Previous Article | Next Article 
Applied and Environmental Microbiology, October 2001, p. 4464-4470, Vol. 67, No. 10
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.10.4464-4470.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Insertion or Deletion of the Cheo Box Modifies Radiation
Inducibility of Clostridium Promoters
S.
Nuyts,1,2,*
L.
Van
Mellaert,1
S.
Barbé,1
E.
Lammertyn,1
J.
Theys,1
W.
Landuyt,2
E.
Bosmans,3
P.
Lambin,4 and
J.
Anné1
Laboratory of Bacteriology, Rega Institute, Katholieke
Universiteit Leuven,1 and Laboratory of
Experimental Radiobiology, University Hospital
Gasthuisberg,2 Leuven, and DiaMed
EuroGen, Tessenderlo,3 Belgium, and
Department of Radiation Oncology, RTIL, Academic Hospital
Maastricht, Maastricht, The Netherlands4
Received 18 April 2001/Accepted 8 July 2001
 |
ABSTRACT |
Radiation-inducible promoters are being used in many
viral vector systems to obtain spatial and temporal control of gene
expression. It was previously proven that radiation-induced gene
expression can also be obtained in a bacterial vector system using
anaerobic apathogenic clostridia. The effect of radiation inducibility
was detected using mouse tumor necrosis factor alpha (mTNF-
) as a model protein under regulation of the radiation-inducible
recA promoter. In this report, experiments are described
in which this recA promoter was modified in order to
increase radiation responsiveness. Incorporation of an extra Cheo box
in the recA promoter region resulted in an increase in
mTNF-
secretion from 44% for the wild-type promoter to 412% for
the promoter with an extra Cheo box after a single irradiation dose of
2 Gy. Deletion of the Cheo box in the promoter region eliminated
radiation inducibility. These results prove that the Cheo box in the
recA promoter is indeed the radiation-responsive element. We also tested whether we could induce the constitutive endo-
-1,4-glucanase promoter (eglA) via ionizing
irradiation by introducing a Cheo box in the promoter region. While the
use of the constitutive promoter did not lead to an increase in
mTNF-
secretion after irradiation, the introduction of a Cheo box
resulted in a 242% increase in mTNF-
secretion. Reverse
transcriptase PCR of RNA samples isolated from irradiated and
nonirradiated bacterial cultures demonstrated that the increase in
secretion was the result of enhanced transcription of the mTNF-
gene.
 |
INTRODUCTION |
In the search for new therapeutic
modalities for cancer, gene therapy has attracted enormous interest
over the last few years. Many strategies to apply gene therapy have
been developed, and even more vectors to deliver the gene of interest
have been constructed. However, one of the major pitfalls of gene
therapy is still the lack of specificity of gene delivery. Developing a
good gene therapy protocol involves the use of a tumor-specific vector
system and gene expression limited to the tumor only. This protocol
will result in a high therapeutic index: high local tumor control with low systemic side effects.
Recently, the use of bacteria as a tumor-specific protein
transfer system has attracted interest. Attenuated
Salmonella (18, 19), anaerobic
Bifidobacterium (28), and apathogenic
Clostridium (2, 5, 6) have been shown to
provide selective colonization in tumors. With Clostridium,
no vegetative bacteria were found in normal tissues (5).
Moreover, the use of bacteria as a protein transfer system is very
safe, since treatment can be stopped at any time by addition of the
appropriate antibiotic (21).
Clostridium can be genetically engineered to express
therapeutic proteins such as mouse tumor necrosis factor alpha
(mTNF-
) locally in a tumor (23). However, to obtain
spatial and temporal control of gene expression, we investigated the
use of a radiation-inducible promoter in Clostridium. The
use of such a promoter would ensure that the therapeutic protein would
be expressed only in irradiated tumoral tissues and not in nontumoral
hypoxic tissues, such as abscesses or infarcted tissues. Moreover,
protein expression would occur only after radiotherapy, so that gene
expression would be switched on and physicians would know from what
time on the therapeutic protein would be present (3). With
cytotoxic agents such as TNF-
, this protocol would mean a major advantage.
It has been found that the recA promoter, belonging to the
SOS repair system of bacteria, is induced by radiotherapy at the clinically relevant dose of 2 Gy (13-15). A single dose
of 2 Gy significantly increased mTNF-
secretion by recombinant
clostridia, by 44%. Moreover, gene activation could be repeated with a
second dose of 2 Gy, a result which makes this promoter promising for clinical use, since in patient settings, daily doses of 2 Gy are used
(15). However, with this recA promoter, there
is still basal activity leading to transcription and secretion of
mTNF-
under nonirradiation conditions.
In the present report, we investigated whether the Cheo box in the
recA promoter was responsible for the radiation induction and whether we could increase radiation responsiveness by incorporating an extra Cheo box in the promoter region.
All genes belonging to the SOS repair system are activated by the
presence of DNA damage. In nonactivating conditions, a repressor called
LexA (for gram-negative bacteria) or DinR (for gram-positive bacteria)
binds to a specific operator sequence, called the SOS box or the Cheo
box, respectively. When DNA damage occurs, the central protein, RecA,
forms a complex with single-stranded DNA that stimulates
autoproteolysis of the repressor and thus leads to increased
transcription of the SOS genes (1, 10). These genes play a
role in repairing the original DNA damage.
Our hypothesis was that the addition of a second repressor binding site
in the promoter region of a radiation-inducible gene would decrease
transcription under basal conditions. After radiotherapy, both
binding sites would become free and repression would be absent. In this
report, we describe the cloning of the different recA promoter-operator mutations and present data on mTNF-
secretion by
recombinant Clostridium acetobutylicum DSM792
with and without radiation. We also investigated whether we could use
the Cheo box to make a constitutive promoter radiation inducible.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and culture conditions.
C. acetobutylicum DSM792 was grown in 2×
YT medium (17) at 37°C in an anaerobic system (model
1024; Forma Scientific, Marietta, Ohio) with 90%
N2 and 10% H2 and with
palladium as a catalyst.
For primary vector construction, Escherichia coli
TG1 (20) was used. This strain was grown in Luria-Bertani
broth at 37°C. E. coli ER2275 was used for in
vivo methylation of plasmid DNA prior to the electroporation of
clostridia (8). The E. coli-Clostridium shuttle plasmid pIMP1 was used as a cloning
vector (9).
mTNF-

