Previous Article | Next Article 
Applied and Environmental Microbiology, January 2001, p. 65-74, Vol. 67, No. 1
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.1.65-74.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Novel Tellurite-Amended Media and Specific
Chromosomal and Ti Plasmid Probes for Direct Analysis of Soil
Populations of Agrobacterium Biovars 1 and 2
Christophe
Mougel,1,2
Benoit
Cournoyer,1 and
Xavier
Nesme1,2,*
Microbial Ecology, UMR-CNRS
5557,1 and INRA,2
Université Claude Bernard-Lyon I, F-69622 Villeurbanne cedex,
France
Received 22 May 2000/Accepted 16 October 2000
 |
ABSTRACT |
Ecology and biodiversity studies of Agrobacterium spp.
require tools such as selective media and DNA probes. Tellurite was tested as a selective agent and a supplement of previously described media for agrobacteria. The known biodiversity within the genus was
taken into account when the selectivity of
K2TeO3 was analyzed and its potential for
isolating Agrobacterium spp. directly from soil was
evaluated. A K2TeO3 concentration of 60 ppm was
found to favor the growth of agrobacteria and restrict the development of other bacteria. Morphotypic analyses were used to define
agrobacterial colony types, which were readily distinguished from other
colonies. The typical agrobacterial morphotype allowed direct
determination of the densities of agrobacterial populations from
various environments on K2TeO3-amended medium.
The bona fide agrobacterium colonies growing on media amended with
K2TeO3 were confirmed to be
Agrobacterium colonies by using 16S ribosomal DNA (rDNA)
probes. Specific 16S rDNA probes were designed for
Agrobacterium biovar 1 and related species
(Agrobacterium rubi and Agrobacterium fici) and
for Agrobacterium biovar 2. Specific pathogenic probes from
different Ti plasmid regions were used to determine the pathogenic
status of agrobacterial colonies. Various morphotype colonies from bulk
soil suspensions were characterized by colony blot hybridization with
16S rDNA and pathogenic probes. All the Agrobacterium-like
colonies obtained from soil suspensions on amended media were found to
be bona fide agrobacteria. Direct colony counting of agrobacterial
populations could be done. We found 103 to 104
agrobacteria · g of dry soil
1 in a silt loam bulk
soil cultivated with maize. All of the strains isolated were
nonpathogenic bona fide Agrobacterium biovar 1 strains.
 |
INTRODUCTION |
The ecology and biodiversity of
Agrobacterium have been studied mainly by using collections
of isolates from crown gall tumors. However, soil agrobacteria are
usually nonpathogenic, and a better understanding of agrobacteria in
soil habitats is necessary. Media suitable for studying low
concentrations of agrobacteria in soil are still needed in spite of
earlier attempts to produce them (for a review see reference
18). The percentage of cells recovered with some media
depends upon the agrobacterial genotype (15), and such
media should not be used to study the biodiversity of agrobacteria.
Other media, such as those described by Brisbane and Kerr
(6), do not result in significant differences in the percentage of cells recovered and can be used for biodiversity studies.
Most of these media have been developed for isolating Agrobacterium from rich soils or tumors, and they are not
selective enough to inhibit the growth of undesired microorganisms from biotopes containing relatively low concentrations of agrobacteria. Agrobacterium-like colonies selected by visual inspection also require
additional tests to ensure that they are bona fide
Agrobacterium colonies. As a result, agrobacterial density
cannot be determined by direct counting.
Kinkle et al. (14) showed that several
Rhizobium species were resistant to selenite and tellurite.
Incorporation of selenite and tellurite into growth media has allowed
direct isolation of Rhizobium meliloti from soil
(14). The genera Agrobacterium and Rhizobium
are close relatives. Thus, incorporation of selenite, which is present
at a low concentration in the media of Brisbane and Kerr, or tellurite
might improve the selectivity of media used to isolate
Agrobacterium spp. However, such media could be used to
study biodiversity only if the added oxidative metalloids did not
significantly alter recovery of any of the agrobacterial genotypes.
Several bona fide species of the genus Agrobacterium and
some putative new species not completely described yet have been identified by conventional morphological and biochemical analysis and
by DNA-DNA hybridization studies. A relationship has been established
between the classic assignments of agrobacteria in biovars
(12) and the species designations, as follows:
Agrobacterium vitis for biovar 3 (25),
Agrobacterium rhizogenes for biovar 2, and
Agrobacterium radiobacter for biovar 1 (35).
This latter name was contested by Bouzar (3), who proposed
Agrobacterium tumefaciens instead. Notwithstanding this,
exhaustive studies have shown that there are at least nine genomic
species within biovar 1 alone (31). Thus, the general term
biovar 1 as defined by Keane et al. (12) is used in this
paper to designate a cluster of closely related genomic species that
includes, but is not restricted to, A. tumefaciens sensu
Bouzar (3). Two other putative species of
Agrobacterium still remain to be completely described. One putative species includes agrobacteria related to strain NCPPB1650 (13, 35). The other consists of agrobacteria isolated from weeping fig trees (5), which have been named
Agrobacterium fici in the Biolog catalog. The species and
biovar designations have been corroborated by 16S rRNA (rrs)
analysis (5, 35, 41). All bona fide and putative
Agrobacterium species contain specific rrs
sequences. As a result, the rrs gene is now routinely used
to identify the main species or biovars of newly isolated Agrobacterium strains, for instance, restriction fragment
length polymorphism analysis by PCR (24, 30). Specific
oligonucleotide probes based on variable parts of the rrs
gene can thus be designed for rapid, accurate species identification on
colony blots.
Pathogenic agrobacteria also occur in soils (3). As
pathogenicity requires a large plasmid designated the Ti plasmid, some of the regions of this plasmid are routinely targeted by PCR
amplification in order to identify pathogenic strains (29,
30). DNA probes based on the same Ti plasmid regions used in
these PCR screening analyses can also be used to detect Ti plasmids on
colony blots.
