Previous Article | Next Article ![]()
Applied and Environmental Microbiology, September 2000, p. 3891-3897, Vol. 66, No. 9
Department of Natural Resource Sciences,
McGill University, Macdonald Campus, Ste. Anne de Bellevue,
Québec, H9X 3V9,1 and
Biotechnology Research Institute, National Research Council of
Canada, Montreal, Québec, H4P 2R2,2
Canada
Received 28 February 2000/Accepted 26 June 2000
We studied nitrogen oxide production and consumption by
methanotrophs Methylobacter luteus (group I),
Methylosinus trichosporium OB3b (group II), and an isolate
from a hardwood swamp soil, here identified by 16S ribosomal DNA
sequencing as Methylobacter sp. strain T20 (group I). All
could consume nitric oxide (nitrogen monoxide, NO), and produce small
amounts of nitrous oxide (N2O). Only
Methylobacter strain T20 produced large amounts of NO
(>250 parts per million by volume [ppmv] in the headspace) at
specific activities of up to 2.0 × 10 Nitric oxide (nitrogen monoxide, NO)
is an important trace gas that plays important roles in tropospheric
chemistry and is a factor in acid precipitation and ozone turnover
(12, 13, 38). Soils are a major source of NO, accounting for
up to 40% of the global budget (43), most coming from
arable land (38). Processes of microbial metabolism are
responsible for most of the NO source or sink strength of terrestrial
and aquatic systems.
Biological production and consumption of NO occur via a variety of
reductive and oxidative processes involving heterotrophic and
autotrophic microorganisms. The detailed mechanisms of these processes
are not yet fully understood but are further considered in the
Discussion section.
Methane-oxidizing bacteria are important in reducing global emissions
of methane from terrestrial and aquatic systems. They also participate
in various nitrogen cycle processes: nitrate and ammonium assimilation,
nitrogen fixation (15), and nitrification (6).
They produce nitrous oxide (N2O) during nitrification in
ammonium-containing medium (24, 26, 47). Methylomonas agile and Methylosinus trichosporium, group I and II
methanotrophs, respectively, consume NO, but aerobic cultures in
ammonium-containing medium were not observed to produce NO
(26). Denitrification was not observed in a detailed study
of 136 methanotrophic bacteria (8). It was reported earlier
in CH4-oxidizing isolates (14), but this has not
been independently confirmed, and there may be some question about the
purity of the isolates.
As part of a study of the potential roles of methanotrophs in nitrogen
cycle processes, we investigated both production and consumption of NO
by Methylobacter luteus (a group I methanotroph), Methylosinus trichosporium OB3b (a group II methanotroph),
and strain T20 (a group I methanotroph isolated from a swamp soil). We
show that strain T20 is a Methylobacter sp. and report the production by it of up to 250 parts per million by volume (ppmv) of NO
in the headspace of cultures growing in nitrate-containing medium.
Microorganisms and culture conditions.
Organisms used were
Methylobacter luteus NCIB 11914 (group I, from R. S. Hanson), Methylosinus trichosporium OB3b (group II, from
R. S. Hanson), and strain T20, a group I methanotroph isolated by
T.R. from the top band of growth in an agarose diffusion column (2) inoculated with a methane enrichment culture obtained
with soil from a hardwood swamp at Mt. St. Hilaire, Québec,
Canada (1). This strain is unusual in that it does not form
colonies on solid or semisolid medium. Culture conditions were as
previously described (33). Ammonium chloride (9.3 mM)
mineral salts (AMS), sodium nitrate (11.7 mM) mineral salts (NMS)
(42), ammonium plus nitrate mineral salts (ANMS), and
mineral salts (MS, as for AMS without nitrogen source) media were used.
Purity was tested microscopically and by plating on nutrient agar.
Erlenmeyer flasks (250 ml), each containing 100 ml of NMS medium, were
closed with rubber stoppers fitted with injection ports, inoculated
with 0.5 ml of a late-exponential-phase culture, and CH4
injected to give a mixing ratio of 30% (vol/vol) in the headspace.
Such main cultures were incubated on a rotary shaker (200 rpm) at
25°C and sampled periodically for the determination of optical
density and CH4, O2, and NO mixing ratios and
for further studies.