cDNA was available on plasmid pIG2mTNF (Innogenetics, Ghent,
Belgium). Plasmid pHZ117, containing the
eglA gene of
C. acetobutylicum P262, was a gift from H. Zappe
(
29). The
eglA promoter and signal sequence
were used to express and secrete
mTNF-

. This chimeric gene construct
was present on shuttle plasmid
pIMP1, resulting in
pIMP-
eglA-mTNF-
(
23). The
eglA
promoter
in this plasmid was replaced by the
C. acetobutylicum recA promoter,
resulting in
pIMP-
recA-mTNF-
(
15). Table
1 shows an overview
of the plasmids used
in this study. The
recA promoter was isolated
from
chromosomal DNA as previously described (
14).
Media were supplemented, when applicable, with erythromycin (25 µg/ml) or ampicillin (50 µg/ml).
Mutation of the recA and eglA
promoters, DNA manipulations, and transformation procedures.
Introduction and/or deletion of the Cheo box in the recA and
eglA promoters was done using a Quickchange site-directed
mutagenesis kit (Stratagene). Table 2
shows the sequences of the wild-type and mutated recA and
eglA promoters at the 3' region. All mutations were
introduced in the pIMP1 shuttle vector containing the eglA or recA promoter followed by the eglA-mTNF-
fusion gene (Table 1).
For mutation of the
eglA and
recA promoters,
mutagenic primers containing an extra Cheo box flanked by 10 to 15 bases of the
correct sequence were designed. Similarly, mutagenic
primers with
the desired deletion were developed (the Cheo box is given
in
bold): primers used to incorporate an extra Cheo box in the
recA promoter region

5'
TATATTGACAAAT
GAACAAAT
GTTCATATAATTATATG
3'
and 5'
CATATAATTATAT
GAACATTT
GTTCATTTGTCAATATA
3';
primers used to delete the Cheo box in the
recA promoter
region

5'
TAATTATATGTATA
deletion 12 bpGAGAGAAAGGTTGG 3' and 5'
CCAACCTTTCTCTC
deletion 12 bpTATACATATAATTA
3'; and primers used to introduce a Cheo box in the
eglA promoter
region