Here, we investigated whether media amended with selenite or tellurite
are suitable for both direct counting and isolation of bona fide
agrobacteria from soil. Most of the presently known biodiversity of
Agrobacterium spp. was considered in order to evaluate the
resistance of individual strains to selenite and tellurite and the
effects of the two additives on cell recovery. Chromosome and Ti
plasmid probes were used to establish the agrobacterium and
pathogenicity status of the agrobacterium-like colonies isolated from
soil by using amended or unamended media.
 |
MATERIALS AND METHODS |
Bacterial strains and media.
The strains of
Agrobacterium spp. listed in Table
1 include representatives of all bona
fide species plus representatives of putative new
species and members of heterogeneous biovar 1, as described by Popoff
et al. (31). Most strains used in this study that were
isolated from the same host were confirmed to be genotypically
different by using molecular methods described by Ponsonnet and Nesme
(30), and these strains reflected the wide diversity of
pathogenic populations involved in crown gall outbreaks (4,
29). Pathogenicity was tested by inoculating standard host
plants as previously described (30). Bacteria were grown
at 28°C for 48 h on nonselective MG agar medium and for 5 days
on 1A medium (selective for all biovar 1 strains) and 2E medium
(selective for A. rhizogenes) (6, 12). Strains were also grown overnight in LPG broth (30).
MICs of potassium selenite and potassium tellurite.
The MICs
of tellurite for pure cultures were determined on MG medium, as well as
1A and 2E media (selective for Agrobacterium biovars 1 and
2, respectively). Twofold serial dilutions were prepared with 0.9%
(wt/vol) NaCl, and dilutions were plated onto MG, 1A, and 2E media with
or without K2TeO3. A stock solution (100 µg
ml
1) of K2TeO3 was prepared in
ultrapure water and sterilized by filtration. Each strain was tested
with different concentrations of metal. The experiment was performed by
using three plates per dilution, and the plates were incubated for 7 days.
Soil.
The 10- to 30-cm superficial layer of a standard silt
loam soil from a maize field close to Lyon
(La-Côte-Saint-André, France) was used as a source of soil.
Two soil samples, one collected in May 1998 and the other collected in
July 1998, were sieved through a <2-mm mesh. The soil properties were
as follows: 17% clay, 35.3% loam, 47.7% sand, and 2% organic
matter; pH (water) 7; and water-holding capacity, 25.8 g of
H2O 100 g (dry weight)
1
(32).
Counting the Agrobacterium population in soil.
The microorganisms were extracted from 5-g portions of soil by blending
samples with 50 ml of sterile distilled water for 90 s in a
blender (Waring Commercial, New Hartford, Conn.). The resulting soil
suspensions were serially diluted in sterile distilled water, and 100 -µl aliquots of appropriate dilutions were spread on agar plates.
Three plates were inoculated per dilution.
Total viable heterotrophic bacteria were counted on Trypticase soy agar
(TSA) (Gibco BRL, Rockville, Md.) diluted 1/10. Agrobacteria were
counted on 1A and 2E media with or without 80 µg of
K2TeO3 per ml. Cycloheximide (200 mg · liter
1) was used as an antifungal agent. All counting was
done after incubation for 3 and 5 days at 28°C. Data were expressed
as means and standard errors of the means based on three independent
replicate determinations. Agrobacterium-like colonies were
purified by suspending individual colonies for at least 30 min in
sterile distilled water and then streaking them on LPG agar. The
process was repeated until all colonies appeared to be homogeneous.
Production of 3-ketolactose (2) and production of acid
from erythritol were used to separate the strains into biovars 1 and 2 (11).
DNA probes, PCR, and hybridization conditions.
DNA
oligonucleotide probes were designed by comparing nine 16S rRNA
sequences (from four biovar 1 strains, one strain of
Agrobacterium rubi, one strain isolated from Ficus
benjamina [A. fici], and three biovar 2 strains). The
sequences were compared by using the multiple-alignment ClustalW
algorithm (40). Consensus probes F639rrsAT41
(AAACCCCGAATGTCAAGAGC) and F640rrsAT42
(ATACCCCGAATGTCAAGAGC) were designed to detect the cluster
containing A. tumefaciens, A. rubi, and
Agrobacterium isolated from F. benjamina.
F641rrsAR5 (CCATATCTCTACGGGTAACA) was designed to
detect A. rhizogenes. DNA probes were defined by using OLIGO
software (33), and their specificities for the targets
were confirmed by a BLASTn analysis performed with the GenBank database
(1). The specificities of the DNA probes were tested with
collection strains by using a slot blot technique with 16S rDNA PCR
products obtained with primers FGPS6 and FGPS1509', exactly as
described by Ponsonnet and Nesme (30). The oligonucleotide
probes were synthesized by Eurogentec (Seraing, Belgium). Synthetic DNA
oligonucleotide probes were 3' end labelled by using a DNA tailing kit
(Boehringer Mannheim, Meylan, France) with [
-32P]dATP
(NEN Life Science Products, Boston, Mass.) at a specific activity of
6,000 Ci/mmol according to the manufacturer's recommendations. Unincorporated nucleotides were removed with a Qiaquick column, as
recommended by the manufacturer (Qiagen S.A., Courtaboeuf, France).
The PCR DNA pathogenicity probes consisted of three regions of the Ti
plasmid. These probes were amplified from genomic DNA of strain C58 by
using primers FGPtmr530 and FGPtmr701' (for the tumor morphology root [tmr] probe) and primers
FGPnos1236' and FGPnos975 (for the nopaline
synthase [nos] probe, specific for nopaline pTi20). These
two DNA probes corresponded to genes on transferred DNA T-DNA. The
virulence (inter-vir) DNA probe was obtained with a pair of
primers designed to amplify the virB-virG intergene using
F749 (GCTAGCTTGGAAGATCGCAC) (this study) and
FGPvirG15' by using the sequence of a conserved region of
virB11 in order to amplify the virB-virG
intergene of all of the Ti and Ri plasmids sequenced (data not
shown). Two genomic DNAs were used to amplify this probe: the genomic
DNA of C58 (pTiC58, nopaline type of Ti plasmid) and the genomic DNA of
B6 (pTiB6, octopine type of Ti plasmid). The PCR conditions used were
those described by Nesme et al. (21) and Picard et al.