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Production and Consumption of Nitric Oxide by Three
Methanotrophic Bacteria
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
17 mol of NO
cell
1 day
1, mostly after a culture became
O2 limited. Production of NO by strain T20 occurred mostly
in nitrate-containing medium under anaerobic or nearly anaerobic
conditions, was inhibited by chlorate, tungstate, and O2,
and required CH4. Denitrification (methanol-supported N2O production from nitrate in the presence of acetylene)
could not be detected and thus did not appear to be involved in the production of NO. Furthermore, cd1 and Cu
nitrite reductases, NO reductase, and N2O reductase could
not be detected by PCR amplification of the nirS,
nirK, norB, and nosZ genes,
respectively. M. luteus and M. trichosporium
produced some NO in ammonium-containing medium under aerobic
conditions, likely as a result of methanotrophic nitrification and
chemical decomposition of nitrite. For Methylobacter strain
T20, arginine did not stimulate NO production under aerobiosis, suggesting that NO synthase was not involved. We conclude that strain
T20 causes assimilatory reduction of nitrate to nitrite, which then
decomposes chemically to NO. The production of NO by methanotrophs such
as Methylobacter strain T20 could be of ecological significance in habitats near aerobic-anaerobic interfaces where fluctuating O2 and nitrate availability occur.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Production and consumption of NO. Production of NO was measured in the presence and absence of O2 and presence of CH4 unless otherwise stated. The zero-order production rates were estimated by linear regression of NO mixing ratios against time.
Consumption of 2 ppmv of NO was first order, so rate constants were estimated by logarithmic regression of NO mixing ratios against time, and the rates presented were calculated at 1 ppmv of NO. In these experiments, autoclaved medium without cells was used as a control and results were corrected for the extremely low rates of NO disappearance in such controls.Studies with different nitrogen sources.
Cultures (100 ml)
in NMS were harvested by centrifugation (12,100 × g,
10 min, 4°C) three times and resuspension in MS medium. Pellets were
finally suspended in MS containing the desired nitrogen source(s) (9.3 mM NH4Cl, 11.7 mM NaNO3, or 11.7 mM arginine-N) to the final optical density (OD) indicated in the Results section. Samples (10 ml) of such suspensions were transferred to 60-ml serum
bottles that were then evacuated and filled with He plus desired mixing
ratios of CH4 and O2. After appropriate
incubation times at 25°C, pH, OD660, and concentrations
of NO3
, NO2
, NO,
and N2O were measured.
Denitrification. Denitrification by strain T20 was tested for using an acetylene (C2H2) inhibition method (48) but in a way similar to that used for methanotrophic N2 fixation (C2H2 reduction) assays (30, 40). Samples (10 ml) of a 5-day-old main culture in NMS medium were transferred to 60-ml serum bottles. Methanol (final concentration, 0.25% [vol/vol], previously shown to support growth of strain T20) was added, and the bottles were evacuated to remove residual CH4. Then C2H2 (2% final), or an equal volume of He, or sodium azide (0.5 mM final concentration) was added to triplicate bottles. N2O concentrations were measured after 2 and 5 days of incubation. In another experiment, 10 ml of NMS medium in serum bottles was directly inoculated with strain T20, incubated under 20% CH4 for 4 days, and then assayed as described above. N2O was determined after 2, 3, and 6 days of incubation.
Analyses.
CH4 and O2 were obtained
from Air Products and Praxair, Montreal, Canada, respectively, and NO
and N2O were obtained from Matheson, Montreal, Canada.
CH4, O2, and OD were determined as described
(33). Cell numbers were counted microscopically using a
Hawksley counting chamber (Lancing, U.K.). NO, N2O,
NO3
, and NO2
were
measured by gas chromatography and colorimetric methods (17).
DNA extraction. A 5-day culture of strain T20 (100 ml) was centrifuged at 17,400 × g for 20 min, and the pellet was resuspended in 1 ml of sterile distilled water. DNA was then extracted using the Fast DNA method for bacterial cultures as described by the manufacturer (BIO 101, Vista, Calif.). DNA was quantified by determination of the absorbance at 260 nm on a DU-600 spectrophotometer (Beckman Instruments).
PCR amplification of genes coding for nitrite, NO, and
N2O reductases and for 16S rRNA from strain T20.
Four
sets of primers were used to amplify genes coding for the
cd1 nitrite reductase (nirS), the
copper nitrite reductase (nirK), the nitric oxide reductase
(norB), and the 16S rRNA. The primers for the two
NO2
reductases, the NO reductase, and the
N2O reductase (nosZ) were designed following
alignment (with the program GeneWorks) of the sequences from different
denitrifying bacteria (R. Roy and C. W. Greer, unpublished data)
retrieved from GenBank (www.ncbi.nlm.nih.org). Conserved regions were
used as the target for the primers. The primer sets were as follows:
nirS from Paracoccus denitrificans Pd1222,
Pseudomonas aeruginosa PAO1, Pseudomonas stutzeri
ATCC 14405, and Ralstonia eutropha H16, F852-881
(5'-CGGCTACGCGGTGCATATCTCGCGTCTGTC-3') and R1138-1167
(5'-GATGGACGCCACGCGCGGCTCGGGGTGGTA-3'); nirK from Achromobacter cycloclastes, Pseudomonas
aeruginosa G179, and Pseudomonas aureofaciens ATCC
13985, F510-539 (5'-GGGCATGAACGGCGCGCTCATGGTGCTGCC-3') and R856-885 (5'-CGGGTTGGCGAACTTGCCGGTGGTCCAGAC-3');
norB from Paracoccus denitrificans
Pd1222, Pseudomonas aeruginosa PAO1, and Pseudomonas
stutzeri ATCC 14405, F1295-1320
(5'-GGCGTGTGGGAACTGATCATGGCTGC-3') and R1722-1747
(5'-GCGCCATAGAAGGCCATGTGGCCGTG-3'); and nosZ from Paracoccus denitrificans Pd1222, Pseudomonas
aeruginosa PAO1, Ralstonia eutropha H16, and
Pseudomonas stutzeri ATCC 14405, F1408-1437 (5'-CTGGGTCTCGGGCCGCTGCACACCACCTTC-3') and R1675-1704
(5'-GATCAGCTGCTCGTTCTCCGGATGCAGCGG-3').