5'
TTTAAGGGACTTT
GAACATAT
GTTCTTGACAAATTAAT
3'
and 5'
ATTAATTTGTCAA
GAACATAT
GTTCAAAGTCCCTTAAA
3'.
To verify the insertion or deletion of the Cheo box, the DNA fragments
containing the introduced mutations were subcloned
in pUC19 and the DNA
sequence was determined with an automated
laser fluorescence ALF
Express sequencer (Amersham Pharmacia BioTech).
Primers used for
sequencing were CY5-labeled M13 forward and reverse
primers.
All general DNA manipulations in
E. coli were
carried out as described by Sambrook et al. (
20).
Restriction endonucleases
and DNA-modifying enzymes were purchased from
Roche Diagnostics
(Brussels, Belgium), GIBCO BRL (Gaithersburg, Md.),
and Eurogentec
(Seraing, Belgium) and used as indicated by the
suppliers.
Plasmid DNA was isolated from
E. coli with a
Wizard Plus SV miniprep kit (Promega Inc., Madison, Wis.).
E. coli was transformed using chemically
competent cells obtained with the RbCl method. Transformation of
C. acetobutylicum DSM792 was carried out by
electroporation as recently described
(
11).
Irradiation.
Recombinant bacteria were grown until early log
phase (optical density at 600 nm, ±0.3). At this time, cultures were
divided into two sets, one of which was exposed to radiation while the other was mock irradiated and used as a control. Bacteria were exposed
to 2 Gy with a 60Co unit at a dose rate of 0.9 Gy/min. This dose of 2 Gy was chosen because it is the dose currently
used in most clinical settings. After irradiation at room temperature,
bacteria were incubated anaerobically at 37°C, and samples were taken
at different time intervals after exposure.
Each experiment was independently repeated three
times.
Analysis of mTNF-
secretion.
The amount of mTNF-
secreted by recombinant clostridia was quantified using enzyme-linked
immunosorbent assay (ELISA) kits (DiaMed EuroGen, Tessenderlo,
Belgium). Supernatants taken from irradiated and nonirradiated
cultures were diluted 10-fold in phosphate-buffered saline-7.5%
bovine serum albumin, and 100-µl aliquots were placed in wells of a
96-well microtiter plate in duplicate. Further manipulations were done
according to the manufacturer's protocol.
Concentrations of secreted mTNF-

were calculated and compared for
the irradiated and nonirradiated cultures. The level of
radiation-induced mTNF-

production was expressed as the fold
increase in mTNF-

concentration of irradiated samples compared
with
that of the corresponding nonirradiated
samples.
Student's
t test was used for statistical
analysis.
Immunoblot analysis with polyclonal rabbit anti-mTNF-

antibodies was
carried out by the method of Van Mellaert et al. (
25).
RT-PCR.
To prove that the induction of mTNF-
was the
result of an increase in promoter activity, reverse transcriptase (RT)
PCR (RT-PCR) was performed on RNA isolated from irradiated and
nonirradiated bacterial cultures. One hour after radiotherapy, 4-ml
aliquots of cultures were taken and RNA was extracted using an RNeasy
mini kit from Qiagen (Valencia, Calif.) as previously described
(12). The RNA concentration was determined
spectrophotometrically. To ensure that there was no DNA contamination
which could result in mTNF-
cDNA transcription from the plasmid, 1 µg of RNA was digested with Fnu4HI, which cleaves mTNF-
cDNA at positions 82 and 213, and an additional DNase treatment was
carried out. After heat inactivation of the enzymes, 200 U of Moloney
murine leukemia virus RT (GIBCO BRL) was added to the RNA together with
a mixture containing 0.8 µl of deoxynucleoside triphosphates (5 mM
each), 4 µl of 5× RT buffer, 2 µl of reverse primer (10 pmol/µl), and 2 µl of dithiothreitol (DTT) (0.1 M) in a total
volume of 20 µl. After 1 h of incubation at 37°C, the
resulting cDNAs were amplified using PCR. Five microliters of the RT
mixture was added to a mixture containing 8.5 µl of reverse primer
(10 pmol/µl), 7 µl of forward primer (10 pmol/µl), 2.5 µl of
deoxynucleoside triphosphates (5 mM each), 0.5 U of JumpStart
Taq DNA polymerase (Sigma Chemical Co., St. Louis, Mo.), and
4.5 µl of 10× PCR buffer in a total volume of 50 µl. After
40 PCR cycles (10 min at 95°C, 30 s at 95°C, 2 min at 40°C,
30 s at 72°C, and 5 min at 72°C), 1-µl aliquots were run on
1% agarose gels. Primers used for the amplification of mTNF-
were
as follows: forward primer
5' GTAAGATCAAGTAGTCAA 3'; and
reverse primer
5' CAGAGCAATGACTCCAAA 3'.
To verify the absence of any DNA contamination, all samples underwent
the same RT-PCR procedure without the addition of Moloney
murine
leukemia virus RT. To ensure equal amounts of RNA in all
samples, an
internal fragment of
C. acetobutylicum 16S rRNA
was
amplified using RT-PCR to function as an internal standard. Primers
used for the amplification of 16S rRNA were as follows: forward
primer