(27, 28). The PCR DIG probes were obtained by
incorporating digoxigenin-11-dUTP (Roche Diagnostic, Basel,
Switzerland) during PCR. Labelling was performed by using the reaction
conditions recommended by the manufacturer. The specificities of the
probes were tested with a collection of strains.
Colony hybridization.
Pure colonies were transferred
directly onto nylon membranes (GeneScreen Plus; NEN Research Products,
Boston, Mass.). Colonies were lysed as described by Sambrook et al.
(34), with some modifications. The filters were first
wetted with 0.6% (wt/vol) lysozyme in 10 mM Tris-HCl-1 mM EDTA
(dissodium salt dihydrate), (pH 8) for 15 min, and lysis was performed
for 10 min in 10% (wt/vol) sodium dodecyl sulfate (SDS). The
preparations were denatured for 10 min in denaturation solution (0.5 N
NaOH, 1.5 M NaCl) and neutralized for 10 min in neutralizing solution
(1 M Tris [pH 7.5], 1.5 M NaCl). Finally, the nylon membranes were
soaked for 10 min in 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M
sodium citrate, pH 7.0). The transferred DNA was cross-linked by
irradiation with UV light for 3 min, and the membranes were treated
with proteinase K (2 mg ml
1 in 2× SSC) for 1 h
at 37°C. For oligonucleotide hybridization, baked membrane filters
were placed in 50 ml of prehybridization solution (1% [wt/vol] SDS,
10% [wt/vol] dextran sulfate, 2× SSC, 5 µg of denatured
herring sperm DNA per ml, 2 µg of tRNA per ml and incubated for
2 h at the hybridization temperature (47°C). The
prehybridization solution was discarded, and the membranes were
incubated in the hybridization solution (prehybridization solution plus
probe) overnight at the hybridization temperature. The membranes were
washed twice in 2× SSC for 10 min at room temperature, once in
2× SSC-1% SDS for 10 min at the hybridization temperature, twice in 1× SSC-0.1% SDS at the hybridization temperature, and once in 0.1× SSC-0.1% SDS at the hybridization temperature.
They were then exposed to X-ray film for autoradiography for 4 h
to locate individual positive colony signals. Hybridization with PCR
DIG probes was performed by using the reaction conditions recommended
by the manufacturer (Roche Diagnostic).
 |
RESULTS AND DISCUSSION |
Direct counting of agrobacterial populations and studies of the
genetic structure of isolated strains require new selective media that
ensure recovery of sparse populations without producing any significant
differences between agrobacterial genotypes. We investigated the
suitability of selenite and tellurite for this purpose by testing the
responses of strains chosen to obtain the greatest possible
biodiversity of Agrobacterium spp.
Resistance of agrobacteria to Na2SeO3.
As indicated by Lippincott et al. (15), agrobacterial
colonies growing on 1A and 2E media develop an orange-brown to
red-brown pigmentation. This red coloration is produced by all of the
agrobacteria tested and is presumably due to reduction of the added Se
compound to its elemental form. Selenite reduction was thus used to
improve medium selectivity. However, the original concentration of
Na2SeO3 in 1A and 2E media (0.1 g · liter
1) was not high enough to effectively control the
competing microflora when the density of agrobacteria in the soil was
low (less than 10
4 CFU · g of
soil
1). The selenite concentration in the medium could
not be increased because MIC studies have shown that the resistance of
agrobacterial strains to Na2SeO3 varies
considerably (the MICs range from 2 to 14 g · liter
1) (Table 1), while complete control of the
competing microflora requires at least 10 g · liter
1 (data not shown). As reduction of the Se compound
is generally associated with reduction of other metal salts that are
much more toxic, such as K2TeO3
(14), the latter compound was used to improve the
selectivity of the 1A and 2E media used to isolate agrobacteria
directly from soils.
Resistance of agrobacteria to K2TeO3.
Here, we show for the first time that agrobacteria are resistant to
K2TeO3 (Table 1). Agrobacteria growing on
amended media had the typical colony morphology (convex, glistening,
circular with entire edges) but a typical black color (Fig.
1), probably due to intracellular
accumulation of black crystals of metallic tellurium (16,
38). Other members of the alpha subdivision of the
Proteobacteria, such as Rhodobacter spp.
Rhodopseudomonas palustris, Bradyrhizobium spp.,
and Rhizobium spp., were also found to be resistant to
tellurite (19).

View larger version (95K):
[in this window]
[in a new window]
|
FIG. 1.
Plating of a 10 1 dilution suspension of
soil on 1A medium (a) or 1A medium amended with 60 ppm of
K2TeO3 (b). (c) Enlarged (magnification, × 10)
typical black colonies of A. tumefaciens on the amended
medium. Some agrobacterial colonies are indicated by arrows.
|
|
Resistance to tellurite was studied by determining the MICs of
K2TeO3 for 76 strains selected to represent
most of the diversity presently known in the genus
Agrobacterium. Special emphasis was placed on
representatives of biovar 1 and biovar 2 because these agrobacteria are
the organisms most frequently isolated from crown gall tumors in fruit
and forest tree nurseries. The MICs of K2TeO3 varied from 640 to 1,280 µg ml
1 for biovar 2 and from
80 to 320 µg ml
1 for biovar1, A. rubi,
A vitis, and A. fici (Table 1) in all of the
amended media (MG, 1A, and 2E media). Thus, the closely related
organisms A. tumefaciens, A. rubi and A. fici could be selectively isolated by using the same
K2TeO3 concentration with the same medium (1A
medium). Hence, K2TeO3 concentrations of 60 to
80 µg · ml
1 should allow growth of almost all agrobacteria.
