Previous Article | Next Article 
Applied and Environmental Microbiology, January 2001, p. 22-32, Vol. 67, No. 1
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.1.22-32.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Molecular Ecology of Tetracycline Resistance:
Development and Validation of Primers for Detection of Tetracycline
Resistance Genes Encoding Ribosomal Protection Proteins
R. I.
Aminov,*
N.
Garrigues-Jeanjean, and
R. I.
Mackie
Department of Animal Sciences, University of
Illinois at Urbana-Champaign, Urbana, Illinois 61801
Received 5 July 2000/Accepted 6 October 2000
 |
ABSTRACT |
Phylogenetic analysis of tetracycline resistance genes encoding the
ribosomal protection proteins (RPPs) revealed the monophyletic origin
of these genes. The most deeply branching class, exemplified by
tet and otrA, consisted of genes from the
antibiotic-producing organisms Streptomyces rimosus and
Streptomyces lividans. With a high degree of confidence,
the corresponding genes of the other seven classes (Tet M, Tet S, Tet
O, Tet W, Tet Q, Tet T, and TetB P) formed phylogenetically distinct
separate clusters. Based on this phylogenetic analysis, a set of PCR
primers for detection, retrieval, and sequence analysis of the
corresponding gene fragments from a variety of bacterial and
environmental sources was developed and characterized. A pair of
degenerate primers targeted all tetracycline resistance genes encoding
RPPs except otrA and tet, and seven other
primer pairs were designed to target the specific classes. The primers
were used to detect the circulation of these genes in the rumina of
cows, in swine feed and feces, and in swine fecal streptococci. Classes
Tet O and Tet W were found in the intestinal contents of both animals,
while Tet M was confined to pigs and Tet Q was confined to the rumen.
The tet(O) and tet(W) genes circulating in the
microbiota of the rumen and the gastrointestinal tract of pigs were
identical despite the differences in animal hosts and antibiotic use
regimens. Swine fecal streptococci uniformly possessed the
tet(O) gene, and 22% of them also carried
tet(M). This population could be considered one of the main
reservoirs of these two resistance genes in the pig gastrointestinal
tract. All classes of RPPs except Tet T and TetB P were found in the commercial components of swine feed. This is the first demonstration of
the applicability of molecular ecology techniques to estimation of the
gene pool and the flux of antibiotic resistance genes in production animals.
 |
INTRODUCTION |
Antibiotic resistance research has
been and still is confined primarily to the study of cultivable
bacterial isolates of mostly clinical origin. However, the cultivable
isolates may represent only a fraction of the actual microbiota
(1) where the antibiotic resistance genes reside. For
example, no bacteria can be grown from more than 80% of all clinical
samples sent to clinical microbiology laboratories (4),
and certainly no antibiotic resistance profile can be determined if
cultivation fails. Another important issue with antibiotic resistance
is the fact that the wide use of antibiotics not only selects for
drug-resistant pathogenic bacteria but also exerts selective pressure
on the normal commensal microbiota. In light of the ubiquitously
demonstrated phenomenon of horizontal antibiotic resistance gene
transfer in the microbial world, the presence of such reservoirs may
explain the rapid dissemination of antibiotic resistance from commensal
organisms to the pathogenic microbiota. However, information regarding
the antibiotic resistance pool in commensal microbiotas is very scarce,
and the data are mostly phenotypical. Therefore, development of
genotyping tools for detection and tracking of antibiotic resistance
genes in a variety of commensal and pathogenic bacteria, as well as in
the environment, is essential for understanding the ecology of
antibiotic resistance.
One of the attractive models for studying the ecology of antibiotic
resistance could be the genes conferring resistance to tetracyclines.
Tetracyclines belong to a family of broad-spectrum antibiotics that
includes tetracycline, chlortetracycline, doxycycline, and minocycline.
These antibiotics inhibit protein synthesis in gram-positive and
gram-negative bacteria by preventing the binding of aminoacyl-tRNA
molecules to the 30S ribosomal subunit (36). Bacterial
resistance to tetracycline is mediated mainly by two mechanisms,
protection of ribosomes by large cytoplasmic proteins (5, 6, 23,
33, 43) and energy-dependent efflux of tetracycline (18,
33, 36). A third mechanism, enzymatic inactivation of
tetracycline, is relatively uncommon and has been described in only one
species (41). The first nomenclature for tetracycline
resistance determinants was proposed in 1989 (17), and a
recent update appeared in 1999 (19). The ribosomal
protection mechanisms identified so far fall into six classes: Tet M,
Tet O, TetB P, Tet Q, Tet S, and otrA (43).
Almost all representatives of these classes have been sequenced and
have been shown to encode proteins with N-terminal amino acid sequence
similarity to translation elongation factors EF-Tu and EF-G (6,
22, 35, 43).
Since their introduction in the 1950s, tetracyclines have been widely
used in human and veterinary medicine, as growth promoters in animal
industry, and for prophylaxis in plant agriculture and aquaculture. At
present, resistance to tetracyclines has spread to almost all bacterial
genera, and this situation perhaps is the consequence of previous
overuse. Among the ribosomal protection determinants, Tet M was
described originally in streptococci (5, 24) and
subsequently in a broad variety of gram-positive and gram-negative
bacteria (32). The Tet S determinant was encountered first
on a plasmid in the food pathogen Listeria monocytogenes (7), later in a number of Enterococcus faecalis
strains (8), and recently on a plasmid of
Lactococcus lactis isolated from raw milk (31).
Tet O-related sequences were determined first in plasmids from
campylobacteria (40, 42), then in streptococci (16,
45), and recently in a rumen bacterium, Butyrivibrio fibrisolvens (2). Finding nearly identical
tet(Q) sequences in Prevotella ruminicola (a
typical inhabitant of the rumen) and in Bacteroides (a
typical inhabitant of the human gastrointestinal tract)
(29) suggested that bacteria normally found in the guts of
different species can exchange DNA, presumably during transient colonization of the animal intestine by human-associated bacteria or
vice versa. This scenario is supported by recent work which described
the occurrence of the tet(W) gene in the rumen and in human
and pig intestinal microbiotas (37). Sequence analysis of
this gene from taxonomically divergent rumen and human bacterial isolates showed that there was no or just one nucleotide substitution in a 1.25-kb amplified internal fragment. Misincorporation errors during amplification could not be ruled out, suggesting that the sequences may actually be identical in ruminal B. fibrisolvens, Selenomonas ruminantium, and
Mitsuokella multiacidus isolates and in human isolates of
Fusobacterium prausnitzii and Bifidobacterium longum (37). These findings demand that there be
further research targeted at development of genotyping tools for
tracking the movement of antibiotic resistance genes in the environment.
In this study, we initiated research to examine the molecular ecology
of antibiotic resistance. As a model, we used tetracycline resistance
genes encoding the ribosomal protection proteins (RPPs). Phylogenetic
analysis revealed the monophyletic origin of these genes, which allowed
us to design a set of PCR primers suitable for detection of RPP genes
in general, as well as different classes. After validation, this set
was used to detect the corresponding genes in the total DNA of swine
fecal and rumen samples and in swine feed, as well as in fecal
streptococcal isolates from pigs. The primers were also used in a
PCR-denaturing gradient gel electrophoresis (DGGE) analysis to
demonstrate the overall diversity and similarity of RPP genes in
different ecosystems. The methods used in this work can be applied to
study other phylogenetically coherent antibiotic resistance gene families.
 |
MATERIALS AND METHODS |
Phylogenetic analysis and primer design.