5' GGAGCAAACAGGATTAGATACC 3'; and reverse
primer

5' TGCCAACTCTATGGTGTGACG
3'.
 |
RESULTS |
Mutation of the recA and eglA
promoters.
After introduction of the wanted mutations in the
vectors pIMP-eglA-mTNF-
and pIMP-recA-mTNF-
by PCR mutagenesis, mutations were verified by sequence analysis and
restriction digestion. Therefore, a 605-bp fragment containing the
mutated sequence in each plasmid was subcloned in pUC19 digested with
HindII.
Since both
eglA and
recA promoters are functional
in
E. coli, it was possible to test the
activities of the mutated promoters
by determination of the expression
and secretion of mTNF-

. Therefore,
lysates and supernatants were
analyzed by Western blot analyses
using rabbit anti-mTNF-

polyclonal
antibodies and alkaline phosphatase-conjugated
anti-rabbit
antibodies (Sigma). Using both cell lysates and supernatants,
we
could clearly demonstrate the presence of mTNF-

in all
recombinant
bacteria containing the different constructs, proving that
the
mutated promoters were still functional (data not
shown).
After introduction of the recombinant plasmids into
Clostridium by electroporation, the presence of mTNF-

in
supernatants
and lysates was again demonstrated by immunoblotting (data
not
shown).
Analysis of mTNF-
secretion.
ELISA analysis was used to
quantify mTNF-
secretion by recombinant clostridia. Average values
can be summarized as follows. Under basal, nonirradiation conditions,
bacteria containing the pIMP-recA-mTNF-
construct show
basal promoter activity leading to an mTNF-
secretion level of 680 pg/ml. Bacteria containing the construct with an extra Cheo box show a
basal mTNF-
secretion level of 486 pg/ml. When the Cheo box is
deleted, the level of secretion increases to 756 pg/ml. This means that
the addition of a Cheo box leads to a 30% decrease in basal promoter
activity. Besides a decrease in basal activity, we also intended to
increase the response after irradiation. As reported earlier, the
wild-type recA promoter shows a 1.44-fold increase in
mTNF-
secretion after a single dose of 2 Gy (15).
When we deleted the Cheo box from the recA promoter region,
no significant increase in mTNF-
secretion was measured after
irradiation compared with the results obtained for the
control samples (Fig. 1). However,
when we incorporated an extra Cheo box in the recA promoter
region, a 4.12-fold increase (standard deviation [SD], ±1.77) in
mTNF-
secretion was seen 2.5 h after a single dose of 2 Gy
(Fig. 1). At 1.5 h after irradiation, the 2.27-fold increase (SD,
±0.28) in mTNF-
secretion was significant (P < 0.02; Student's t test).

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 1.
Fold increase of mTNF- secretion in C.
acetobutylicum
DSM792(pIMP-recAdeletedCheo-mTNF- ) (gray bars) and
C. acetobutylicum
DSM792(pIMP-recAextraCheo-mTNF- ) (hatched bars) after
a single dose of 2 Gy as a function of time after irradiation. The bars
represent data from three independent experiments. Error bars represent
standard deviations. Induction factors and standard deviations are
shown in the table.
|
|
When we irradiated the recombinant bacteria containing the
pIMP-
eglA-mTNF-
construct, no increase in mTNF-

secretion was
seen, confirming the constitutive properties of the
eglA promoter
(Fig.
2).
However, when a Cheo box was incorporated in the
eglA promoter region, an increase of 2.42-fold (SD, ±0.9) was seen
2.5 h after 2-Gy irradiation (Fig.
2). Again, at 1.5 h after
irradiation,
the 1.93-fold increase (SD, ±0.31) in mTNF-

secretion was significant
(
P < 0.05; Student's
t test).