We estimated the sampling bias caused by adding tellurite to the medium
by determining the percentage of cells recovered in amended medium to
see if this value depended upon the agrobacterial genotype. The
recoveries of 38 biovar 1 and 2 strains with amended and unamended
media were compared. Two concentrations of
K2TeO3 were tested with 1A medium containing
K2TeO3 (60 and 80 µg · ml
1), and two concentrations were tested with 2E medium
containing K2TeO3 (80 and 160 µg · ml
1). The percentage of cell recovery was determined by
dividing the average number of CFU obtained with amended medium by the number obtained with unamended medium, based on three independent experiments. The average levels of cell recovery were 95% ± 3% (mean ± standard error of the mea and 85% ± 8% for 1A medium
containing 60 and 80 µg of K2TeO3 per ml,
respectively, and 75% ± 16% and 61% ± 12% for 2E medium
containing 80 and 160 µg of K2TeO3 per ml,
respectively. No significant interactions between medium and genotype
and no genotype or medium effects were detected (P > 0.05, as determined by analysis of variance). This suggests that almost all strains of agrobacteria can be isolated by using media amended with these concentrations of K2TeO3
without any significant bias for individual genotypes. The relative
levels of the various agrobacterial genotypes isolated from a given
population should be identical in amended and unamended media. However,
the amended media should facilitate sampling of agrobacteria in heavily
contaminated environments.
There are several determinants of resistance to tellurite, and there is
little or no link among them (39). Nothing is known about
resistance to tellurite in agrobacteria. However, the characteristic garlicky odor of the volatile dimethyl telluride resulting from tellurite reduction by a thiopurine methyltransferase found, for instance, in Pseudomonas syringae pathovar pisi
(8) has never been reported for agrobacteria, suggesting
that the mechanism of resistance is different. However, Summers and
Jacoby (37) showed that resistance to tellurite
(Ter) is plasmid mediated in several bacterial species,
while the tellurite resistance of Rhodobacter sphaeroides is
borne on the chromosome (23). Tellurite resistance is
probably chromosomal in agrobacteria, since the resistance of C58 and
the resistance of its derivatives C58C1 (cured of Ti plasmid pTiC58)
and GMI9023 (cured of both pTiC58 and cryptic plasmid pAtC58) were
identical (Table 1).
Design of chromosomal DNA probes.
Molecular probes were
developed to hybridize colony DNA blots and therefore verify that
Agrobacterium-like colonies growing on selective media were
bona fide agrobacterial colonies. Specific regions of the rrs
(16S rRNA) gene were identified from previously published
sequences and used to define three 20-mer oligonucleotides, F639rrsAT41 and F640rrsAT42 specific for biovar
1, A. rubi, and A. fici, and
F641rrsAR5 specific for biovar 2. When pooled
F639rrsAT41 and F640rrsAT42 were used as
radioactive DNA probes, they hybridized with colony DNA blots of all of
the strains of biovar 1, A. rubi, and A. fici
tested but did not hybridize with the strains of biovar 2 and A. vitis used in this study (Fig. 2 and
Table 1). The 20-mer oligonucleotide F641rrsAR5 hybridized
with colony DNA blots of only A. rhizogenes.

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 2.
16S rDNA slot blot analyses of PCR products of
agrobacterium collection with the biovar 1 cluster DNA probes
F639rrsAT41 and F640rrsAT42 (a) and the biovar 2 DNA probe F641rrsAR5 (b). See Table 1 for a description of
the strains. Biovar 1 DNAs were obtained from strains
CFBP2413T (Spot A1), Ach5 (B1), CFBP1903 (C1), GMI9023
(D1), CFBP1901 (E1), CFBP296 (F1), CFBP354 (G1), CFBP1904 (H1),
CFBP2241 (A2), CFBP2243 (B2), CFPB2407 (C2), CFBP2410 (D2), CFBP2411
(E2), CFBP2414T (F2), CFBP2454 (G2), CFBP2456 (H2),
CFBP2457 (A3), CFBP2458 (B3), CFBP2177 (C3), CFBP2516 (D3), CFBP2518
(E3), S56 (F3), S377 (G3), S4 (H3), ATCC 4720 (A4), CIP28-75 (B4),
CIP43-76 (C4), CIP127-76 (D4), CIP111-78 (E4), NCPPB925 (F4), F/1Zutra
(G4), RV3 (H4), 3/1Zutra (A5), NCPPB1641 (B5), T37 (C5), ICPB TT9 (D5),
6 Mushin (E5), O362 (F5), O363 (G5), A96.11 (H5), A134.2 (A6), A134.3
(B6), A134.6 (C6), B100.11 (D6), M9 (E6), M10 (F6), M15 (G6), M214
(H6), M292 (A7), X88.283 (B7), X88.293 (C7), X88.299 (D7), X88.303
(E7), 85.2 (F7), 85.6 (G7), 85.49 (H7), 85.52 (A8), 85.66 (B8), and
85.104 (C8). A. fici DNA was obtained from strain AF3.44;
(E8). A. rubi DNA was obtained from strain
CFBP999T (G8). Biovar 2 DNAs were obtained from strains
CFBP450 (A9), CFBP1804 (B9), CFBP1905 (C9), CFBP1936 (D9), CFBP1937
(E9), CFBP1961 (F9), CFBP1962 (G9), CFBP2178 (H9),
CFBP2408T (A10), CFBP2417 (B10), CFBP2418 (C10), CFBP2419
(D10), CFBP2519 (E10), CFBP2520 (F10), C104.12 (G10), C104.22 (H10), M3
(A11), M32 (B11), M84 (C11), M111 (D11), M120 (E11), 85.30 (F11),
85.110 (G11), and 85.120 (H11). Biovar 3 DNAs were obtained from
strains CFBP2512 (A12), CFBP2618 (B12), CFBP2620 (C12), CFBP2621 (D12),
and CFBP2622 (E12).
|
|
Design of Ti plasmid probes.
Molecular probes were also
designed to detect wild Agrobacterium strains harboring a Ti
plasmid. Four nonradioactive DNA probes were prepared from PCR products
corresponding to the following conserved regions of Ti plasmids: the
tmr region, two inter-vir regions, and the
nos regions. The results of a hybridization analysis confirmed the predicted specificities of the probes based on the Ti
plasmid contents of control strains. There was no hybridization with
nonpathogenic (i.e., Ti plasmid-free) agrobacteria, whatever probe was
used (Fig. 3 and Table 1), confirming the
results obtained by PCR (data not shown).

View larger version (99K):
[in this window]
[in a new window]
|
FIG. 3.