16S rDNA sequence. For the sequencing of the 16S rDNA gene, 16S rDNA amplicons (1.5 kb) generated by PCR were first purified through a QiaQuick column (Qiagen, Mississauga, Canada). The purified DNA fragments were then used as templates for PCR reactions using a single primer. Besides primers F1 and R13, primers F2, R1, R2, R5, R8, and R11 were also used (16). Two primers developed in this study were F1B (bases 519 to 536), CAGCMGCCGCGGTAATWC, and F1C (bases 907 to 926), AAACTCAAATGAATTGACGG (M is A or T, and W is A or C). PCRs were performed in 10-µl final volumes with 20 ng of 16S rDNA template, 12 pmol of primer, and 4 µl of D-rhodamine reaction mix (ABI; Perkin Elmer). PCR was done on a Gene Amp 2400 (Perkin Elmer) using 25 cycles of 10 s at 96°C, 5 s at 50°C, and 4 min at 60°C. The amplicon DNA was then purified either by using Centrisep columns (Princeton Separations, Adelphia, N.J.) or by precipitating with ethanol. The purified DNA was dried in a rotary evaporator (Speed Vac; Savant Insts., Farmingdale, N.Y.) and later processed on an ABI 373 DNA Sequencer (Perkin Elmer). Sequence data were analyzed against GenBank through the Blast program.
Nucleotide sequence accession numbers. The 16S rDNA nucleotide sequence for strain T20 was deposited in the GenBank database under accession number AF131868. Other GenBank accession numbers used were as follows: for nirS Paracoccus denitrificans Pd1222 (U05002), Pseudomonas aeruginosa PAO1 (X16452, Pseudomonas stutzeri ATCC 14405 (M80653), and Ralstonia eutropha H16 (X91394); for nirK, Achromobacter cycloclastes (Z48635), Pseudomonas aeruginosa G179 (M97294), and Pseudomonas aureofaciens ATCC 13985 (Z21945); for norB, Paracoccus denitrificans Pd1222 (U28078), Pseudomonas aeruginosa PAO1 (D38133), and Pseudomonas stutzeri ATCC 14405 (Z28384); and for nosZ, Pseudomonas stutzeri ATCC14405 (M22628), Pseudomonas aeruginosa PAO1 (X65277), Ralstonia eutropha H16 (X74792), and Paracoccus denitrificans Pd1222 (X65278).
| |
RESULTS |
|---|
|
|
|---|
Production and consumption of NO.
Methylobacter luteus
and Methylosinus trichosporium accumulated very low
concentrations (<0.03 ppmv) of NO during growth in NMS medium (Fig. 1A
and 2A).
However, once O2 became significantly depleted, strain T20
accumulated NO nearly linearly up to mixing ratios of about 250 ppmv
(Fig. 3A). Short-term measurements of anaerobic NO production rates
showed that this activity was below the detection limit of our method
in M. luteus and M. trichosporium (Fig. 1B and
2B), but in strain T20 (Fig. 3B) rates
increased during the period of O2 depletion and reached 3 pmol of NO ml
1 min
1 in stationary phase.
This was equal to a specific activity of 1.36 × 10
17 mol of NO cell
1 day
1.
Consumption of NO could not be detected under anaerobiosis because of
the NO production that occurred under such conditions, and the isotope
dilution study that would have been necessary to elucidate this was
beyond the scope of this study. However, in the presence of 20%
O2, all three organisms showed aerobic NO consumption rates rising to about 2 pmol of NO ml
1 min
1
during the growth of the culture, and in the case of strain T20, this
rate was relatively constant from 2 to 7 days of growth of the main
culture. Only after the first 3 days of growth of the culture of strain
T20 (Fig. 3A) was the production of NO greater than its potential
consumption rate (Fig. 3B), thus allowing accumulation of NO in the
culture (Fig. 3A).
|
|
|
Effect of oxygen.