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 2.
Fold increase of mTNF- secretion in C.
acetobutylicum DSM792(pIMP-eglA-mTNF- )
(gray bars) and C. acetobutylicum
DSM792(pIMP-eglACheo-mTNF- ) (hatched bars)
after a single dose of 2 Gy as a function of time after irradiation.
The bars represent data from three independent experiments. Error bars
represent standard deviations. Induction factors and standard
deviations are shown in the table.
|
|
RT-PCR.
RT-PCR was carried out to prove that the increase in
mTNF-
secretion was the result of an increase in promoter activity. One microliter of the PCR mixture was placed on a gel (Fig.
3). The upper panel in Fig. 3 represents
the 650-bp internal fragment of 16S rRNA which was amplified to ensure
that equal amounts of RNA were used in each PCR. The
lower panel in Fig. 3 represents the 470-bp internal fragment
of mTNF-
which was amplified. Equal amounts of RNA were used in all
reactions (Fig. 3). When mTNF-
was amplified, for the constructs
containing the eglA promoter with a Cheo box introduced
(Fig. 3, first and second lanes), the wild-type recA
promoter (third and fourth lanes), and the recA promoter
with an extra Cheo box (fifth and sixth lanes), the nonirradiated samples showed a weaker band than the irradiated samples, indicating that more mRNA was present in the irradiated samples. For the constitutive eglA promoter (Fig. 3, eighth and ninth lanes)
and the recA promoter with a deletion of the Cheo box (tenth
and eleventh lanes), no difference was seen between the irradiated and
the nonirradiated samples. For the control samples, both the
recA promoter with an extra Cheo box and the eglA
promoter containing a Cheo box showed a weaker band than the
corresponding wild-type promoters. This weaker signal can be attributed
to lower transcription levels because of higher repression levels under
noninducing conditions. The reverse was seen for the recA
promoter with a deletion of the Cheo box: a stronger signal in the
nonirradiated samples for the mutated promoter than for the wild-type
promoter. This stronger signal is the result of the absence of
repression.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 3.
RT-PCR of irradiated and nonirradiated RNAs extracted
from C. acetobutylicum DSM792. The upper
panel represents the amplification of a 650-bp internal fragment of 16S
rRNA which functions as an internal standard to ensure that equal
amounts of RNA were used in each RT reaction. The lower panel
represents the amplification of a 470-bp internal fragment of mTNF- .
RNA extracted from C. acetobutylicum
DSM792 was transformed with
pIMP-eglACheo-mTNF- (first and second
lanes), pIMP-recA-mTNF- (third and
fourth lanes),
pIMP-recAextraCheo-mTNF- (fifth and
sixth lanes), pIMP-eglA-mTNF- (eighth
and ninth lanes), and
pIMP-recAdeletedCheo-mTNF- (tenth and
eleventh lanes). The seventh lane shows a positive control for 16S rRNA
(PCR performed on chromosomal DNA from C.
acetobutylicum).
|
|
The absence of any band in the samples to which no RT was added
confirmed that there was no DNA contamination in any of the
samples
(data not
shown).
 |
DISCUSSION |
When DNA damage occurs, bacteria have at their disposal more than
20 genes to repair the original damage. All these genes belong to the
so-called SOS repair system (10). These genes have in
their promoter region a specific operator sequence, called the Cheo box
for gram-positive bacteria and the SOS box or LexA binding site for
gram-negative bacteria, to which a repressor binds (1, 7).
This repressor is called LexA for gram-negative bacteria and DinR for
gram-positive bacteria. When DNA damage is present, RecA will form a
complex with single-stranded DNA, and this complex will stimulate
autoproteolysis of LexA or DinR, resulting in increased transcription
of the SOS repair genes. Both LexA and DinR bind to their operator
sequence as dimers (4, 27). The consensus sequence for the
Cheo box in gram-positive bacteria is 5'
GAAC-N4-GTTC 3' (1). This
consensus sequence is positioned within promoter regions such that the
regulatory molecule LexA bound at these sites can interfere with the