All currently
available nucleotide sequences encoding RPPs, as well as the
phylogenetically most closely related elongation factors, EF-Gs, were
downloaded from the GenBank database (3). These included
the sequences of the following RPP genes (the numbers in parentheses
are GenBank accession numbers): E. faecalis DS16 tet(M) (M85225), E. faecalis Tn916
tet(M) (X56353), E. faecalis Tn1545 tet(M)
(X04388), Neisseria meningitidis tet(M) (X75073), Ureaplasma urealyticum tet(M) (U08812), Gardnerella
vaginalis tet(M) (U58986), Neisseria gonorrhoeae 6418 tet(M) (L12241), N. gonorrhoeae 2903 tet(M) (L12242), Staphylococcus aureus tet(M)
(M21136), Streptococcus pneumoniae Tn5251 tet(M)
(X90939), L. monocytogenes BM4210/pIP811 tet(S)
(L09756), L. lactis K214/pK214 tet(S) (X92946),
S. pneumoniae tet(O) (Y07780), Streptococcus mutans DL5 tet(O) (M20925), Campylobacter jejuni
tet(O) (M18896), B. fibrisolvens tet(W) (AJ222769),
Bacteroides fragilis tet(Q) (Z21523), Prevotella
intermedia PDRC-11 tet(Q) (U73497), P. ruminicola
tet(Q) (L33696), B. fragilis BF-2 tet(Q)
(Y08615), Bacteroides thetaiotaomicron tet(Q) (X58717),
Streptococcus pyogenes A498 tet(T) (L42544),
Clostridium perfringens CW92 tetB(P) (L20800),
Streptomyces lividans 1326 tet (M74049), and
Streptomyces rimosus otrA (X53401). Elongation factor
EF-G-encoding genes were obtained from Bacillus subtilis
(D64127), E. faecalis (retrieved from www.tigr.org),
Escherichia coli (X00415), Helicobacter pylori
(AE001539), Thermus thermophilus (X16278), and Aquifex aeolicus (AE000669).
Sequences were aligned with the multiple-sequence alignment program
CLUSTAL W (44). The two-parameter model of Kimura
(14) was used for construction of neighbor-joining trees
(34). The statistical significance of branching was
evaluated by bootstrap analysis (11) involving the
construction of 1,000 trees from resampled data. Sequences within
clusters were separately aligned and compared with each other. PCR
primers were designed to satisfy specificity and so that they could
potentially be used in multiplex PCR with simultaneous coamplification
of the V3 region of 16S ribosomal DNA (rDNA) (26) and in
PCR-DGGE analysis (27). The nine sets of primers and the
expected amplicon sizes are shown in Table
1. A GC clamp
(CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGG) was added to the
reverse primers for use in DGGE analysis (26). The primers
used for amplification of the bacterial V3 region of 16S rDNA were the
primers described previously (27).
Environmental samples and DNA extraction.
Samples of whole
rumen contents were obtained from eight fistulated steers maintained at
the Research Farm of the University of Illinois at Urbana-Champaign.
The animals used are treated with antibiotics only in case of disease,
and no antibiotics are given for prophylaxis or growth promotion. No
tetracyclines had been used for disease treatment in this group of
animals, and the animals were considered free of tetracycline selective
pressure. Fecal samples from six sows were collected at the Swine
Research Farm of the University of Illinois at Urbana-Champaign. In
this facility, in addition to therapeutic use, antibiotics are added to
feed for prophylactic and growth-promoting purposes. The sows were
routinely fed Tylan (Elanco Animal Health, Indianapolis, Ind.) at a
concentration of 40 mg per kg of feed. The antibiotic was switched to
chlortetracycline (400 mg per kg of feed) for 2 weeks and then back to
Tylan. Fecal samples were collected 3 weeks after the switch back to
Tylan. Rumen and fecal samples were frozen at
20°C for future
isolation of total DNA. Samples of pig feed were stored at room
temperature before DNA isolation. Total DNA was isolated from the
fecal, rumen, and feed samples by using a Soil DNA Purification Kit (Mo
Bio, Solana Beach, Calif.) according to the manufacturer's protocol.
Organisms, plasmids, and culture techniques.
The organisms
and plasmids used in this study for validation and control are listed
in Table 2. C. jejuni subsp.
jejuni ATCC 43503 was grown at 37°C under microaerophilic
conditions on ATCC medium 1115. C. perfringens JIR4202 was
grown anaerobically at 37°C on BHIB medium (Difco Laboratories,
Detroit, Mich.). S. pyogenes CIP105079 was grown aerobically
on BHIB medium (Difco) at 37°C. E. coli strains were grown
on Luria-Bertani medium at 37°C with aeration. Media were solidified
when necessary with 1.8% (wt/vol) agar (Difco). Tetracycline (Sigma
Chemical Co., St. Louis, Mo.) was added at a concentration of 10 µg/ml to cultures of C. jejuni, C. perfringens,
and S. pyogenes. The cloned tet genes were
maintained in E. coli by selection of plasmid antibiotic
markers (ampicillin or kanamycin at a concentration of 50 µg/ml or
chloramphenicol at a concentration of 20 µg/ml).
For isolation of fecal streptococci, fresh fecal samples from six pigs
were resuspended in phosphate-buffered saline (pH 7.0), and dilutions
were plated on MRS agar (Difco) plates. For detection of tetracycline
resistance, colonies were transferred to the same medium with 10 µg
of tetracycline per ml. The taxonomic affiliations of the resulting
isolates were confirmed by sequencing 1.4-kb fragments of 16S rDNA
amplified with bacterial primers (15). DNA similarity
matrixes were calculated by using the DNADIST program in the PHYLIP
package (12). Restriction fragment length polymorphism (RFLP) analysis was accomplished by AluI restriction
digestion of amplified 1.4-kb fragments, followed by electrophoresis on a 3.0% agarose gel.
PCR and DGGE.
A typical PCR mixture (total volume, 20 µl)
contained 25 pmol of each primer (except for the degenerate universal
primers, which were used at a concentration of 100 pmol per mixture),
1× ExTaq reaction buffer (Takara Shuzo, Orsu, Japan), each
deoxynucleoside triphosphate at a concentration of 100 µM, and 1.0 U
of ExTaq DNA polymerase (Takara Shuzo). A 200-ng portion of
purified DNA or one-half of the biomass of a 1- to 2-mm-diameter colony
was used as a template. PCR amplification (25 cycles) was performed with a GeneAmp 2400 PCR system (Perkin-Elmer, Norwalk, Conn.) as
follows: initial denaturation at 94°C for 5 min, followed by 25 cycles of 94°C for 30 s, 30 s of annealing at the annealing temperatures shown in Table 1, and 30 s of extension at 72°C, and a final extension step at 72°C for 7 min. A touchdown PCR with
the degenerate Ribo2 primers (Table 1) was performed as follows:
initial denaturation at 94°C for 5 min; 22 cycles of denaturation at
94°C for 30 s, annealing for 30 s with 1°C decrements at
temperatures of 72 to 50°C, and extension at 72°C for 30 s; 20 cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for
30 s; and final extension at 72°C for 7 min. If unidentified
substances in a DNA preparation inhibited the PCR, 1 µl of the
reaction mixture was used as a template for further amplification.
Aliquots (5 µl) were analyzed by electrophoresis on a 2.5% (wt/vol)
agarose gel (NuSieve; FMC Bioproducts, Rockland, Maine) containing the fluorescent dye GelStar (FMC Bioproducts). Gels with amplicons generated by the Ribo2 primers were stained with ethidium bromide.