Oxygen inhibited the production of NO by
strain T20 (Fig. 4). Production of NO was
maximum at the lowest measured O2 concentration (<0.2%)
and decreased rapidly at higher O2, reaching zero at about 0.75% O2.
|
1
min
1) only in the presence of CH4 and no
added O2, suggesting a requirement for CH4 as a
source of reducing power (see Discussion).
Nitrogen sources.
Potential nitrogen sources for the
production of NO by strain T20 were studied by analyzing for NO in
samples of a 5-day NMS culture washed and resuspended in MS alone and
in MS containing NH4Cl, NaNO3, or arginine and
10% CH4 for a period of 18 h. With 20%
O2 no NO was produced in any medium, and at 0%
O2 NO was produced only in NMS in the presence of
CH4 at a rate of 0.42 pmol of NO ml
1
min
1. These results suggest once again that a reductive
process is involved and that an O2-requiring NO synthase
such as that reported in Nocardia (11) is not involved.
|
Inhibitors of nitrate reductase. Potassium chlorate (20 mM) caused >99% inhibition of growth and methane consumption and 98% inhibition of production of NO and CO2 in aerobic cultures of strain T20 growing in NMS over a 12-day period (data not shown). In similar cultures, sodium tungstate (25 mM) completely suppressed methane consumption and production of NO and CO2 (T. Ren and R. Knowles, unpublished data). Chlorate inhibits assimilatory nitrate reductase (31), and tungstate causes formation of inactive nitrate reductase (39), so their effects in the present study provide further evidence for the involvement of a nitrate reductase, probably the assimilatory type B.
Denitrification. Reduction of residual nitrate to N2O by strain T20 was tested for in the presence of methanol as the reductant and either C2H2 or sodium azide to inhibit an N2O reductase. Only about 15 to 19 ppmv of N2O were produced in both the presence and absence of 2% C2H2, and sodium azide caused less N2O production than was observed in the controls (T. Ren and R. Knowles, unpublished data). Thus, there was no evidence for the presence of a denitrification system in strain T20.
Despite the lack of physiological evidence for the presence of denitrification as a possible source of NO, we also used molecular tools to test for the presence of denitrifying reductases. PCR primers designed to amplify a 316-bp fragment from the cd1 nitrite reductase (nirS), a 378-bp fragment from the Cu nitrite reductase (nirK), a 433-bp fragment from the NO reductase (norB), and a 297-bp fragment from the N2O reductase (nosZ) of denitrifying bacteria were tested on genomic DNA extracted from strain T20. No amplification was observed with any of these primers at annealing temperatures of 50 and 60°C, although the 16S rDNA gene was successfully amplified with universal primers F1 and R13. Previously published PCR primers reported to amplify nirS and nirK genes (9, 20) were also tested against DNA from strain T20. At annealing temperatures of 50 and 60°C, these primers failed to amplify any denitrification genes from strain T20. These results suggest that nitrite reductase, NO reductase, and N2O reductase are absent in strain T20, or if present, they are significantly different from the corresponding denitrifying reductases.Production of nitrogen oxides.
The time course of NO
production by strain T20 in initially aerobic NMS medium was studied
next, and NO3
, NO2
,
and N2O were also measured. At about the time of
O2 depletion (after about 3 days of incubation), there was
accumulation of micromole quantities of NO and
NO2
and nanomole quantities of
N2O (Fig. 5). About 2 mmol of
NO3
were consumed, presumably mainly by
assimilation. During NO production, the specific activity was 2.0 × 10
17 mol of NO produced cell
1
day
1. The N oxide products were, in order of abundance
(micromoles per flask), NO2
(35) > NO
(2.2) > N2O (0.19), and once again reductive
processes seemed to be involved.
|
, but this did not result in
great NO production (Table 4). Some nitrification (production of
NO2
or NO3
)
occurred in AMS with all strains, especially with low (1%)
CH4 and 20% O2, and although this was
accompanied by some NO production in M. luteus (Table 2) and
both NO2
and NO production in M. trichosporium (Table 3), the very low nitrification by strain T20
was associated with only moderate NO production (Table 4).
|
|
|
| |
DISCUSSION |
|---|
|
|
|---|
We report for the first time the production of significant amounts
of NO (up to 250 ppmv in the gas phase, or 0.45 µM) by O2-deficient cultures of a methanotroph, here tentatively
identified as Methylobacter sp. strain T20, isolated from a
mixed-hardwood swamp soil. The specific activities of NO production (up
to 2.0 × 10
17 mol of NO cell
1
day
1) were close to rates reported for some denitrifiers
(3) but much lower than reported for others (32).