initiation of transcription by RNA polymerase. Several genes can be
found which have two or more putative Cheo boxes, and for those in
which repressor binding is proven, the distance between the two
boxes is 15 to 16 bp (27).
We investigated whether the Cheo box in the recA promoter of
C. acetobutylicum DSM792 was responsible for
induction after ionizing irradiation. We deleted the Cheo box and found
that there was no increase in mTNF-
secretion after irradiation, in
contrast to the results obtained with the wild-type recA
promoter when radiation induction was present. When we incorporated a
second Cheo box 50 bp upstream of the first, we could increase the
radiation responsiveness of the promoter from a 44% increase in the
secretion of mTNF-
for the wild-type promoter to 412% for the
mutated promoter, in comparison with the results obtained without
irradiation. We chose to insert a second Cheo box 50 bp upstream of the
first to ensure that there was no spherical hindrance between the two dimers. These results thus demonstrate that the Cheo box in the promoter region of recA is indeed the radiation-responsive
element and can be used to increase the response after ionizing
irradiation. The addition of a Cheo box also led to a 30% decrease in
basal promoter activity.
Moreover, we proved that the introduction of a Cheo box in the
constitutive eglA promoter caused the mutated promoter to
respond to ionizing radiation, in contrast to the results obtained with the wild-type eglA promoter. From the literature it is known
that the Cheo box is normally located between bp
42 and bp
106 from the start codon (27). Therefore, we introduced a
Cheo box 71 bp upstream of the ribosome binding site.
RT-PCR demonstrated that the increase in secretion was the result of
increased promoter activity, since higher concentrations of mRNA were
present in the irradiated samples. Increased secretion of therapeutic
proteins such as mTNF-
in Clostridium after irradiation is thus the result of increased activity at the transcriptional level.
RT-PCR also demonstrated that under nonirradiation conditions (resembling basal conditions), the addition of a Cheo box resulted in a
lower level of transcription and the deletion of a Cheo box resulted in
a higher level of transcription after irradiation. These results prove
that the Cheo box functions as a repressor binding site which becomes
free after DNA damage caused by, for example, ionizing irradiation,
leading to removal of repression and increased transcription.
Several publications have shown that the Cheo box or LexA binding site
is responsible for activation of the SOS repair genes after DNA damage
(1). Van der Lelie et al. have demonstrated that the
addition of a second LexA binding site in the E. coli recN promoter increases inducibility after
treatment with genotoxic agents (24).
To our knowledge, this is the first report which proves that the Cheo
box is responsible for increased transcription of the recA
gene after ionizing irradiation in Clostridium and can be used to further increase inducibility. Moreover, that fact that we
could use radiation to induce the strong eglA promoter by
introducing a Cheo box in the promoter region implies that the
secretion of high doses of therapeutic proteins such as TNF-
can be
controlled by ionizing irradiation.
Since the Cheo box is functional in the eglA promoter,
independent of its natural sequence context, it seems possible to use radiation to induce other clostridial promoters which might be even
stronger. We tested only the presence of two Cheo boxes in one
promoter, but the addition of more boxes might even increase inducibility and decrease basal activity further.
Systemic administration of therapeutic proteins such as TNF-
is
limited due to hepatotoxicity and life-threatening hypotension as major
side effects (16). Many groups have been exploring the
means to obtain the selective expression of genes locally in a tumor
(reviewed in reference 26). Limiting the expression of
toxic agents to a tumor cell is extremely important if damage to the