For DGGE, polyacrylamide gels with urea-formamide gradients (8%
acrylamide, 15 to 60% urea-formamide, 0.5× TAE buffer; pH 7.4) were
polymerized on Gel-Bond support sheets (FMC Bioproducts). Electrophoresis was performed at 60°C and 150 V for 2 h and then at 200 V for 1 h by using the D-Gene System (Bio-Rad Laboratories, Richmond, Calif.). After electrophoresis, the gels were rinsed in
double-distilled H2O, fixed in a solution containing 10%
ethanol and 0.5% acetic acid, and silver stained. Gel images were
captured and digitized with a Bio-Rad system that included a GS-710
calibrated imaging densitometer connected to a G3 Macintosh computer
with the Diversity Database fingerprinting software. For cloning and sequencing of DGGE bands, the corresponding amplicons were excised from
the gels and equilibrated in TE buffer at room temperature for 30 min,
and 1 µl of the buffer with diffused DNA was used for reamplification.
For estimation of the proportion of antibiotic resistance-carrying
microbiota, total DNA from the rumen and the standard strain [C.
jejuni with tet(O)] were subjected to multiplex PCR
[using amplification conditions for tet(O)] with primer
sets TetO and V3 (targeting the V3 region of 16S rDNA). In this
multiplex PCR, a C. jejuni DNA template was used at various
dilutions. The gel images were digitized, and densitograms were
generated with the NIH Image program
(http://rsb.info.nih.gov/nih-image). Then the densitogram of the rumen
multiplex PCR was compared to the range of C. jejuni
amplification data. In lines having the same density of the TetO
signal, the V3 signal intensities were compared for the total rumen DNA
(all bacterial sequences amplified) and C. jejuni DNA. From
this comparison, the approximate proportion of the suspected
tet(O)-carrying bacteria was calculated.
Cloning and sequencing of PCR amplicons.
PCR products were
cloned by using a TA Cloning kit (Invitrogen, Carlsbad, Calif.). White
colonies of ampicillin-resistant transformants were screened for the
presence of tet fragments by PCR by using the same primer
set that was used for amplification. DNA sequence analysis of
recombinant plasmids was performed for both strands (primers M13F and
M13R) at the University of Illinois Biotechnology Center. On-line
similarity searching was performed by using the BLAST (Basic Local
Alignment Search Tool) family of programs in GenBank (21).
 |
RESULTS |
Phylogenetic analysis.
Phylogenetic analysis was performed
with 25 complete nucleotide sequences encoding RPPs and with six
complete sequences encoding phylogenetically closely related
translation elongation factors belonging to family G (EF-G). With 100%
bootstrap support, this analysis confirmed the monophyletic origin of
RPP genes and the early branching from the other group of elongation
factors, EF-G (Fig. 1). The number of
substitutions per base pair was approximately 2.4 times higher in the
RPP cluster than in the EF-G cluster. Within the RPP supercluster,
there are eight clusters corresponding to the recently revised classes
Tet M, Tet S, Tet O, Tet W, Tet Q, Tet T, TetB P, and otrA.
Three of these clusters, Tet W, Tet T, and TetB P, are represented by
only a single sequence at present.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
Phylogenetic placement of tetracycline resistance genes
encoding RPPs. The sequence of the A. aeolicus fusA gene for
translation elongation factor EF-G was used as the outgroup to root the
tree. The number at each node is the number of times that that tree
configuration occurred in 1,000 bootstrap trials. The scale bar
indicates 0.1 fixed nucleotide substitution per sequence position. The
sets of PCR primers (Table 1) targeting various classes of RPP genes
are shown on the right.
|
|
This analysis suggests that there was early branching between the RPP
genes of antibiotic-producing strains, tet and
otrA, and the other RPP genes circulating in pathogenic and
saprophytic bacteria (Fig. 1). Thus, based on available sequence data,
no evidence of recent horizontal transfer of RPP genes from
antibiotic-producing strains to other bacteria exists at present.
However, there is a high level of similarity, as shown by the extremely
short branch lengths, among the sequences in taxonomically distantly
related bacteria for classes Tet M, Tet S, Tet O, and Tet Q (Fig. 1).
Design and validation of PCR primers targeting RPP genes.
Evidence of the monophyletic origin of the RPP genes opened the
possibility of designing primers that target all genes in the cluster.
However, early branching and further independent diversification,
together with the high G+C contents of the tet and
otrA genes, precluded incorporation of these genes into the alignment analysis. Thus, the design of the universal primer pair was
based on the sequences belonging to seven classes of RPP genes. As
mentioned above, the rate of nucleotide substitution in the RPP cluster
is higher than that in other elongation factors, and therefore, the
overall sequence structure is less conserved. Because of this, the
design of the universal primer pair involved a substantial level of
degeneracy (Table 1). Primer pairs specific for the individual classes,
together with the expected amplicon sizes, are shown in Table 1.
This set of primers was rigorously tested in PCR performed with DNA and
colony biomasses of control strains (Table
3). In all cases except the
tet gene with OTR primers, amplicons of the expected size
were produced with positive controls. We suspect that the failure to
amplify tet with OTR primers was due to structural instability of this gene on a high-copy-number plasmid. The gene was
also shown to be structurally unstable in its original host, S. lividans (10). As expected, no signal was produced
with the pJIR667 template when the universal and class-specific primer sets were used (Table 3). During a previous gene cloning procedure, the
upstream region of the gene was deleted (20). The forward primers of the Ribo2 and TetB/P sets target this lost region, and no
amplification is expected because of this. In all other cases, sequence
analysis of PCR-generated amplicons from control strains confirmed the
specificity of the primers and the identity of the amplified product.
To simplify the detection procedure, biomasses from both colonies and
liquid cultures were used for PCR, and these amplifications were also
successful (Table 3).
Detection of RPP genes in the rumen.
Total DNA preparations
from the rumen samples were subjected to PCR amplification with the
universal primer set, the Ribo2 set, followed by analysis with
class-specific primers. Although the Ribo2 primer set performed well
with pure cultures (Table 3), it was not sufficiently selective during
amplification from total community DNA. According to the analysis with
class-specific primers, the rumen microbiota appeared to bear the
tet(O), tet(Q), and tet(W) genes (data
not shown). The coamplified V3 region of 16S rDNA (data not shown)
allowed a rough estimate of the proportion of the rumen bacterial
microbiota carrying the corresponding resistance genes. Comparative
analysis of densitograms by using biomass of C. jejuni as a
standard suggested that up to 5% of ruminal bacteria may carry
tet(O). The rumen samples were also subjected to PCR-DGGE analysis with the TetO, TetQ, and TetW primer sets, in which GC clamps
were attached to the reverse primers. This analysis revealed the
uniformity of the tet(W) and tet(O) genes
circulating in the rumen microbiota of the cows (Fig.
2, lanes 2 through 9, and Fig. 3, lanes 13 through 20). DGGE bands from
tet(W) samples were excised, reamplified, sequenced, and
found to be identical to the tet(W) sequence
(2). However, the DGGE band from this control template migrated farther than our samples (Fig. 2, lane 13), and careful inspection of the nucleotide sequence of the tet(W) control
revealed a nucleotide substitution (T
C), which may have been
incorporated during amplification from B. fibrisolvens
(2). A DGGE analysis with the TetO primers produced
similar results, with no variations among animals but with two bands
(Fig. 3, lanes 13 through 20). Sequence analysis revealed that these
two bands, which were in the region of tet(O), were actually
identical, but for unknown reasons, the upper band also contained the
reverse DGGE primer misincorporated at the 5' end of the forward
primer, thus increasing the melting temperature and creating artificial
heterogeneity. A DGGE analysis with the TetQ primers revealed diversity
among tet(Q) in the rumen, as well as animal-to-animal
variation (Fig. 4). There were at least
five bands, and sequence analysis confirmed the heterogeneity at the
sequence level.

