its own promoter was amplified by PCR using pKT231 as a template. The primer sequences flanking the NcoI site were as follows: Km-N, CCATGGGGACCAGTTGGTGATTTT, and Km-C, CCATGGTTAGAAAAACTCATCGAGC. The amplified Km gene replaced a 500-bp NcoI fragment within the ald1 gene of pSH6 (Fig. 1C), yielding pDALD1. The ald1 disruption plasmid, pDALD1, was linearized, dephosphorylated, and then introduced into Acinetobacter sp. strain M-1 by electroporation.
Nucleotide sequence accession number. The nucleotide sequence data reported in this paper will appear in the DDBJ/EMBL/GenBank nucleotide sequence databases under accession number AB042203.
| |
RESULTS |
|---|
|
|
|---|
Nucleotide and deduced amino acid sequences of ald1. An NAD+-dependent long-chain aldehyde dehydrogenase, which showed activity toward tetradecanal, was purified from a soluble cell-free fraction of n-hexadecane-grown Acinetobacter sp. strain M-1 cells. We obtained the amino acid sequence information on two internal peptide sequences, K-5 (MMLDHYQQTK) and K-12 (DQYENFIGGQWVAPVK), from limited proteolytic digests of the purified enzyme. Based on these amino acid sequences, we synthesized two PCR primers, K-12N and K-5C, as described in Materials and Methods. A DNA fragment of about 1.4 kb was amplified by PCR using Acinetobacter sp. strain M-1 chromosomal DNA as the template with these primers. Through Southern hybridization and colony hybridization selection using the 32P-labeled 1.4-kb PCR-amplified product, one positive clone containing a 5.7-kb HindIII fragment in pBluescript II SK(+) was isolated. The ORF corresponding to Ald1 was found in the 3.5-kb PstI region, and ald1 was not clustered with other genes for enzymes related to n-alkane oxidation (Fig. 1B). This is unlike the placement of the aldehyde dehydrogenase gene (alkH) in the alk operon of the OCT plasmid in P. oleovorans (29). The ald1 gene was composed of 1,512 bp corresponding to 503 amino acid residues with a predicted molecular mass of 55,496 Da. A database search revealed that Ald1 showed considerable similarity to various aldehyde dehydrogenases, despite the differences in their origin and in their physiological and catalytic properties, including, e.g., AcoD of Alcaligenes eutrophus (18) (70% identity and 85% similarity) and AldB of E. coli (32) (68% identity and 83% similarity). Although AcoD is involved in the catabolism of acetoin and ethanol, Ald1 of our strain prefers longer aldehydes and is not active toward such short-chain aldehydes (see below). The following sequences are presumed to be functional motifs: GXGXXXG (positions 218 to 224; X represents any amino acid) as an AMP-binding site; VTLELGGKSP (positions 259 to 268) as a glutamic acid active-site motif (31); and GYKKSGVG (positions 467 to 474; Y represents an aromatic residue) as a putative conserved sequence among various aldehyde dehydrogenases (32).
Purification of rAld1 from E. coli JM109(pCM1). Acinetobacter sp. strain M-1 has several types of enzyme that catalyzed the oxidation of n-alkanals (22). Since the amount of the purified Ald1 from Acinetobacter sp. strain M-1 was too small for study of its biochemical properties, ald1 was overexpressed in E. coli. The cell extract of E. coli JM109(pCM1) showed aldehyde dehydrogenase activity toward tetradecanal, 0.156 U/mg of protein, but no activity was observed for the control strains, E. coli JM109 and E. coli JM109(pUC118). The enzyme was purified up to 70-fold from a cell extract of the transformant cells, as mentioned in Materials and Methods. The specific activity of the purified enzyme toward tetradecanal was 10.9 U/mg of protein. The purified enzyme preparation showed apparent homogeneity on SDS-PAGE.
General properties of the purified rAld1. The relative molecular mass of the purified enzyme was estimated to be 55 kDa on SDS-PAGE and 232 kDa on gel filtration; these values were identical to those obtained with the preparation from the native Acinetobacter strain. The molecular mass of the subunit is in close agreement with the value calculated from the deduced amino acid sequence, as mentioned above. Only one N-terminal amino acid sequence, MHYVDPNQSGSKIHFKDQYE, was obtained upon Edman degradation. Judging from these results, the enzyme is homotetrameric.