Pathogenicity status as determined by cell blot analyses
of Agrobacterium spp. (see Materials and Methods). The DNA
probes used were the tmr probe (a), the nos probe
(b), and vir probes obtained with pTiC58 (c) and with pTiB6
(d). The biovar 1 pathogenic strains with the octopine type of Ti
plasmid used were strains CFBP2413T (Spot A1), CFBP2407
(B1), and Ach5 (C1). The biovar 1 pathogenic strains with the nopaline
type of Ti plasmid used were strains CFBP296 (D1), CFBP354 (E1),
CFBP1904 (F1), CFBP2410 (G1), CFBP2177 (H1), CFBP2516 (A2), A134.6
(B2), A134.2 (C2), M15 (D2), B100.11 (E2), M292 (F2), 85.104 (G2),
85.66 (H2), 85.52 (A3), X88.283 (B3), A134.3 (C3), 85.2 (D3), 85.49 (E3), X88.293 (F3), M9 (G3), M10 (H3), 85.6 (A4), X88.299 (B4), M214
(C4), X88.303 (D4), A99.11 (E4), CFBP1903 (D5), CFBP1901 (F5), and
CFBP999T (H5). The biovar 1 pathogenic strains with an
unknown opine type of Ti plasmid used were strains 2T3Pb (F4), 6MS3
(G4), 436.3SA (H4), 1C3Pb (A5), and 2T3Sa (B5). The biovar 1 nonpathogenic strains used were strains CFBP2414 (A6), GMI9023 (B6 and
E5), CFBP2241 (C6), CFBP2243 (D6), CFBP2454 (E6), CFBP2456 (F6),
CFBP2457 (G6), CFBP2458 (H6), and CFBP2518 (A7). The biovar 2 pathogenic strains with the nopaline type of Ti plasmid used were
strains CFBP1804 (C8), CFBP1905 (D8), CFBP1936 (E8), CFBP1961 (F8),
CFBP1962 (G8), CFBP2178 (H8), CFBP2417 (A9), CFBP2418 (B9), 85.186 (C9), C104.12 (D9), C104.22 (E9), 85.110 (F9), 85.30 (G9), 85.123 (H9),
M3 (A10), M32 (B10), M120 (C10), M111 (D10), M84 (E10), 85.120 (F10),
CFBP2419 (A11), and CFBP2519 (B11). The biovar 2 pathogenic strain with
the agropine/mannopine type of Ti plasmid used was strain
CFBP2408T (A8). The biovar 2 pathogenic strain with an
unknown opine type of Ti plasmid used was strain CFBP450 (B8). The
biovar 2 nonpathogenic strains used were strains CFBP1937 (C7 and
G10) and CFBP2520 (D7 and H10). The biovar 3 pathogenic strains with
the nopaline type of Ti plasmid used were strains CFBP2512 (A12) and
CFBP2620 (G12). The biovar 3 pathogenic strains with the
cucumopine/octopine type of Ti plasmid used were strains CFBP2618
(C12), CFBP2622 (D12), and CFBP2621 (G12).
|
|
The tmr probe is 173 bp long and is found in nopaline and
octopine types of Ti plasmids (20). Positive hybridization
signals were obtained with this probe only with DNAs of agrobacteria
known to harbor a Ti plasmid (69 strains) (Table 1), which confirmed the results obtained by PCR and suggested that the tmr
region is a good indicator of the presence of a Ti plasmid (9,
21, 30). However, the tmr probe did not give positive
results with 10 strains described as pathogenic. In three instances
(CFBP296, M15, CFBP450), the strains had probably lost the Ti plasmids, since they were not amplified in the present study although they had
been amplified in previous studies (data not shown). Ti plasmids are
generally stable in agrobacteria, but incubation at a high temperature
can result in loss of these plasmids (10). A lack of
tmr hybridization was expected in two instances because
A. vitis CFBP2621 (= Ag57) and strain CFBP2408 are known to
have no tmr gene (7, 26). Two strains (S56 and
3/1Zutra) showed no DNA hybridization, while PCR products of the
expected size were obtained, suggesting that the tmr
sequences of these strains differ significantly enough to hinder probe
hybridization. The cause of the lack of hybridization with the three
remaining strains (NCPPB1641, NCPPB925, S377) is not well understood,
but these strains belong to rare genomic groups of agrobacteria
(31) and could harbor unusual Ti or Ri plasmids with no or
divergent tmr sequences.
The nos probe corresponds to a region of the T-DNA encoding
nopaline synthase. This probe hybridized with the DNAs of strains harboring a Ti plasmid known to produce tumors containing nopaline. There was no hybridization with strains that did not form nopaline in
tumors. Strain CFBP2618, which uses nopaline but does not synthesize nopaline in tumors, did not hybridize with the nopaline synthetase probe. This probe is thus adequate for identifying the nopaline type of
Ti plasmid.
Two inter-vir probes, one amplified from pTiC58 (nopaline
type of Ti plasmid) and the other amplified from pTiB6 (octopine type
of Ti plasmid), were generated. These two probes hybridized with DNAs
of all typical nopaline and octopine types of Ti plasmids. The
intensities of the hybridization signals varied according to the
similarity to the Ti plasmid and also to the mannopine-agropine type of
Ri plasmid of CFBP2408 (Fig. 3 and Table 1). The octopine cucumopine
type of Ti plasmids hybridized only with the PCR-amplified probe from
pTiC58. The other hybridization patterns were obtained with strains
having an undetermined opine type.
Densities of Agrobacterium spp. populations in bulk
soil and necrosed tumors.
Amended media were tested for the
ability to isolate bona fide agrobacteria from plant tumors. Pathogenic
isolates were recovered from old or necrosed plant material (data not
shown), for which unamended media are inappropriate because of the high
density of competing bacteria (mainly fluorescent Pseudomonas
sp.). The tellurite-amended media were developed under a program
funded by the European Community (Integrated Control of Crown Gall in Mediterranean Countries). Our findings represented such a marked improvement that the other partners in this program rapidly adopted the
method for isolation of agrobacteria from various materials.
The other reservoirs of agrobacteria are the soil and rhizospheres. It
is laborious to determine agrobacterial densities with unamended media,
because delineation of bona fide agrobacteria from
Agrobacterium-like colonies always requires additional tests to determine identities. These tests include biochemical or molecular assays but are generally limited to pathogenicity trials. Consequently, very few data on the ecology of agrobacteria in soils and rhizospheres are available.