Much smaller amounts of NO were produced by M. luteus and
M. trichosporium. Production of NO was not detected by
Krämer et al. (26) in Methylomonas agile
and M. trichosporium, but their experimental conditions were
aerobic only. Methanotrophs become O2 limited below a
critical concentration of about 5.7 µM (0.45%) O2
(33). Here, even in the absence of added O2, the
presence of CH4 stimulated NO production, perhaps because
some contaminating O2 allowed CH4 to act as a source of reducing power for the cells. All three bacteria used in our
study consumed NO under aerobic conditions, in agreement with
Krämer et al. (26).
Production of N2O by the three methanotrophs studied here
was much less than that of NO, with a maximum specific activity for
strain T20 of 5.1 × 10
18 mol of N2O-N
cell
1 day
1. This activity is at least
1,000-fold lower than the specific denitrifying enzyme activity (DEA)
of 1.75 × 10
14 mol of N2O-N
cell
1 day
1 reported for denitrifiers
assayed in soil (28). Strain T20 did not reduce
N2O in either the presence or absence of CH4
under aerobic or anaerobic conditions (Ren and Knowles, unpublished).
There are several possible mechanisms by which production of NO and N2O could occur (12, 50).
(i) Denitrification, involving an NO-producing
NO2
reductase and NO reductase, has not been
confirmed in methanotrophs (8). For strain T20, nitrate (in
NMS medium) supported most NO production under anaerobic or nearly
anaerobic conditions, but the fact that C2H2
did not stimulate anaerobic production of N2O from nitrate by methanol-supported cells of strain T20 and the lack of detection by
PCR analysis of cd1 or copper-type
NO2
reductases, NO reductase, and
N2O reductase suggest that denitrification is unlikely.
(ii) Nitrification by autotrophic bacteria releases NO and some
N2O via an NO2
reductase,
especially at lower O2 concentrations. N2O but
not, so far, NO has been reported as a product of nitrification by methanotrophs in aerobic ammonium-containing medium (AMS) (12, 26,
47). The small amounts of N2O and larger amounts of
NO produced in this study in aerobic AMS by all three bacteria suggest a methanotrophic nitrification source. The mechanisms could involve chemical decomposition (chemodenitrification) of the products of
NH3 oxidation, NH2OH and/or
NO2
. We have confirmed (Ren and Knowles,
unpublished) that chemical decomposition of
NO2
does occur in our mineral salts medium,
that it is inversely related to pH and proportional to
NO2
concentration (compare reference
35), and occurs three to four times more rapidly
with living than with boiled cells of strain T20. However, it is
difficult to assign relative importance to biological versus chemical
processes in the production of NO by strain T20.
(iii) Activity of dissimilatory NO3
reductase
in bacteria other than denitrifiers can release some N2O
(3, 7, 45). In Escherichia coli, a functional
NO3
reductase appears to be necessary for
production of N2O (37) and NO (21)
during NO2
reduction, and a flavohemoglobin
can reduce NO to N2O (23). There is also
evidence that Bacillus cereus produces NO during NO3
respiration (22).
(iv) Assimilation of NO3
can result in
N2O release (7), but production of NO during
assimilation has not been clearly demonstrated. Our experiments with
ammonia- and nitrate-containing media and the effects of chlorate and
tungstate suggest that assimilatory nitrate reduction, followed by
chemical decomposition of nitrite, is a likely mechanism for the
production of the relatively large amounts of NO and the smaller
amounts of N2O by strain T20 following assimilation in NMS medium.
(v) NO synthase, reported in mammalian systems and in a Nocardia sp. (11), requires arginine and O2. NO synthase does not appear to be a likely mechanism in strain T20, since arginine does not stimulate and O2 inhibits NO production.
(vi) Anaerobic reduction of NO3
or
NO2
to NO can be catalyzed by a xanthine
oxidoreductase, an enzyme reported in mammalian systems (29)
and in ureide-producing plant root nodules (4) but not to
our knowledge in bacteria. Such a mechanism also seems unlikely but
remains a possibility for future study.
The 250 ppmv (ca. 0.45 µM) of NO produced by strain T20 is probably
toxic for many microorganisms. Two Micrococcus spp. and a
Staphylococcus aureus strain were inhibited markedly by <2
ppmv of NO but, surprisingly, less inhibited if NO was oxidized to NO2 (27). Unrealistically high NO concentrations
(ca. 100 µM) inhibit oxidase activity of membrane vesicles from
anaerobically grown Paracoccus denitrificans and from bovine
heart submitochondrial particles (10). In general, the
effects of low NO concentrations (<5 µM) are direct, by binding to
heme copper cofactors involved in cellular regulation or by reacting
with O2
radicals to produce reactive N oxide
species such as peroxynitrite (OONO
), NO2,
N2O3, and N2O4
(44), which can then exert other indirect effects. These
products would be less likely under the hypoxic conditions that promote
NO production in strain T20.