The enzyme showed an optimum temperature of 43°C, and 90% of its activity remained after incubation at 60°C for 30 min. The optimum pH was 9.5, and more than 90% of the activity was retained after incubation for 30 min at 30°C within pH 7.5 to 9.0. The enzyme activity was completely inhibited by p-chloromercuribenzoate (1.0 mM) and N-ethylmaleimide (1.0 mM) and was strongly inhibited by iodoacetate (1.0 mM), suggesting that a sulfhydryl group was essential for the activity. The enzyme activity was completely inhibited by Pb2+, Fe3+, Ag+, and Hg2+ at a concentration of 1.0 mM and was partially inhibited by several other metal ions at 1.0 mM: Mn2+ (37% inhibition), Zn2+ (44%), and Cu2+ (63%). Mg2+ (1.0 mM) slightly activated the enzyme (135% activation).Substrate specificity.
The enzyme was active toward
n-alkanals with carbon chains longer than four carbons but
was not active toward ethanal and propanal. The enzyme activity became
higher with increasing substrate carbon chain length. Among the
substrates examined, the n-alkanal most preferred was
tetradecanal, which is the longest n-alkanal commercially
available (Fig. 2). This means that the
enzyme can be categorized as a long-chain aldehyde dehydrogenase. The
enzyme catalyzed the dehydrogenation of benzaldehyde (66% activity
toward tetradecanal), o-, m-, and
p-fluorobenzaldehyde (76, 136, and 84%, respectively),
p-chlorobenzaldehyde (95%), m-methylbenzaldehyde (36%), trans-2-decenal (32%),
trans-cinnamaldehyde (38%), and cis-9-hexadecenal (31%). The purified enzyme utilized only
NAD+ as a cofactor, i.e., it did not use NADP+.
|
Northern analysis.
To examine the expression and regulation of
ald1, Northern blot analysis was performed with the total
RNA of Acinetobacter sp. strain M-1 cells grown on a salt
medium with an n-alkane ranging from C16 to
C30, and with sodium acetate as a control carbon source (Fig. 3A). The most intensive band was
detected with the mRNA from n-hexadecane-grown cells. The
level of mRNA became lower with increasing carbon chain length of the
n-alkane and became almost negligible with
n-hexacosane, indicating that ald1 mRNA was most
abundant when the cells were grown on C16. In spite of no
signal on Northern hybridization, the cells grown on
n-hexacosane, n-triacontane, and sodium acetate
showed significant levels of enzyme activity toward tetradecanal (Fig.
3B). This means that an alternative aldehyde dehydrogenase(s) active
toward tetradecanal is induced with these carbon sources. The existence
of isozymes was also indicated by gene disruption analysis (see below).
|
Gene disruption of ald1 in Acinetobacter
sp. strain M-1.
To determine the physiological role of Ald1 in
Acinetobacter sp. strain M-1, the chromosomal
ald1 gene was destroyed by homologous recombination with the
disruption vector pDALD1 as described in Materials and Methods. The
transformant was selected for the kanamycin resistance phenotype. The
ald1 gene disruption was confirmed by Southern analysis
(Fig. 1D). The chromosomal DNAs from both the wild-type strain and the
ald1
strain were double digested with EcoRV
and KpnI. The signal of the wild-type strain corresponded to
the size of 1.7 kb. This shifted to 3.3 kb for the ald1
strain, the size expected to result from insertion of two copies of the Km gene.
strain. The cell extract of the ald1
strain showed about half of the aldehyde dehydrogenase activity (0.16 U/mg of protein) toward tetradecanal that the wild-type strain showed.
Wax ester accumulation and growth rate of the ald1
strain.