The assay described below was designed to check whether amended media
could be used for direct plate counting of soil agrobacteria by visual
inspection alone. Samples of the La-Côte-Saint-André soil
taken at 2-month intervals were used to isolate heterotrophic culturable bacteria (TSA), biovar 1 and related agrobacteria (medium 1A), and biovar 2 agrobacteria (medium 2E), with or without
K2TeO3. The efficacies of the amended media
were tested by directly plating soil suspensions and by verifying the
bona fide Agrobacterium status of the isolates by colony DNA
blot hybridization with chromosomal oligonucleotide probes.
Significantly fewer bacterial colonies were recovered with all
tellurite-amended media. However, this was not true when
Agrobacterium-like colonies alone were considered, at least
with 1A medium since no Agrobacterium-like colonies were detected with 2E medium (Table 2).
Plating soil suspensions on K2TeO3-amended
media also resulted in the typical black color of
Agrobacterium-like colonies together with strong inhibition of the competing microflora, which facilited both visualization and
isolation of Agrobacterium candidates (Fig. 1).
Agrobacterium-like colonies were recovered from 1A medium
(40 isolates) and from 1A medium containing
K2TeO3 (180 isolates). Isolates obtained from
1A medium were characterized by hybridization with 16S ribosomal DNA
(rDNA) probes, and nine of them were shown to be fluorescent
pseudomonads. All 180 isolates obtained from 1A medium containing
K2TeO3 were identified as bona fide
Agrobacterium isolates. The densities of agrobacteria in
bulk soil could thus be determined directly by visual inspection of
plates containing Te-amended medium. The percentages of bona fide
Agrobacterium isolates in Agrobacterium-like
colonies (78% with unamended medium and 100% with amended 1A medium)
were used to estimate the densities of bona fide agrobacteria in bulk
La-Côte-Saint-André soil (Table 2). Analysis of variance
showed that there was no significant effect of added tellurite on
determination of agrobacterial density in soil (Table
3), confirming the usefulness of this
amended medium for direct counting of soil populations of
Agrobacterium.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Variance analysis of the densities of bona fide
Agrobacterium soil isolates in 1A medium amended or not
amended with tellurite on two arbitrary soil sampling
dates
|
|
Ecology of Agrobacterium spp. in the
La-Côte-Saint-André soil.
In this work, we discovered
three significant ecological features about agrobacteria from
La-Côte-Saint-André soil. One was the lack of culturable
agrobacteria when was used 2E medium that was amended or not amended
with K2TeO3 (Table 2). This indicated that the
density of culturable biovar 2 organisms in the bulk La-Côte-Saint-André soil was less than 200 CFU · g
1. However, members of this taxon were present, since 2E
medium containing K2TeO3 allowed direct
counting of many bona fide biovar 2 isolates from the rhizospheres of
plants grown in the same soil (unpublished results). The question of
the predominance of Agrobacterium biovars has been studied
in several instances (17), but the data never applied to
nonpathogenic agrobacteria in bulk soil. The low density of biovar 2 in
the La-Côte-Saint-André bulk soil is an interesting
ecological trait of this taxon and is probably related to a property of
the local La-Côte-Saint-André environment. The density of
biovar 1 agrobacteria reported in the present study, 103 to
104 CFU · g (dry weight) of soil
1, is
similar to the values reported for other soils (22, 36). This value is lower than the 107 agrobacterium-like
colonies per g of soil reported by Bouzar et al. (4) under
favorable conditions. Thus, even if agrobacteria are present in the
sandy loam soil which we studied, environmental factors, especially the
low organic matter content, were probably not optimal for growth of
agrobacteria in the La-Côte-Saint-André bulk soil.
The second important ecological feature was the effect of sampling on
the soil density of biovar 1 (Table 3). This could have been due to a
temporal effect. Temporal variations in soil agrobacteria can occur,
and the amended media used in the present work should facilitate study
of seasonal variations in agrobacterial populations.
The third ecological feature was the lack of a Ti plasmid in any of the
agrobacteria isolated from the bulk soil, as determined by DNA
hybridization with the Ti plasmid probes described above and confirmed
by the lack of tumor formation in Kalanchoe daigremontiana plants (data not shown). Similar results were obtained with rhizosphere agrobacteria from the same soil (unpublished results). The frequency of
Agrobacterium harboring a Ti plasmid in the
La-Côte-Saint-André soil was less than 1/1,300. This agrees
with previous reports showing that the population of tumor-inducing
agrobacteria in natural or cultivated soil is low to undetectable
except in the vicinity of infected plants (22, 36). The
ratio was highest (1/13) in soils in which host plants had been growing
and lowest (1/500) in soils that had never been cultivated or supported
host plants other than dicotyledonous weeds (17). This was
the case for La-Côte-Saint-André soil, which had been
cultivated with maize for many years.
In conclusion, the selectivity and sensitivity of the 1A and 2E media
were increased by taking advantage of the intrinsic resistance of
agrobacteria to tellurite. Agrobacteria could be reliably counted
directly on plates by using media amended with tellurite. Isolation of
agrobacterium strains from soil and characterization of isolates by
using biovar-specific oligonucleotide probes designed by using the 16S
rDNA allowed direct study of natural populations in a bulk soil. The
amended media and the PCR DNA probes for pathogenicity were also used
to determine the density of pathogenic agrobacteria in contaminated
soil. This procedure should be useful for sanitary inspection of soils
before planting.
 |
ACKNOWLEDGMENTS |
We thank M. A. Poirier for technical assistance.
This research was supported by project ERB1C18CT970198 (Intergrated
Control of Crown Gall in Mediterranean Countries) funded by the
European Union INCO-DC Programme to X.N.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: UMR-CNRS
5557 Ecologie Microbienne, Université Claude Bernard Lyon I,
Bât 741, 4ème étage, 43 Bd du 11 Novembre 1918, F-69622 Villeurbanne cedex, France. Phone: 33472448289. Fax:
33472431223. E-mail: nesme{at}bomserv.univ-lyon1.fr.
 |
REFERENCES |
| 1.
|
Altshul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[CrossRef][Medline].
|
| 2.
|
Bernaerts, M. J., and J. De Ley.