The manner in which strain T20 might protect itself from toxic NO is not clear from our data. This strain consumes NO rapidly under aerobic conditions, and the lack of net consumption under anaerobiosis suggests that activity of a denitrifying NO reductase with a low Km (1 to 6 nM NO) is unlikely. An NO-binding cytochrome c', as reported in denitrifying Alcaligenes and Achromobacter spp. (46) and in Methylococcus capsulatus (49), and other NO-binding hemoproteins (23) may exert a protective effect. It is also possible that there may be spatial separation of production and consumption in the cell, but the high diffusion velocity of NO would make this unlikely. The aerobic consumption and oxidation of NO by as yet unknown mechanisms in heterotrophs (5, 17, 18, 25) is also not likely under the hypoxic conditions in which most NO is produced, but is probably relevant under aerobic conditions in these methanotrophs (26).
The production of NO under O2-deficient conditions by
bacteria such as Methylobacter sp. strain T20 may be of
ecological significance. Many active methanotrophs occur close to
aerobic-anaerobic interfaces in habitats where autotrophic or
methanotrophic nitrification can lead to accumulation of
NO2
and/or NO3
. In
such regions, changing location of the interface can cause methanotrophs to suffer O2 deficiency and to contribute to
the gross production of NO. Whether this results in emission from the
habitat would then depend on all of the NO-consuming microbial activities. Indeed, up to 95% of gross NO production in an organic soil is recycled by oxidation within the soil, greatly restricting emission (19).
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by a grant to R.K. from the Natural Sciences and Engineering Research Council of Canada.
We thank R. S. Hanson for the gift of Methylobacter luteus and Methylosinus trichosporium OB3b and W. G. Zumft and J. M. Tiedje for permission to use plasmids pnir9 (nirS), pNORCB1 (norB), and pMW12 (nosZ) (W.G.Z.), and pRTC19 (nirK) (J.M.T.) obtained through Y. K. Chan. We thank C. Greer for useful discussion and facilities, H. Bergeron for technical help, and two anonymous reviewers for helpful comments.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Dept. of Natural Resource Sciences, McGill University, Macdonald Campus, 21 111 Lakeshore Rd., Ste. Anne de Bellevue, QC H9X 3V9, Canada. Phone: (514) 398-7751. Fax: (514) 398-7990. E-mail: knowles{at}nrs.mcgill.ca.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Amaral, J. A., and R. Knowles.
1994.
Methane metabolism in a temperate swamp.
Appl. Environ. Microbiol.
60:3945-3951 |
| 2. | Amaral, J. A., and R. Knowles. 1995. Growth of methanotrophs in methane and oxygen counter gradients. FEMS Microbiol. Lett. 126:215-220[CrossRef]. |
| 3. |
Anderson, I. C., and J. S. Levine.
1986.
Relative rates of nitric oxide and nitrous oxide production by nitrifiers, denitrifiers, and nitrate respirers.
Appl. Environ. Microbiol.
51:938-945 |
| 4. |
Atkins, C. A.,
P. J. Sanford,
P. J. Storer, and J. S. Pate.
1988.
Inhibition of nodule functioning in cowpea by a xanthine oxidoreductase inhibitor, allopurinol.
Plant Physiol.
88:1229-1234 |
| 5. | Baumgärtner, M., M. Koschorreck, and R. Conrad. 1996. Oxidative consumption of nitric oxide by heterotrophic bacteria in soil. FEMS Microbiol. Ecol. 19:165-170[CrossRef]. |
| 6. |
Bédard, C., and R. Knowles.
1989.
Physiology, biochemistry, and specific inhibitors of CH4, NH4+, and CO oxidation by methanotrophs and nitrifiers.
Microbiol. Rev.
53:68-84 |
| 7. |
Bleakley, B. H., and J. M. Tiedje.
1982.
Nitrous oxide production by organisms other than nitrifiers or denitrifiers.
Appl. Environ. Microbiol.
44:1342-1348 |
| 8. |
Bowman, J. P.,
L. I. Sly,
P. D. Nichols, and A. C. Hayward.
1993.
Revised taxonomy of the methanotrophs: description of Methylobacter gen. nov., emendation of Methylococcus, validation of Methylosinus and Methylocystis species, and a proposal that the family Methylococcaceae include only the group I methanotrophs.
Int. J. Syst. Bacteriol.
43:735-753 |
| 9. |
Braker, G.,
A. Fesefeldt, and K.-P. Witzel.
1998.
Development of PCR primer systems for amplification of nitrite reductase genes (nirK and nirS) to detect denitrifying bacteria in environmental samples.
Appl. Environ. Microbiol.