The major determinant of wax ester composition during
growth on alkanes is the chain length of the alkane substrate. The main component of intracellular wax esters in Acinetobacter sp.
strain M-1 and the ald1
strain, which were grown under
nitrogen-limiting conditions with 0.5% n-hexadecane for
72 h, was hexadecyl-hexadecanoate, i.e., no other significant
components of wax esters were observed under the experimental
conditions used. This finding suggested that C16 is the
main carbon chain length species in intracellular wax esters in this strain.
strains grown on n-hexadecane under
nitrogen-limiting conditions. As expected, the amount of wax esters in
the cells of the ald1
strain, 0.73 µmol/mg of protein,
was less than half of that in the wild-type strain, 1.7 µmol/mg of
protein. Next, wax ester degradation was compared by shifting the cells
to a salt medium without a carbon source. The accumulated wax esters
were degraded at similar rates in the wild-type and the
ald1
strain (Fig. 4). These
results suggest that Ald1 plays an important role in the synthesis of
wax esters but not in their degradation.
|
strain still retained the ability to grow on
n-hexadecane as a sole carbon source. The initial growth
rate was the same as that of the wild-type strain, but the final cell
yield was less than half that of the wild type strain. The same result
was obtained when n-tridecane was used as the carbon source
instead of n-hexadecane (data not shown). We did not attempt
to detect the intermediates, such as corresponding aldehydes or free
fatty acids, in growth medium of the ald1
strain on
n-alkane.
|
| |
DISCUSSION |
|---|
|
|
|---|
In this study, we investigated the physiological role of a
long-chain aldehyde dehydrogenase, Ald1, which was found in a soluble fraction of a cell extract of n-alkane-grown
Acinetobacter sp. strain M-1 cells. Through genetic and
biochemical analyses, Ald1 was shown to play a significant role in
intracellular wax ester synthesis and in n-alkane
utilization by the following results: (i) the purified Ald1 from
recombinant E. coli cells was active toward a long-chain
n-alkanal; (ii) the ald1 transcript was induced by long-chain n-alkanes, C16 to C22;
(iii) disruption of ald1 caused a remarkable decrease in the
amount of intracellular wax esters; and (iv) the cell yield of the
ald1
strain was much lower than that of the wild-type
strain. The remaining ability of the ald1
strain to
accumulate some amount of wax esters suggests the participation of an
alternative aldehyde dehydrogenase(s) or the existence of an
alternative wax synthesis pathway. Indeed, the soluble fraction of the
ald1
strain still exhibited some NAD+-dependent aldehyde dehydrogenase activity (50% that
of the wild-type strain toward tetradecanal and 80% toward
n-decanal or n-hexanal).
Ratajczak et al. reported that alkM, encoding
integral-membrane terminal alkane hydroxylase, is essential for
n-alkane degradation by Acinetobacter sp. strain
ADP1 (19). (We recently obtained genes encoding the enzymes
involved in the n-alkane hydroxylation system in
Acinetobacter sp. strain M-1 [unpublished data]). These findings suggest that the oxidation of an n-alkane to the
corresponding acyl-CoA proceeds through membrane-bound enzymes as in
P. oleovorans. This was supported by the existence of
membrane-bound alcohol and aldehyde dehydrogenases in
Acinetobacter spp. (1). On the other hand,
acyl-CoA reductase has been reported to be essential for wax ester
synthesis in Acinetobacter calcoaceticus BD413
(20), indicating that the resulting aldehyde would be
further catalyzed by aldehyde reductase and acyl-CoA:alcohol
transacylase for wax ester synthesis. As judged from these facts,
acyl-CoA is the common intermediate for
-oxidation and wax ester
synthesis (as well as phospholipid synthesis [1])
(Fig. 6). The principal role of aldehyde
dehydrogenase might be to supply a fatty acid which is a precursor of
acyl-CoA, and a variety of aldehyde dehydrogenases have been found in
the membrane and cytosolic fractions of Acinetobacter spp.
(1). As described above, a membrane-bound enzyme would mainly participate in the carbon flow of n-alkanes to cell
constituent synthesis and to energy production through
-oxidation.
In contrast, our present results, i.e., (i) retarded growth on
n-hexadecane and impaired wax ester synthesis in the
ald1
strain, (ii) inducibility of ald1 by
n-hexadecane, and (iii) the substrate specificity of rAld1,
supported the possibility that soluble aldehyde dehydrogenases (one of
them being Ald1) mainly participate in wax ester synthesis.
|
The growth of the ald1
strain on n-hexadecane
showed the same rate as that of the wild-type strain until the
mid-exponential phase; then it ceased at a growth level less than half
that of the wild-type strain. In an Acinetobacter sp., wax
esters began to accumulate at the mid-exponential phase (6).
Judging from these observations, wax ester synthesis might be related
to the growth of Acinetobacter sp. strain M-1 on
n-alkanes after the mid-exponential phase.