1963.
A biochemical test for crown gall bacteria.
Nature (London)
197:406-407.
|
| 3.
|
Bouzar, H.
1994.
Request for a judicial opinion concerning the type species of Agrobacterium.
Int. J. Syst. Bateriol.
44:373-374[Free Full Text].
|
| 4.
|
Bouzar, H.,
D. Ouadah,
Z. Krimi,
J. B. Jones,
M. Trovato,
A. Petit, and Y. Dessaux.
1993.
Correlative association between resident plasmids and the host chromosome in a diverse Agrobacterium soil population.
Appl. Environ. Microbiol.
59:1310-1317[Abstract/Free Full Text].
|
| 5.
|
Bouzar, H.,
W. S. Chilton,
X. Nesme,
Y. Dessaux,
V. Vaudequin,
A. Petit,
J. B. Jones, and N. C. Hodge.
1995.
A new Agrobacterium strain isolated from aerial tumors on Ficus benjamina L.
Appl. Environ. Microbiol.
61:65-73[Abstract].
|
| 6.
|
Brisbane, P. G., and A. Kerr.
1983.
Selective media for the three biovars of Agrobacterium.
J. Appl. Bacteriol.
54:425-431.
|
| 7.
|
Camilleri, C., and L. Jouanin.
1991.
The TR-DNA region carrying the auxin synthesis genes of the Agrobacterium rhizogenes agropine-type plasmid pRiA4: nucleotide sequence analysis and introduction into tobacco plants.
Mol. Plant-Microbe Interact.
4:155-162[Medline].
|
| 8.
|
Cournoyer, B.,
S. Watanabe, and A. Vivian.
1998.
A tellurite-resistance genetic determinant from phytopathogenic pseudomonads encodes a thiopurine methyltransferase: evidence of a widely-conserved family of methyltransferases.
Biochim. Biophys. Acta
1397:161-168[Medline].
|
| 9.
|
Cubero, J.,
M. C. Martinez,
P. Llop, and M. M. Lopez.
1999.
A simple and efficient PCR method for the detection of Agrobacterium tumefaciens in plant tumor.
J. Appl. Microbiol.
86:591-602[CrossRef][Medline].
|
| 10.
|
Hamilton, R. H., and M. Z. Fall.
1971.
The loss of tumor-initiating ability in Agrobacterium tumefaciens by incubation at high temperature.
Experientia
27:229-230[CrossRef][Medline].
|
| 11.
|
Hayward, A. C.
1964.
Characteristics of Pseudomonas solanacearum.
J. Appl. Bacteriol.
27:265-277.
|
| 12.
|
Keane, P. J.,
A. Kerr, and P. B. New.
1970.
Crown gall of stone fruit. II. Identification and nomenclature of Agrobacterium isolates.
Aust. J. Biol. Sci.
23:585-595.
|
| 13.
|
Kersters, K.,
J. De Ley,
P. H. A. Sneath, and M. Sackin.
1973.
Numerical taxonomic analysis of Agrobacterium.
J. Gen. Microbiol.
78:227-239.
|
| 14.
|
Kinkle, B. K.,
M. J. Sadowsky,
K. Johnstone, and W. C. Koskinen.
1994.
Tellurium and selenium resistance in rhizobia and its potential use for direct isolation of Rhizobium meliloti from soil.
Appl. Environ. Microbiol.
60:1674-1677[Abstract/Free Full Text].
|
| 15.
|
Lippincott, J. A.,
B. B. Lippincott, and M. P. Starr.
1983.
The genus Agrobacterium, p. 842-845.
In
M. P. Starr (ed.), The procaryotes: a handbook of habitats, isolation and identification of bacteria. Springer-Verlag, New York, N.Y.
|
| 16.
|
Llyod-Jones, G.,
A. M. Osborn,
D. A. Rithie,
P. Strike,
J. L. Hobman,
N. L. Brown, and A. R. Duncan.
1994.
Accumulation and intracellular fate of tellurite in tellurite-resistant Escherichia coli: a model for the mechanism of resistance.
FEMS Microbiol. Lett.
118:113-120[CrossRef][Medline].
|
| 17.
|
Moore, L. W., and D. A. Cooksey.
1981.
Biology of Agrobacterium tumefaciens: plant interactions, p. 15-42.
In
K. L. Giles, and A. G. Atherly (ed.), Biology of the Rhizobiaceae. Academic Press, Inc., Orlando, Fla.
|
| 18.
|
Moore, L. W.,
C. I. Kado, and H. Bouzar.
1988.
Gram-negative bacteria. A. Agrobacterium, p. 16-36.
In
N. W. Schaad (ed.), Laboratory guide for identification of plant pathogenic bacteria, 2nd ed. The American Phytopathological Society, St. Paul, Minn.
|
| 19.
|
Moore, M. K., and S. Kaplan.
1992.
Identification of intrinsic high-level resistance to rare-earth oxides and oxyanions in members of the class Proteobacteria: characterization of tellurite, selenite, and rhodium sesquioxide reduction in Rhodobacter sphaeroides.
J. Bacteriol.
174:1505-1514[Abstract/Free Full Text].
|
| 20.
|
Nesme, X.,
M. C. Leclerc, and R. Bardin.
1989.
PCR detection of an original endosymbiont: the Ti plasmid of Agrobacterium tumefaciens, p. 47-50.
In
P. Nardon, V. Gianinazzi-Peason, A. M. Greines, L. Margulis, and D. C. Smith (ed.), Endocytobiology IV. Institut National de la Recherche Agronomique, Paris, France.
|
| 21.
|
Nesme, X.,
C. Picard, and P. Simonet.
1995.
Specific DNA sequences for detection of soil bacteria, p. 111-139.
In
J. T. Trevor, and J. D. Van Elsas (ed.), Nucleic acids in the environment. Springer-Verlag, Berlin, Germany.
|
| 22.
|
New, P. B., and A. Kerr.
1972.
Biological control of crown gall: field measurements and glasshouse experiments.
J. Appl. Bacteriol.
35:279-287.
|
| 23.
|
O'Gara, J. P.,
M. Gomelsky, and S. Kaplan.
1997.