64:3769-3775 |
| 10. | Carr, G. J., and S. J. Ferguson. 1990. Nitric oxide formed by nitrite reductase of Paracoccus denitrificans is sufficiently stable to inhibit cytochrome oxidase activity and is reduced by its reductase under aerobic conditions. Biochim. Biophys. Acta 1017:57-62[Medline]. |
| 11. |
Chen, Y. J., and J. P. N. Rosazza.
1995.
Purification and characterization of nitric oxide synthase (NOSNOC) from a Nocardia species.
J. Bacteriol.
177:5122-5128 |
| 12. |
Conrad, R.
1996.
Soil microorganisms as controllers of atmospheric trace gases (H2, CO, CH4, OCS, N2O, and NO).
Microbiol. Rev.
60:609-640 |
| 13. | Conrad, R. 1996. Metabolism of nitric oxide in soil and soil microorganisms and regulation of flux into the atmosphere, p. 167-203. In J. C. Murrell, and D. P. Kelly (ed.), Microbiology of atmospheric trace gases. NATO Sci. Ser., vol. 139. Springer-Verlag, Heidelberg, Germany. |
| 14. | Davies, T. R. 1973. Isolation of bacteria capable of utilizing methane as a hydrogen donor in the process of denitrification. Water Res. 7:575-579[CrossRef]. |
| 15. | De Bont, J. A. M., and E. G. Mulder. 1974. Nitrogen fixation and co-oxidation of ethylene by a methane-utilizing bacterium. J. Gen. Microbiol. 83:113-121. |
| 16. | Dorsch, M., and E. Stackebrandt. 1992. Some modification in the procedure of direct sequencing of PCR amplified 16S rDNA. J. Microbiol. Methods 16:271-279. |
| 17. | Dunfield, P. F., and R. Knowles. 1997. Biological oxidation of nitric oxide in a humisol. Biol. Fertil. Soils 24:294-300[CrossRef]. |
| 18. | Dunfield, P. F., and R. Knowles. 1998. Organic matter, heterotrophic activity, and NO consumption in soils. Global Change Biol. 4:199-207. |
| 19. | Dunfield, P. F., and R. Knowles. 1999. Nitrogen monoxide production and consumption in an organic soil. Biol. Fertil. Soils 30:153-159. |
| 20. |
Hallin, S., and P.-E. Lindgren.
1999.
PCR detection of genes encoding nitrite reductase in denitrifying bacteria.
Appl. Environ. Microbiol.
65:1652-1657 |
| 21. | Ji, X.-B., and T. C. Hollocher. 1989. Nitrate reductase of Escherichia coli as a NO-producing nitrite reductase. Biochem. Arch. 5:61-66. |
| 22. | Kalkowski, L., and R. Conrad. 1991. Metabolism of nitric oxide in denitrifying Pseudomonas aeruginosa and nitrate respiring Bacillus cereus. FEMS Microbiol. Lett. 82:107-111[CrossRef]. |
| 23. | Kim, S. O., Y. Orii, D. Lloyd, M. N. Hughes, and R. K. Poole. 1999. Anoxic function for the Escherichia coli flavohaemoglobin (Hmp): reversible binding of nitric oxide and reduction to nitrous oxide. FEBS Lett. 445:389-394[CrossRef][Medline]. |
| 24. | Knowles, R., and E. Topp. 1988. Some factors affecting nitrification and the production of nitrous oxide by the methanotrophic bacterium Methylosinus trichosporium OB3b, p. 383-393. In G. G. Sermanni, and P. Nannipieri (ed.), Current perspectives in environmental biogeochemistry. C.N.R.-I.P.R.A., Rome, Italy. |
| 25. | Koschorreck, M., E. Moore, and R. Conrad. 1996. Oxidation of nitric oxide by a new heterotrophic Pseudomonas sp. Arch. Microbiol. 166:23-31[CrossRef][Medline]. |
| 26. | Krämer, M., M. Baumgärtner, M. Bender, and R. Conrad. 1990. Consumption of NO by methanotrophic bacteria in pure culture and in soil. FEMS Microbiol. Ecol. 73:345-350[CrossRef]. |
| 27. |
Mancinelli, R., and C. P. McKay.
1983.
Effects of nitric oxide and nitrogen dioxide on bacterial growth.
Appl. Environ. Microbiol.
46:198-202 |
| 28. |
Martin, K.,
L. L. Parsons,
R. E. Murray, and M. S. Smith.
1988.
Dynamics of soil denitrifier populations: relationships between enzyme activity, most-probable-number counts, and actual N gas loss.
Appl. Environ. Microbiol.