Although n-alkane metabolism in Acinetobacter spp. seemed to be complicated due to the diversity and overlapping functions of enzymes, determination of the carbon flow from n-alkanes to various metabolites, such as wax esters, is of both academic and applied interest and is a challenging problem which should be solved through enzymological and genetic studies.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Kitashirakawa, Sakyo-ku, Kyoto 606-8502, Japan. Phone and Fax: 81-75-753-6385. E-mail: nkato{at}kais.kyoto-u.ac.jp.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Asperger, O., and H. Kleber. 1991. The biology of Acinetobacter, p. 323-350. Plenum Press, New York, N.Y. |
| 2. | Aurich, H., and G. Eitner. 1977. Induktion der NADP+-abhängigen Aldehyddehydrogenase durch Kohlenwasserstoffe bei Acinetobacter calcoaceticus. Z. Allg. Mikrobiol. 17:263-266[Medline]. |
| 3. | Bagdasarian, M., R. Lurz, B. Rückert, F. C. H. Franklin, M. M. Bagdasarian, J. Frey, and K. N. Timmis. 1981. Specific-purpose plasmid cloning vectors. II. Broad-host-range, high-copy-number, RSF1010-derived vectors, and a host-vector system for gene cloning in Pseudomonas. Gene 16:237-247[CrossRef][Medline]. |
| 4. | De Mot, R., I. Nagy, G. Schoofs, and J. Vanderleyden. 1994. Sequence of a Rhodococcus gene cluster encoding the subunits of ethanolamine ammonia-lyase and an APC-like permease. Can. J. Microbiol. 40:403-407[Medline]. |
| 5. | Dewitt, S., J. L. Erbin, D. Howes-Orchison, D. Dalietos, and S. L. Neidleman. 1982. Saturated and unsaturated wax esters produced by Acinetobacter sp. HO1-N grown on C16-C20 n-alkanes. J. Am. Oil Chem. Soc. 59:69-74[CrossRef]. |
| 6. | Fixter, L. M., M. N. Nagi, J. G. McCormack, and C. A. Fewson. 1986. Structure, distribution and function of wax esters in Acinetobacter calcoaceticus. J. Gen. Microbiol. 132:3147-3157. |
| 7. |
Fox, M. G. A.,
F. M. Dickinson, and C. Ratledge.
1992.
Long-chain alcohol and aldehyde dehydrogenase activities in Acinetobacter calcoaceticus strain HO1-N.
J. Gen. Microbiol.
138:1963-1972 |
| 8. |
Gallagher, I. H. C.
1971.
Occurrence of waxes in Acinetobacter.
J. Gen. Microbiol.
68:245-247 |
| 9. |
Geissdörfer, W.,
S. C. Frosch,
G. Haspel,
S. Ehrt, and W. Hillen.
1995.
Two genes encoding proteins with similarities to rubredoxin and rubredoxin reductase are required for conversion of dodecane to lauric acid in Acinetobacter calcoaceticus ADP1.
Microbiology
141:1425-1432 |
| 10. | Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Biol. Chem. 166:557-580. |
| 11. |
Hidalgo, E.,
Y. Chen,
E. C. C. Lin, and J. Aguilar.
1991.
Molecular cloning and DNA sequencing of the Escherichia coli K-12 ald gene encoding aldehyde dehydrogenase.
J. Bacteriol.
173:6118-6123 |
| 12. | Klossek, P., M. Kirchner, and J. Kurth. 1985. Immobilisierung partikelgebundener Aldehyddehydrogenase aus Acinetobacter calcoaceticus EB104. J. Basic Microbiol. 25:429-435[CrossRef]. |
| 13. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[CrossRef][Medline]. |
| 14. | Leahy, J. G. 1994. Transformation of Acinetobacter calcoaceticus RAG-1 by electroporation. Can. J. Microbiol. 40:233-236. |
| 15. |
Navy, I.,
G. Schoofs,
F. Compernolle,
P. Proost,
J. Vanderleyden, and R. De Mot.
1995.
Degradation of the thiocarbamate herbicide EPTC(S-ethyl dipropylcarbamothioate) and biosafening by Rhodococcus sp. strain NI86/21 involve an inducible cytochrome P-450 system and aldehyde dehydrogenase.