Identification and molecular analysis of multiple loci contributing to high-level tellurite resistance in Rhodobacter sphaeroides 2.4.1.
Appl. Environ. Microbiol.
63:4713-4720[Abstract].
|
| 24.
|
Oger, P.,
Y. Dessaux,
A. Petit,
L. Gardan,
C. Manceau,
C. Chomel, and X. Nesme.
1998.
Validity, sensitivity and resolution limit of the PCR-RFLP analysis of the rrs (16S rRNA gene) as a tool to identify soil-borne and plant-associated bacterial populations.
Genet. Sel. Evol.
30:S311-S321.
|
| 25.
|
Ophel, K., and A. Kerr.
1990.
Agrobacterium vitis new species for strains of Agrobacterium biovar 3 from grapevine.
Int. J. Syst. Bacteriol.
40:236-241[Abstract/Free Full Text].
|
| 26.
|
Otten, L.,
J. Canaday,
J. C. Gérard,
P. Fournier,
P. Crouzet, and F. Paulus.
1992.
Evolution of agrobacteria and their Ti plasmids a review.
Mol. Plant-Microbe Interact.
5:279-287[Medline].
|
| 27.
|
Picard, C.,
C. Ponsonnet,
G. Recorbet,
F. Antonelli,
P. Simonet, and X. Nesme.
1994.
Detection of pathogenic Agrobacterium in soils by PCR, p. 729-734.
In
M. Lematrre, S. Freigoun, K. Rudolph, and J. G. Swings (ed.), Plant pathogenic bacteria. Les Colloques, Editions INRA, Paris, France.
|
| 28.
|
Picard, C.,
X. Nesme, and P. Simonet.
1995.
Detection and enumeration of soil bacteria by using the MPN-PCR technique, p. 2.7.3.
:1-9. In A. D. L. Akkermans, J. D. van Elsas, and F. J. de Bruijn (ed.), Molecular microbial ecology. Kluwer Academic Publishers, Dordrecht, Holland.
|
| 29.
|
Pionnat, S.,
H. Keller,
D. Héricher,
A. Bettachini,
Y. Dessaux,
X. Nesme, and C. Poncet.
1999.
Ti plasmids from Agrobacterium characterize rootstock clones that initiated a spread of crown gall disease in Mediterranean countries.
Appl. Environ. Microbiol.
65:4197-4206[Abstract/Free Full Text].
|
| 30.
|
Ponsonnet, C., and X. Nesme.
1994.
Identification of Agrobacterium strains by PCR-RFLP analysis of pTi and chromosomal regions.
Arch. Microbiol.
161:300-309[Medline].
|
| 31.
|
Popoff, M. Y.,
K. Kerster,
M. Kiredjian,
I. Miras, and C. Coynault.
1984.
Position taxonomique de souches de Agrobacterium d'origine hospitalière.
Ann. Microbiol. (Paris)
135:427-442.
|
| 32.
|
Ranjard, L.,
A. Richaume,
L. Jocteur-Monrozier, and S. Nazaret.
1997.
Response of soil bacteria to Hg(II) in relation to soil characteristics and cell location.
FEMS Microbiol. Ecol.
24:312-331.
|
| 33.
|
Rychlik, W., and R. E. Rhoads.
1989.
A computer program for choosing optimal oligonucleotides for filter hybridization, sequencing and in vitro amplification of DNA.
Nucleic Acids Res.
17:8543-8551[Abstract/Free Full Text].
|
| 34.
|
Sambrook, J.,
E. F. Fritsh, and T. E. Maniatis.
1989.
Molecular cloning: a laboratory manual 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 35.
|
Sawada, H.,
H. Ieki,
H. Oyaizu, and S. Matsumoto.
1993.
Proposol for rejection of Agrobacterium tumefaciens and revised descriptions for the genus Agrobacterium and for Agrobacterium radiobacter and Agrobacterium rhizogenes.
Int. J. Syst. Bateriol.
43:694-702[Abstract/Free Full Text].
|
| 36.
|
Schroth, M. N.,
A. R. Weinhold,
A. H. McCain,
D. C. Hildebrand, and N. Ross.
1971.
Biology and control of Agrobacterium tumefaciens.
Hilgardia
40:537-552.
|
| 37.
|
Summers, A. O., and G. A. Jacoby.
1977.
Plasmid-determined resistance to tellurium compounds.
J. Bacteriol.
129:276-281[Abstract/Free Full Text].
|
| 38.
|
Taylor, D. E.,
E. G. Walter,
R. Sherburne, and D. P. Bazett-Jones.
1988.
Structure and location of tellurium deposited in Escherichia coli cells harbouring tellurite resistance plasmids.
J. Ultrastruct. Mol. Struct. Res.
99:18-26[CrossRef][Medline].
|
| 39.
|
Taylor, D. E.
1999.
Bacterial tellurite resistance.
Trends Microbiol.
7:111-115[CrossRef][Medline].
|
| 40.
|
Thompson, J. D.,
D. G. Higgins, and T. J. Gibson.
1994.
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choise.
Nucleic Acids Res.
22:4673-4680[Abstract/Free Full Text].
|
| 41.
|
Yanagi, M., and K. Yamasato.
1993.
Phylogenetic analysis of the family Rhizobiaceae and related bacteria by sequencing of 16S rRNA gene using PCR and DNA sequencer.
FEMS Microbiol. Lett.
107:115-120[CrossRef][Medline].
|
Applied and Environmental Microbiology, January 2001, p. 65-74, Vol. 67, No. 1
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.1.65-74.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Vogel, J., Normand, P., Thioulouse, J., Nesme, X., Grundmann, G. L.
(2003). Relationship between Spatial and Genetic Distance in Agrobacterium spp. in 1 Cubic Centimeter of Soil. Appl. Environ. Microbiol.
69: 1482-1487
[Abstract]
[Full Text]
-
Krimi, Z., Petit, A., Mougel, C., Dessaux, Y., Nesme, X.
(2002). Seasonal Fluctuations and Long-Term Persistence of Pathogenic Populations of Agrobacterium spp. in Soils. Appl. Environ. Microbiol.
68: 3358-3365
[Abstract]
[Full Text]