54:2711-2716 |
| 29. | Millar, T. M., C. R. Stevens, N. Benjamin, R. Eisenthal, R. Harrison, and D. R. Blake. 1998. Xanthine oxidoreductase catalyses the reduction of nitrates and nitrite to nitric oxide under hypoxic conditions. FEBS Lett. 427:225-228[CrossRef][Medline]. |
| 30. | Murrell, J. C., and H. Dalton. 1983. Nitrogen fixation in obligate methanotrophs. Appl. Environ. Microbiol. 129:3481-3486. |
| 31. | Pichinoty, F. 1973. La réduction bactérienne des composés oxygénés minéraux de l'azote. Bull. Inst. Pasteur 71:317-395. |
| 32. | Remde, A., and R. Conrad. 1991. Production and consumption of nitric oxide by denitrifying bacteria under anaerobic and aerobic conditions. FEMS Microbiol Lett. 80:329-332[CrossRef]. |
| 33. | Ren, T., J. A. Amaral, and R. Knowles. 1997. The response of methane consumption by pure cultures of methanotrophic bacteria to oxygen. Can. J. Microbiol. 43:925-928. |
| 34. | Sambrook, J., T. S. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 35. | Samouilov, A., P. Kuppusamy, and J. L. Zweier. 1998. Evaluation of the magnitude and rate of nitric oxide production from nitrite in biological systems. Arch. Biochem. Biophys. 357:1-7[CrossRef][Medline]. |
| 36. | Smith, K. S., A. M. Costello, and M. E. Lidstrom. 1997. Methane and trichloroethylene oxidation by an estuarine methanotroph, Methylobacter sp. strain BB5.1. Appl. Environ. Microbiol. 63:4617-4620[Abstract]. |
| 37. |
Smith, M. S.
1983.
Nitrous oxide production by Escherichia coli is correlated with nitrate reductase activity.
Appl. Environ. Microbiol.
45:1545-1547 |
| 38. | Stohl, A., E. Williams, G. Wotowa, and H. Kromp-Kolb. 1996. A European inventory of soil nitric oxide emissions and the effect of these emissions on the photochemical formation of ozone. Atmos. Environ. 30:3741-3755[CrossRef]. |
| 39. | Takahashi, H., and A. Nason. 1957. Tungstate as a competitive inhibitor of molybdate in nitrate assimilation and N2 fixation by Azotobacter. Biochim. Biophys. Acta 23:433-434. |
| 40. | Takeda, K. 1988. Characteristics of a nitrogen-fixing methanotroph, Methylocystis T-1. Antonie van Leeuwenhoek J. Microbiol. Serol. 54:521-534. |
| 41. | Tourova, T. P., M. V. Omel'chenko, K. V. Fegeding, and L. V. Vasil'eva. 1999. The phylogenetic position of Methylobacter psychrophilus sp. nov. Microbiology 69:493-495. (Translated from Microbiologiya 68:568-570, 1998.) |
| 42. |
Whittenbury, R.,
K. C. Phillips, and J. F. Wilkinson.
1970.
Enrichment, isolation and some properties of methane-utilizing bacteria.
J. Gen. Microbiol.
61:205-218 |
| 43. | Williams, E. J., A. Guenther, and F. C. Fehsenfeld. 1992. An inventory of nitric oxide emissions from soils of the United States. J. Geophys. Res. 97:7511-7519. |
| 44. | Wink, D. A., M. B. Grisham, J. B. Mitchell, and P. C. Ford. 1996. Direct and indirect effects of nitric oxide in chemical reactions relevant to biology. Methods Enzymol. 268:12-31[CrossRef][Medline]. |
| 45. | Yoshida, T., and M. Alexander. 1970. Nitrous oxide formation by Nitrosomonas europaea and heterotrophic microorganisms. Soil Sci. Soc. Am. Proc. 34:880-882. |
| 46. |
Yoshimura, R.,
H. Iwasaki,
S. Shidara,
S. Suzuki,
A. Nakahara, and T. Matsubara.
1988.
Nitric oxide complex of cytochrome c' in cells of denitrifying bacteria.
J. Biochem.
103:1016-1019 |
| 47. | Yoshinari, T. 1985. Nitrite and nitrous oxide production by Methylosinus trichosporium. Can. J. Microbiol. 31:139-144[Medline]. |
| 48. | Yoshinari, T., and R. Knowles. 1976. Acetylene inhibition of nitrous oxide reduction by denitrifying bacteria. Biochem. Biophys. Res. Commun. 69:705-710[CrossRef][Medline]. |
| 49. | Zahn, J. A., D. M. Arciero, A. B. Hooper, and A. A. DiSpirito. 1996. Cytochrome c' of Methylococcus capsulatus Bath. Eur. J. Biochem. 240:684-691[Medline]. |
| 50. | Zumft, W. 1993. The biological role of nitric oxide in bacteria. Arch. Microbiol. 160:253-264[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»