View larger version (100K):
[in this window]
[in a new window]
|
FIG. 2.
DGGE analysis of tet(W) amplicons from steer
rumen and pig fecal samples. Lanes 1, 10, and 20, synthetic marker
composed of known 16S rDNA sequences with various G+C contents; lanes 2 through 9, rumen samples from steers 277, 279, 280, 281, J277, J279,
J280, and J281, respectively; lanes 11 and 12, negative controls pBT-1
[tet(Q)] and pJIR667 [ tetB(P)],
respectively; lane 13, positive control pGEM-tetW
[tet(W)]; lanes 14 through 19, fecal samples from pigs 1 through 6, respectively.
|
|

View larger version (74K):
[in this window]
[in a new window]
|
FIG. 3.
DGGE analysis of tet(O) amplicons from pig
fecal and steer rumen samples. Lanes 1, 12, and 21, synthetic marker
composed of known 16S rDNA sequences with various G+C contents; lanes 2 through 7, fecal samples from pigs 1 through 6, respectively; lanes 8 and 9, S. alactolyticus O19 and O31, respectively; lanes 10 and 11, negative controls pBT-1 [tet(Q)] and pJIR667
[ tetB(P)], respectively; lanes 13 through 20, rumen
samples from steers 277, 279, 280, 281, J277, J279, J280, and J281,
respectively.
|
|

View larger version (135K):
[in this window]
[in a new window]
|
FIG. 4.
DGGE analysis of tet(Q) amplicons from steer
rumen samples. Lanes 1 and 11, synthetic marker composed of known 16S
rDNA sequences with various G+C contents; lanes 2 through 9, rumen
samples from steers 277, 279, 280, 281, J277, J279, J280, and J281,
respectively; lane 10, positive control pBT-1 [tet(Q)].
|
|
Detection of RPP genes in swine feces.
Total DNA preparations
from swine fecal samples were subjected to PCR amplification with the
universal primer set, the Ribo2 set, and also with class-specific
primers. Tet M, Tet O, and Tet W determinants were detected in the
swine intestinal microbiota (data not shown). Further PCR-DGGE analysis
(Fig. 5) and sequencing demonstrated that
swine tet(M) is identical to the control template, tet(M) cloned from Streptococcus agalactiae.
Interestingly, the tet(O) and tet(W) genes
circulating in the pig herd had the same mobility on DGGE gels as the
corresponding genes from the rumina of steers (Fig. 2 and 3). Sequence
analysis of the excised and cloned major DGGE bands confirmed that
these two classes of genes were identical in the two types of animals.
The difference was that swine fecal samples produced an additional
minor tet(W) band migrating farther than the major band
(Fig. 2, lanes 14 through 19). Several attempts to clone this minor
band were unsuccessful, and sequence information for this band is not
available.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 5.
DGGE analysis of tet(M) amplicons from pig
fecal samples and streptococcal isolates. Lanes 1, 11, and 19, synthetic marker composed of known 16S rDNA sequences with various G+C
contents; lanes 2 through 7, fecal samples from pigs 1 through 6, respectively; lane 8, positive control pFD310 [tet(M)];
lanes 9 and 10, negative controls pBT-1 [tet (Q)] and PCR
mixture without a template, respectively; lanes 12 through 18, S. alactolyticus M15, M113, M118, M33, M35, M30, and M32,
respectively.
|
|
Detection of RPP genes in fecal streptococci from swine.
Fecal
streptococcal isolates from swine (n = 150; 25 isolates
from each of six animals) were characterized by RFLP and 16S rDNA
sequence analyses. As determined by the RFLP analysis, these strains
could be divided into at least three groups (Fig.
6). Sequence analysis allowed
identification (sequence similarity, >99%) as strains of
Streptococcus alactolyticus (Table
4). A majority (94.7%) of the isolates
were resistant to tetracycline at a concentration of 10 µg/ml (Table
5). PCR analysis with our set of primers
revealed that all of the resistant isolates carried the
tet(O) gene (Table 5).Approximately 22% of the strains
carried tet(M) in addition to tet(O). No other
tetracycline resistance determinants conferring ribosomal protection
were detected in these isolates (Table 5). Thus, the
tetracycline-resistant swine S. alactolyticus populations
were characterized by the invariable presence of tet(O), and
22% of the strains carried both tet(O) and
tet(M).

View larger version (165K):
[in this window]
[in a new window]
|
FIG. 6.
RFLP analysis of swine S. alactolyticus
isolates. Lanes 1 and 12, 1-kb ladder (Gibco BRL); lanes 2 through 11, isolates M15, M19, M113, M118, M33, M35, M310, M312, M321, and O31,
respectively. The first group includes only M15; the second group
includes M19, M113, M33, M35, M310, and M321; and the third group
consists of M118, M312, and O31.
|
|
DGGE and sequence analyses of the amplified tet(M) fragments
from streptococcal strains demonstrated that these fragments were
identical (Fig. 5, lanes 12 through 18). Moreover, they were identical
to the fragments amplified directly from the total DNA, as well as to
the control template (Fig. 5). The control template, tet(M),
was originally cloned from S. agalactiae, and its 16S rDNA
sequence was 97% similar to those of our streptococcal isolates. Apparently, in our herd S. alactolyticus populations could
be considered one of the main reservoirs of the tet(M) gene
in the swine intestinal microbiota.
DGGE analysis of streptococcal tet(O) revealed some degree
of heterogeneity. In particular, the amplicons from two isolates, O19
and O35, migrated farther through DGGE gels than the amplicons from
nine other streptococci migrated (the results for O19 are shown in lane
8 of Fig. 3). Sequence analysis of these two amplicons revealed a
single A
G substitution (but the locations were different). However,
as with tet(M), the majority of tet(O) amplicons
(as exemplified by S. alactolyticus O31 in Fig. 3) had the
same melting characteristics as the amplicons amplified from the total
swine fecal DNA (Fig. 3). Because of the universal presence of
tet(O), S. alactolyticus populations could be
considered one of the main reservoirs of the tet(O) gene in
the swine intestinal microbiota. In addition, the TetO-generated DGGE
bands from swine streptococcal isolates had the same mobility on DGGE
gels as the bands from rumen samples (Fig. 3). The occurrence of
tet(O) in cultivable rumen bacteria was not studied, and it
is not clear in which part of the rumen microbiota the gene resides. As
in pig samples, the organisms containing the gene may be the ruminal
streptococci, which have been shown to possess transferable
tetracycline resistance (13).
Detection of RPP genes in swine feed.
Because of the presence
of unidentified inhibitory substances, a second round of PCR was
necessary in the experiments performed with swine feed, and therefore,
the detection limit of this assay was lower than that of the assay
performed with the fecal and rumen samples. The presence of bacterial
DNA in all premix and mixed samples was confirmed by amplification of
the V3 region of bacterial 16S rDNA (Table
6). The presence of RPP genes in these
samples was confirmed first with the Ribo2 primer set and then with
class-specific primers (Table 6). First, the feed components were
sampled before the corresponding diet mixes were prepared for three
different age groups. These groups were the starters (ages, 3 to 6 weeks), growers (6 weeks to 6 months), and finishers (antibiotics were
withdrawn before slaughtering). The corn component used to prepare the
mixes for all age groups contained tet(W), tet(O), tet(Q), and tet(M), while the
soybean component also contained the tet(S) gene (Table 6).