J. Bacteriol.
177:676-687 |
| 16. | Neidleman, S. L., and J. Geigert. September 1983. U.S. patent 4,404,283. |
| 17. | Neidleman, S. L., and J. Geigert. 1984. Biotechnology and oleochemicals: changing patterns. J. Am. Oil Chem. Soc. 61:290-297[CrossRef]. |
| 18. |
Priefert, H.,
N. Krüger,
D. Jendrossek,
B. Schmidt, and A. Steinbüchel.
1992.
Identification and molecular characterization of the gene coding for acetaldehyde dehydrogenase II (acoD) of Alcaligenes eutrophus.
J. Bacteriol.
174:899-907 |
| 19. |
Ratajczak, A.,
W. Geißdörfer, and W. Hillen.
1998.
Alkane hydroxylase from Acinetobacter sp. strain ADP1 is encoded by alkM and belongs to a new family of bacterial integral-membrane hydrocarbon hydroxylases.
Appl. Environ. Microbiol.
64:1175-1179 |
| 20. |
Reiser, S., and C. Somerville.
1997.
Isolation of mutants of Acinetobacter calcoaceticus deficient in wax ester synthesis and complementation of one mutation with a gene encoding a fatty acyl coenzyme A reductase.
J. Bacteriol.
179:2969-2975 |
| 21. | Sakai, Y., J. Ishikawa, S. Fukasaka, H. Yurimoto, R. Mitsui, H. Yanase, and N. Kato. 1999. A new carboxylesterase from Brevibacterium linens IFO 12171 responsible for the conversion of 1,4-butanediol diacrylate to 4-hydroxybutyl acrylate: purification, characterization, gene cloning, and gene expression in Escherichia coli. Biosci. Biotechnol. Biochem. 63:688-697[CrossRef][Medline]. |
| 22. | Sakai, Y., J. H. Maeng, S. Kubota, A. Tani, and Y. Tani. 1996. A non-conventional dissimilation pathway for long chain n-alkanes in Acinetobacter sp. M-1 that starts with a dioxygenase reaction. J. Ferment. Bioeng. 81:286-291[CrossRef]. |
| 23. | Sambrook, J., E. F. Fritsh, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 24. |
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467 |
| 25. |
Scott, C. C. L., and W. R. Finnerty.
1976.
Characterization of intracytoplasmic hydrocarbon inclusions from the hydrocarbon-oxidizing Acinetobacter species HO1-N.
J. Bacteriol.
127:481-189 |
| 26. |
Singer, M. E., and W. R. Finnerty.
1985.
Alcohol dehydrogenases in Acinetobacter sp. strain HO1-N: role in hexadecane and hexadecanol metabolism.
J. Bacteriol.
164:1017-1024 |
| 27. |
Singer, M. E., and W. R. Finnerty.
1985.
Fatty aldehyde dehydrogenases in Acinetobacter sp. strain HO1-N: role in hexadecane and hexadecanol metabolism.
J. Bacteriol.
164:1011-1016 |
| 28. | Southern, E. M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503-517[CrossRef][Medline]. |
| 29. | van Beilen, J. B., M. G. Wubbolts, and B. Witholt. 1994. Genetics of alkane oxidation by Pseudomonas oleovorans. Biodegradation 5:161-174[CrossRef][Medline]. |
| 30. | Wales, M. R., and C. A. Fewson. 1994. Constitutive NADP-dependent alcohol dehydrogenase of Acinetobacter sp. strain HO1-N. Curr. Microbiol. 29:273-277[CrossRef]. |
| 31. |
Weretilnyk, E. A., and A. D. Hanson.
1990.
Molecular cloning of a plant betaine-aldehyde dehydrogenase, an enzyme implicated in adaptation to salinity and drought.
Proc. Natl. Acad. Sci. USA
87:2745-2749 |
| 32. |
Xu, J., and R. C. Johnson.
1995.
aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.
J. Bacteriol.
177:3166-3175 |
| 33. | Yanase, H., K. Ikeyama, R. Mitsui, S. Ra, K. Kita, Y. Sakai, and N. Kato. 1996. Cloning and sequence analysis of the gene encoding 3-hexulose-6-phosphate synthase from the methylotrophic bacterium, Methylomonas aminofaciens 77a, and its expression in Escherichia coli. FEMS Microbiol. Lett. 135:201-205[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»