The resistance gene profiles of the commercial whey preparation and the
protein plasma product were similar to that of the soybean component.
Interestingly, the commercial preparation of Tylan (a macrolide which
was used in the grower diet) also contained tetracycline resistance
genes with a profile similar to that of the corn component (Table 6).
The antibiotic mixture used for the starter group (chlortetracycline,
sulfonamide, and penicillin) contained DNA of tetracycline resistance
genes, particularly that of tet(W), tet(O),
tet(Q), tet(M), and tet(S), and had a
profile similar to those of the soybean, whey, and plasma product
components (Table 6).
A second set of samples was taken from fresh mixes and the feed mixes
inside the barns to test the possibility that there was
cross-contamination of the feed inside the barns. However, since the
food components and the mixes already contained the resistance genes
circulating in the pig gut microbiota [tet(M), tet(O), and tet(W)], it was not possible to test
this contamination effect, and there was no difference between the
antibiotic resistance profiles of the freshly prepared feed mix and the
mix obtained inside the barns (Table 6). Interestingly, the
tet(S) signal, which was detected in the soybean component,
disappeared in the mixes used for the grower and finisher stages. Also,
the finisher diet, which was free of any antibiotics, contained the
resistance genes that supposedly came from the corn and soybean
components (Table 6).
 |
DISCUSSION |
This work was the first attempt to use the molecular ecology
approach to study antibiotic resistance and, in particular, to estimate
the gene pool and flux of antibiotic resistance genes in production
animals. With this approach, the first step is elucidation of the
evolutionary history of the genes of interest. From the phylogenetic
analysis, it is evident that the elongation factors conferring
resistance to tetracycline form, with a high degree of confidence, a
phylogenetically coherent group separated from other elongation
factors. Within this group, there are eight clusters, which correspond
to the eight currently defined classes of RPPs (Tet M, Tet S, Tet O,
Tet W, Tet Q, Tet T, TetB P, and otrA).
The most deeply branching class, exemplified by tet and
otrA, is the class obtained from the antibiotic-producing
organisms S. lividans and S. rimosus. Based on
the sequence information available, there is no evidence of recent
horizontal transfer of RPP genes from antibiotic-producing strains to
commensal or pathogenic microbiotas. Hybridization data indicate,
however, that some mycobacteria may actually carry the resistance genes originally described in streptomycetes (30). Additional
sequence information concerning the mycobacterial RPP genes is required to decide whether there was a potential horizontal transfer event from
antibiotic-producing strains. Another interesting aspect of the two
available gene sequences of antibiotic-producing streptomycetes is that
they are quite divergent. The length of the branch between the two
genes is actually comparable to the length of the branch separating the
Tet M, Tet S, and Tet O classes (Fig. 1). If more sequence data from
this class of genes were available, perhaps definition of at least two
new classes would be necessary.
The available sequence data support the scenario that early branching
and lengthy independent diversification of eight (or more) clusters of
RPPs occurred well before the "antibiotic era." While the
functional role of these proteins in antibiotic-producing bacteria is
evident (they provide protection against the synthesized antibiotics),
it is more challenging to explain their presence and function in
bacteria from other ecological niches that have no or limited contact
with the soil microbiota (e.g., the gastrointestinal tract). The long
evolutionary history of RPP genes supports the hypothesis that these
genes might have served some metabolic functions other than providing
antibiotic resistance. Protein synthesis is a vital cell process, and
there should be mechanisms that support proper functioning of the
translation machinery and buffer possible undesirable effects of
low-molecular-weight metabolites of the cell. Thus, the alternative
elongation factors may have been selected in this way in some bacteria
and may have assumed a role in protecting ribosomes against
tetracyclines only recently.
At the same time, the rapid movement of the tetracycline-resistant
elongation factors to taxonomically divergent commensal and pathogenic
bacteria is a very recent evolutionary event on the phylogenetic time
scale and can most probably be attributed to horizontal transfers
within the clusters in the antibiotic era. Some of the genes are
located on plasmids (e.g., pOZ101, pIP811, or pK214) or conjugative
transposons (e.g., Tn916, Tn5251, or
Tn1545), thus facilitating transfer between species and
genus boundaries.
Proof of the monophyletic origin of the RPP genes opened the
possibility of designing primer sets targeting all classes, as well as
class-specific primers. However, it appeared that the early branching
and further independent diversification of the otrA genes,
together with a high G+C content, precluded incorporation of these
genes into the alignment. Also, the number of substitutions per base
pair appeared to be higher in the RPP genes than in other elongation
factors, and therefore, the overall sequence structure is less
conserved. Thus, the overall design of the universal primer pair
involves a substantial level of degeneracy and does not include the
genes from the antibiotic-producing streptomycetes. Primers were
validated in PCR that included crude bacterial biomass and fecal
material, which is notorious for the presence of PCR-inhibiting substances. This fact could be useful for rapid screening for the
presence of the RPP genes in bacteria without a DNA isolation step. The
primers also were designed to amplify short sequences, thus allowing
use in PCR-DGGE analysis. Therefore, such an analysis could be
performed with total DNA preparations of environmental origin, thus
allowing for the first time access to the pool and diversity of RPP
genes in a given ecosystem.
The primers were used to detect the occurrence of RPP genes in the
rumina of cows, in swine feed and feces, and in swine fecal streptococci. The Tet O and Tet W determinants were found in the intestinal contents of both types of animals, while Tet M was confined
to pigs and Tet Q was confined to the rumen. Approximate estimates
suggest that up to 5% of the bacteria in the rumen and swine intestine
may carry the tet(O) gene. Another interesting observation
is that tet(W) and the majority of the tet(O)
genes circulating in the two different animal herds, which had very different antibiotic use regimens, were actually identical. The identity of the tet(W) genes obtained from bovine and ovine
rumen and human intestinal isolates was demonstrated in a recent study (37). Obviously, this finding could be extended to include
yet another animal model (pig) and another gene [tet(O)].
The occurrence of identical tetracycline resistance genes in different
hosts provides additional evidence that there are extensive pools of antibiotic resistance genes that are actively exchanged at least between domestic animals. However, genetic transfer itself is not a
guarantee that the transferred antibiotic resistance gene will be
maintained in another host. The second observation concerning the
persistence of antibiotic resistance in the apparent absence of
antibiotic selective pressure [cattle that have no antibiotic in their
feed but carry intestinal bacteria with tet(O),
tet(Q), and tet(W) and swine feed containing a
diverse group of resistance genes] raises the question of how
resistance persists. The possession of an antibiotic resistance gene by
a bacterium is certainly advantageous in the presence of the
corresponding antibiotic. In the absence of the antibiotic, however,
the cost of carrying of the resistance gene should reduce the bacterial
fitness and the resistant phenotype should be replaced by the sensitive
phenotype. However, a recent reexamination of this topic suggested that
bacteria may have been able to adapt to the burden of resistance with
little or no cost to their fitness (25). In this scenario,
the antibiotic-resistant microbiota would successfully compete with the
sensitive counterpart even in the absence of selection. Such
adaptations would preclude resistant lineages from reverting to
sensitivity and make control of antibiotic resistance even more difficult.
The significant outcome of the sequence analysis of tetracycline
resistance genes in cultivable streptococcal isolates is that the
nucleotide sequences of tet(M) and the majority of
tet(O) genes are identical to those of the corresponding
genes acquired directly from fecal DNA. This is yet another validation
of the in vitro analysis approach and suggests that the pool of
resistance genes, initially discovered in total DNA, could be tracked
to specific bacterial populations in the gut. In our case, S. alactolyticus could be considered one of the main reservoirs of
the tet(M) and tet(O) genes in the swine
intestinal microbiota. Based on RFLP and sequence analyses of 16S rDNA
of S. alactolyticus isolates, this is not a clonal
population but is represented by at least three subpopulations.
Therefore, circulation of identical tet(M) and
tet(O) genes in this genetically diverse group of bacteria suggests that there is horizontal exchange of tetracycline resistance genes rather than coexistence of several tetracycline-resistant clones.
Compared with the rumen and fecal samples, the components of the swine
feed appeared to be contaminated with a more diverse group of RPPs, and
only two classes (Tet T and TetB P) were absent. No attempt to isolate
resistant bacteria was made, but the ubiquitous presence of these
genes, together with the bacterial V3 markers, suggests that the feed
components may have been contaminated by bacteria carrying the
corresponding resistance genes. It is not clear whether these bacteria
were dead or viable; regardless, the feed was genetically contaminated.
The experiments were designed to detect possible cross-contamination of
the swine feed by on-farm dust and fecal material, but it appeared that
the components of swine feed already carried more diverse markers of
tetracycline resistance, including that in the swine gut microbiota.
This suggests that the actual source of antibiotic resistance gene
contamination of swine feed was something else and requires further
independent research. At this time, we hypothesize that at least for
the corn and soybean components the source may have been manure from
farms on which antibiotics were used, which was applied to the land. Whey, a by-product of cheese manufacturing, may contain a residual biomass of tetracycline-resistant lactic acid bacteria and
propionobacteria. However, we have no information concerning the source
of antibiotic resistance gene contamination in other components of the
swine feed, such as the plasma protein and especially the antibiotic preparations, which are supposedly the products of sterile fermentation.
In this study molecular ecology tools were used to study the antibiotic
resistance problem, and the results suggest that this approach has the
potential of uncovering the reservoirs and determining the identities
of antibiotic resistance genes in a variety of ecosystems. This
approach could be easily extended to other classes of antibiotic
resistance genes in order to understand the pathways leading to
acquisition of drug resistance by human- and animal-pathogenic bacteria.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Animal Sciences, University of Illinois, 1207 W. Gregory Drive, Urbana, IL 61801. Phone: (217) 333-8809. Fax: (217) 333-8804. E-mail: aminov{at}uiuc.edu.
 |
REFERENCES |
| 1.
|
Amann, R. I.,
W. Ludwig, and K. H. Schleifer.
1995.
Phylogenetic identification and in situ detection of individual microbial cells without cultivation.
Microbiol. Rev.
59:143-169[Abstract/Free Full Text].
|
| 2.
|
Barbosa, T. M.,
K. P. Scott, and H. J. Flint.
1999.
Evidence for recent intergenic transfer of a new tetracycline resistance gene, tet(W), isolated from Butyrivibrio fibrisolvens, and the occurrence of tet(O), in ruminal bacteria.
Environ. Microbiol.
1:53-64[CrossRef][Medline].
|
| 3.
|
Benson, D. A.,
M. S. Boguski,
D. J. Lipman,
J. Ostell,
B. F. Ouellette,
B. A. Rapp, and D. L. Wheeler.
1999.
GenBank.
Nucleic Acids Res.
27:12-17[Abstract/Free Full Text].
|
| 4.
|
Bergeron, M. G., and M. Quellette.
1995.
Diagnosing bacterial infectious diseases in one hour: an essential upcoming revolution.
Infection
23:69-72[CrossRef][Medline].
|
| 5.
|
Burdett, V.
1986.
Streptococcal tetracycline resistance mediated at the level of protein synthesis.
J. Bacteriol.
165:564-569[Abstract/Free Full Text].
|
| 6.
|
Burdett, V.
1991.
Purification and characterization of Tet(M), a protein that renders ribosomes resistant to tetracycline.
J. Biol. Chem.
266:2872-2877[Abstract/Free Full Text].
|
| 7.
|
Charpentier, E.,
G. Gerbaud, and P. Courvalin.
1993.
Characterization of a new class of tetracycline-resistance gene tet(S) in Listeria monocytogenes BM4210.
Gene
131:27-34[CrossRef][Medline].
|
| 8.
|
Charpentier, E.,
G. Gerbaud, and P. Courvalin.
1994.
Presence of the Listeria tetracycline resistance gene tet(S) in Enterococcus faecalis.
Antimicrob. Agents Chemother.
38:2330-2335[Abstract/Free Full Text].
|
| 9.
|
Clermont, D.,
O. Chesneau,
G. De Cespedes, and T. Horaud.
1997.
New tetracycline resistance determinants coding for ribosomal protection in streptococci and nucleotide sequence of tet(T) isolated from Streptococcus pyogenes A498.
Antimicrob. Agents Chemother.
41:112-116[Abstract].
|
| 10.
|
Dittrich, W., and H. Schrempf.
1992.
The unstable tetracycline resistance gene of Streptomyces lividans 1326 encodes a putative protein with similarities to translational elongation factors and Tet(M) and Tet(O) proteins.
Antimicrob. Agents Chemother.
36:1119-1124[Abstract/Free Full Text].
|
| 11.
|
Felsenstein, J.
1985.
Confidence limits on phylogenies: an approach using the bootstrap.
Evolution
39:783-791[CrossRef].
|
| 12.
|
Felsenstein, J.
1993.
PHYLIP (Phylogeny Inference Package) version 3.53c.
Department of Genetics, University of Washington, Seattle.
|
| 13.
|
Jonecova, Z.,
M. Marekova, and V. Kmei.
1994.
Conjugative transfer of tetracycline resistance in rumen streptococcal strains.
Folia Microbiol.
39:83-86.
|
| 14.
|
Kimura, M.
1980.
A simple model for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences.
J. Mol. Evol.
16:111-120[CrossRef][Medline].
|
| 15.
|
Lane, D. J.
1991.
16S/23S rRNA sequencing, p. 115-175.
In
E. Stackebrandt, and M. Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. John Wiley and Sons, New York, N.Y.
|
| 16.
|
LeBlanc, D. J.,
L. N. Lee,
B. M. Titmas,
C. J. Smith, and F. C. Tenover.
1998.
Nucleotide sequence analysis of tetracycline resistance gene tet(O) from Streptococcus mutans DL5.
J. Bacteriol.
170:3618-3626.
|
| 17.
|
Levy, S. B.,
L. M. McMurry,
V. Burdett,
P. Courvalin,
W. Hillen,
M. C. Roberts, and D. E. Taylor.
1989.
Nomenclature for tetracycline resistance determinants.
Antimicrob. Agents Chemother.
33:1373-1374[Abstract/Free Full Text].
|
| 18.
|
Levy, S. B.
1992.
Active efflux mechanisms for antimicrobial resistance.
Antimicrob. Agents Chemother.
36:695-703[Free Full Text].
|
| 19.
|
Levy, S. B.,
L. M. McMurry,
T. M. Barbosa,
V. Burdett,
P. Courvalin,
W. Hillen,
M. C. Roberts,
J. I. Rood, and D. E. Taylor.
1999.
Nomenclature for new tetracycline resistance determinants.
Antimicrob. Agents Chemother.
43:1523-1524[Abstract/Free Full Text].
|
| 20.
|
Lyras, D., and J. I. Rood.
1996.
Genetic organization and distribution of tetracycline resistance determinants in Clostridium perfringens.
Antimicrob. Agents Chemother.
40:2500-2504[Abstract].
|
| 21.
|
Madden, T. L.,
R. L. Tatusov, and J. Zhang.
1996.
Application of network BLAST server.
Methods Enzymol.
266:131-141[Medline].
|
| 22.
|
Manavathu, E. K.,
K. Hiratsuka, and D. E. Taylor.
1988.
Nucleotide sequence analysis and expression of a tetracycline resistance gene from Campylobacter jejuni.
Gene
62:17-26[CrossRef][Medline].
|
| 23.
|
Manavathu, E. K.,
C. L. Fernandez,
B. S. Cooperman, and D. E. Taylor.
1990.
Molecular studies on the mechanism of tetracycline resistance mediated by Tet(O).
Antimicrob. Agents Chemother.
34:71-77[Abstract/Free Full Text].
|
| 24.
|
Martin, P.,
P. Trieu-Cuot, and P. Courvalin.
1986.
Nucleotide sequence of the Tet M tetracycline resistance determinant of the streptococcal conjugative shuttle transposon Tn1545.
Nucleic Acids Res.
14:7047-7058[Abstract/Free Full Text].
|
| 25.
|
Morris, A.,
J. D. Kellner, and D. E. Low.
1998.
The superbugs: evolution, dissemination and fitness.
Curr. Opin. Microbiol.
1:524-529[CrossRef][Medline].
|
| 26.
|
Muyzer, G.,
E. C. de Waal, and A. G. Uitterlinden.
1993.
Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA.
Appl. Environ. Microbiol.
59:695-700[Abstract/Free Full Text].
|
| 27.
|
Muyzer, G.,
S. Hottentrager,
A. Teske, and C. Wawer.
1996.
Denaturing gradient gel electrophoresis of PCR-amplified 16S rDNA a new molecular approach to analyze the genetic diversity of mixed microbial communities, p. 3.4.4.1-3.4.4.22.
In
A. D. L. Akkermans, J. D. van Elsas, and F. J. de Bruijn (ed.), Molecular microbial ecology manual. Kluwer Academic Publishers, Dordrecht, The Netherlands.
|
| 28.
|
Nikolich, M. P.,
N. B. Shoemaker, and A. A. Salyers.
1992.
A Bacteroides tetracycline resistance gene represents a new class of ribosome protection tetracycline resistance.
Antimicrob. Agents Chemother.
36:1005-1012[Abstract/Free Full Text].
|
| 29.
|
Nikolich, M. P.,
G. Hong,
N. B. Shoemaker, and A. A. Salyers.
1994.
Evidence for the horizontal transfer of tetQ between bacteria that normally colonize humans and bacteria that normally colonize livestock.
Appl. Environ. Microbiol.
60:3255-3260[Abstract/Free Full Text].
|
| 30.
|
Pang, Y.,
B. A. Brown,
V. A. Steingrube,
R. J. Wallace, Jr., and M. C. Roberts.
1994.
Tetracycline resistance determinants in Mycobacterium and Streptomyces species.
Antimicrob. Agents Chemother.
38:1408-1412[Abstract/Free Full Text].
|
| 31.
|
Perreten, V.,
F. Schwarz,
L. Cresta,
M. Boeglin,
G. Dasen, and M. Teuber.
1997.
Antibiotic resistance spread in food.
Nature
389:801-802[Medline].
|
| 32.
|
Roberts, M. C.
1994.
Epidemiology of tetracycline-resistance determinants.
Trends Microbiol.
2:353-357[CrossRef][Medline].
|
| 33.
|
Roberts, M. C.
1996.
Tetracycline resistance determinants: mechanisms of action, regulation of expression, genetic mobility, and distribution.
FEMS Microbiol. Rev.
19:1-24[CrossRef][Medline].
|
| 34.
|
Saitou, N., and M. Nei.
1987.
The neighbor-joining method: a new method for reconstructing phylogenetic trees.
Mol. Biol. Evol.
4:406-425[Abstract].
|
| 35.
|
Sanchez-Pescador, R.,
J. T. Brown,
M. C. Roberts, and M. S. Urdea.
1988.
Homology of the Tet(M) with translational elongation factors: implication for potential modes of tet(M)-conferred tetracycline resistance.
Nucleic Acids Res.
16:1218[Free Full Text].
|
| 36.
|
Schnappinger, D., and W. Hillen.
1996.
Tetracyclines: antibiotic action, uptake, and resistance mechanisms.
Arch. Microbiol.
165:359-369[CrossRef][Medline].
|
| 37.
|
Scott, K. P.,
C. M. Melville,
T. M. Barbosa, and H. J. Flint.
2000.
Occurrence of the new tetracycline resistance gene tet(W) in bacteria from the human gut.
Antimicrob. Agents Chemother.
44:775-777[Abstract/Free Full Text].
|
| 38.
|
Sloan, J.,
L. M. McMurray,
D. Lyras,
S. B. Levy, and J. I. Rood.
1994.
The Clostridium perfringens Tet P determinant comprises two overlapping genes: tetA(P), which mediates active tetracycline efflux, and tetB(P), which is related to the ribosomal protection family of tetracycline-resistance determinants.
Mol. Microbiol.
11:403-415[CrossRef][Medline].
|
| 39.
|
Smith, C. J.,
M. B. Rogers, and M. L. McKee.
1992.
Heterologous gene expression in Bacteroides fragilis.
Plasmid
27:141-154[CrossRef][Medline].
|
| 40.
|
Sougakoff, W.,
B. Papadopoulou,
P. Nordman, and P. Courvalin.
1987.
Nucleotide sequence and distribution of tet(O) gene encoding tetracycline resistance in Campylobacter coli.
FEMS Microbiol. Lett.
44:153-159.
|
| 41.
|
Speer, B. S., and A. A. Salyers.
1989.
Novel aerobic tetracycline resistance gene that chemically modifies tetracycline.
J. Bacteriol.
171:148-153[Abstract/Free Full Text].
|
| 42.
|
Taylor, D. E.,
K. Hiratsuka,
H. Ray, and E. K. Manavathu.
1987.
Characterization and expression of a cloned tetracycline resistance determinant from Campylobacter jejuni plasmid pUA466.
J. Bacteriol.
169:2984-2989[Abstract/Free Full Text].
|
| 43.
|
Taylor, D. E., and A. Chau.
1996.
Tetracycline resistance mediated by ribosomal protection.
Antimicrob. Agents Chemother.
40:1-5[Medline].
|
| 44.
|
Thompson, J. D.,
D. G. Higgins, and T. J. Gibson.
1994.
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice.
Nucleic Acids Res.
22:4673-4680[Abstract/Free Full Text].
|
| 45.
|
Widdowson, C. A.,
K. P. Klugman, and D. Hanslo.
1996.
Identification of the tetracycline resistance gene, tet(O), in Streptococcus pneumoniae.
Antimicrob. Agents Chemother.
40:2891-2893[Abstract].
|
Applied and Environmental Microbiology, January 2001, p. 22-32, Vol. 67, No. 1
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.1.22-32.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
van Hoek, A. H. A. M., Mayrhofer, S., Domig, K. J., Florez, A. B., Ammor, M. S., Mayo, B., Aarts, H. J. M.
(2008). Mosaic Tetracycline Resistance Genes and Their Flanking Regions in Bifidobacterium thermophilum and Lactobacillus johnsonii. Antimicrob. Agents Chemother.
52: 248-252
[Abstract]
[Full Text]
-
Macovei, L., Zurek, L.
(2007). Influx of Enterococci and Associated Antibiotic Resistance and Virulence Genes from Ready-To-Eat Food to the Human Digestive Tract. Appl. Environ. Microbiol.
73: 6740-6747
[Abstract]
[Full Text]
-
Storteboom, H. N., Kim, S.-C., Doesken, K. C., Carlson, K. H., Davis, J. G., Pruden, A.
(2007). Response of Antibiotics and Resistance Genes to High-Intensity and Low-Intensity Manure Management. J. Environ. Qual.
36: 1695-1703
[Abstract]
[Full Text]
-
Koike, S., Krapac, I. G., Oliver, H. D., Yannarell, A. C., Chee-Sanford, J. C., Aminov, R. I., Mackie, R. I.
(2007). Monitoring and Source Tracking of Tetracycline Resistance Genes in Lagoons and Groundwater Adjacent to Swine Production Facilities over a 3-Year Period. Appl. Environ. Microbiol.
73: 4813-4823
[Abstract]
[Full Text]
-
Chen, J., Yu, Z., Michel, F. C. Jr., Wittum, T., Morrison, M.
(2007). Development and Application of Real-Time PCR Assays for Quantification of erm Genes Conferring Resistance to Macrolides-Lincosamides-Streptogramin B in Livestock Manure and Manure Management Systems. Appl. Environ. Microbiol.
73: 4407-4416
[Abstract]
[Full Text]
-
Klare, I., Konstabel, C., Werner, G., Huys, G., Vankerckhoven, V., Kahlmeter, G., Hildebrandt, B., Muller-Bertling, S., Witte, W., Goossens, H.
(2007). Antimicrobial susceptibilities of Lactobacillus, Pediococcus and Lactococcus human isolates and cultures intended for probiotic or nutritional use. J Antimicrob Chemother
59: 900-912
[Abstract]
[Full Text]
-
Hummel, A. S., Hertel, C., Holzapfel, W. H., Franz, C. M. A. P.
(2007). Antibiotic Resistances of Starter and Probiotic Strains of Lactic Acid Bacteria. Appl. Environ. Microbiol.
73: 730-739
[Abstract]
[Full Text]
-
Jindal, A., Kocherginskaya, S., Mehboob, A., Robert, M., Mackie, R. I., Raskin, L., Zilles, J. L.
(2006). Antimicrobial Use and Resistance in Swine Waste Treatment Systems. Appl. Environ. Microbiol.
72: 7813-7820
[Abstract]
[Full Text]
-
Rodriguez, C., Lang, L., Wang, A., Altendorf, K., Garcia, F., Lipski, A.
(2006). Lettuce for Human Consumption Collected in Costa Rica Contains Complex Communities of Culturable Oxytetracycline- and Gentamicin-Resistant Bacteria. Appl. Environ. Microbiol.
72: 5870-5876
[Abstract]
[Full Text]
-
Kazimierczak, K. A., Flint, H. J., Scott, K. P.
(2006). Comparative Analysis of Sequences Flanking tet(W) Resistance Genes in Multiple Species of Gut Bacteria.. Antimicrob. Agents Chemother.
50: 2632-2639
[Abstract]
[Full Text]
-
Masco, L., Van Hoorde, K., De Brandt, E., Swings, J., Huys, G.
(2006). Antimicrobial susceptibility of Bifidobacterium strains from humans, animals and probiotic products. J Antimicrob Chemother
58: 85-94
[Abstract]
[Full Text]
-
Macovei, L., Zurek, L.
(2006). Ecology of antibiotic resistance genes: characterization of enterococci from houseflies collected in food settings.. Appl. Environ. Microbiol.
72: 4028-4035
[Abstract]
[Full Text]
-
Yu, Z., Michel, F. C. Jr, Hansen, G., Wittum, T., Morrison, M.
(2005). Development and Application of Real-Time PCR Assays for Quantification of Genes Encoding Tetracycline Resistance. Appl. Environ. Microbiol.
71: 6926-6933
[Abstract]
[Full Text]
-
Wang, Y., Wang, G.-R., Shoemaker, N. B., Whitehead, T. R., Salyers, A. A.
(2005). Distribution of the ermG Gene among Bacterial Isolates from Porcine Intestinal Contents. Appl. Environ. Microbiol.
71: 4930-4934
[Abstract]
[Full Text]
-
Petsaris, O., Miszczak, F., Gicquel-Bruneau, M., Perrin-Guyomard, A., Humbert, F., Sanders, P., Leclercq, R.
(2005). Combined Antimicrobial Resistance in Enterococcus faecium Isolated from Chickens. Appl. Environ. Microbiol.
71: 2796-2799
[Abstract]
[Full Text]
-
Crawford, S. A., Fiebelkorn, K. R., Patterson, J. E., Jorgensen, J. H.
(2005). International Clone of Neisseria meningitidis Serogroup A with Tetracycline Resistance Due to tet(B). Antimicrob. Agents Chemother.
49: 1198-1200
[Abstract]
[Full Text]
-
Huys, G., D'Haene, K., Van Eldere, J., von Holy, A., Swings, J.
(2005). Molecular Diversity and Characterization of Tetracycline-Resistant Staphylococcus aureus Isolates from a Poultry Processing Plant. Appl. Environ. Microbiol.
71: 574-579
[Abstract]
[Full Text]
-
Smith, M. S., Yang, R. K., Knapp, C. W., Niu, Y., Peak, N., Hanfelt, M. M., Galland, J. C., Graham, D. W.
(2004). Quantification of Tetracycline Resistance Genes in Feedlot Lagoons by Real-Time PCR. Appl. Environ. Microbiol.
70: 7372-7377
[Abstract]
[Full Text]
-
Lancaster, H., Roberts, A. P., Bedi, R., Wilson, M., Mullany, P.
(2004). Characterization of Tn916S, a Tn916-Like Element Containing the Tetracycline Resistance Determinant tet(S). J. Bacteriol.
186: 4395-4398
[Abstract]
[Full Text]
-
Villedieu, A., Diaz-Torres, M. L., Roberts, A. P., Hunt, N., McNab, R., Spratt, D. A., Wilson, M., Mullany, P.
(2004). Genetic Basis of Erythromycin Resistance in Oral Bacteria. Antimicrob. Agents Chemother.
48: 2298-2301
[Abstract]
[Full Text]
-
Melville, C. M., Brunel, R., Flint, H. J., Scott, K. P.
(2004). The Butyrivibrio fibrisolvens tet(W) Gene Is Carried on the Novel Conjugative Transposon TnB1230, Which Contains Duplicated Nitroreductase Coding Sequences. J. Bacteriol.
186: 3656-3659
[Abstract]
[Full Text]
-
Huys, G., D'Haene, K., Collard, J.-M., Swings, J.
(2004). Prevalence and Molecular Characterization of Tetracycline Resistance in Enterococcus Isolates from Food. Appl. Environ. Microbiol.
70: 1555-1562
[Abstract]
[Full Text]
-
Call, D. R., Bakko, M. K., Krug, M. J., Roberts, M. C.
(2003). Identifying Antimicrobial Resistance Genes with DNA Microarrays. Antimicrob. Agents Chemother.
47: 3290-3295
[Abstract]
[F