surrounding normal tissues is to be avoided. Anaerobic bacteria
selectively colonize the hypoxic-necrotic areas of a solid tumor which
are absent in healthy normal tissues, and genetically engineered
bacteria secrete therapeutic proteins locally in the tumor (22,
23). The use of a radiation-inducible promoter will ensure that
no protein is secreted in other necrotic tissues outside the tumor and
that secretion will increase after irradiation of the tumor
(3). In this manner, the combination of radiotherapy, one
of the standard treatment modalities in cancer, and
Clostridium as a tumor-specific protein transfer system can
increase concentrations of therapeutic agents locally in the tumor due
to both spatial and temporal control of protein expression. This
combination can result in higher tumor control rates with lower
systemic side effects. One advantage of our system is the potential to
increase the effectiveness of the recA promoter by the
addition of Cheo boxes in order to increase responsiveness to ionizing
irradiation. When, in the future, more potent clostridial promoters are
discovered, the insertion of a Cheo box could make them radiation
responsive, increasing the potential use of Clostridium as a
vector for cancer therapy.
 |
ACKNOWLEDGMENTS |
We acknowledge financial support from Het Fonds voor
Wetenschappelijk Onderzoek-Vlaanderen, Verkennende Internationale
Samenwerking, and Het K.U.Leuven Onderzoeksfonds. S. Nuyts is a
research fellow of I.W.T. (Vlaams Instituut voor de Bevordering van het
Wetenschappelijk-Technologisch Onderzoek in de Industrie).
We thank Raf Berghmans (DiaMed EuroGen) for providing the ELISA kits.
 |
FOOTNOTES |
*
Corresponding author. Mailing address:
Department of Experimental Radiobiology/Bacteriology, Rega
Institute, Minderbroedersstr. 10, 3000 Leuven, Belgium. Phone:
(32-16)-337358. Fax: (32-16)-337340. E-mail:
Sandra.Nuyts{at}rega.kuleuven.ac.be.
 |
REFERENCES |
| 1.
|
Cheo, D. L.,
K. W. Bayles, and R. E. Yasbin.
1991.
Cloning and characterization of DNA damage-inducible promoter regions from Bacillus subtilis.
J. Bacteriol.
173:1696-1703[Abstract/Free Full Text].
|
| 2.
|
Fox, M. E.,
M. J. Lemmon,
M. L. Mauchline,
T. O. Davis,
A. J. Giaccia,
N. P. Minton, and J. M. Brown.
1996.
Anaerobic bacteria as delivery system for cancer gene therapy: in vitro activation of 5-fluorocytosine by genetically engineered clostridia.
Gene Ther.
3:173-178[Medline].
|
| 3.
|
Hallahan, D. E.,
H. J. Mauceri,
L. P. Sueng,
E. J. Dunphy,
J. D. Wayne,
N. D. Hanna,
A. Toledano,
S. Hellman,
D. W. Kufe, and R. R. Weichselbaum.
1995.
Spatial and temporal control of gene therapy using ionizing irradiation.
Nat. Med.
1:786-791[CrossRef][Medline].
|
| 4.
|
Kim, B., and J. W. Little.
1992.
Dimerization of a specific DNA-binding protein on the DNA.
Science
255:203-205[Abstract/Free Full Text].
|
| 5.
|
Lambin, P.,
J. Theys,
W. Landuyt,
P. Rijken,
A. van der Kogel,
E. van der Schueren,
R. Hodgkiss,
J. Fowler,
S. Nuyts, and J. Anné.
1998.
Colonisation of Clostridium in the body is restricted to hypoxic and necrotic areas of tumours.
Anaerobe
4:183-188.
|
| 6.
|
Lemmon, M. J.,
P. van Zijl,
M. E. Fox,
M. L. Mauchline,
A. J. Giaccia,
N. P. Minton, and J. M. Brown.
1997.
Anaerobic bacteria as a gene delivery system that is controlled by the tumor microenvironment.
Gene Ther.
4:791-796[CrossRef][Medline].
|
| 7.
|
Little, J. W.,
D. W. Mount, and C. R. Yanisch-Perron.
1981.
Purified lexA protein is a repressor of the recA and lexA genes.
Proc. Natl. Acad. Sci. USA
78:4199-4203[Abstract/Free Full Text].
|
| 8.
|
Mermelstein, L. D., and E. T. Papoutsakis.
1993.
In vivo methylation in Escherichia coli by the Bacillus subtilis phage phi 3T I methyltransferase to protect plasmids from restriction upon transformation of Clostridium acetobutylicum ATCC 824.
Appl. Environ. Microbiol.
59:1077-1081[Abstract/Free Full Text].
|
| 9.
|
Mermelstein, L. D.,
N. E. Welker,
G. E. Bennett, and E. T. Papoutsakis.
1992.
Expression of cloned homologous fermentative genes in Clostridium acetobutylicum ATCC824.
Bio/Technology
10:190-195[CrossRef][Medline].
|
| 10.
|
Miller, R., and T. Kokjohn.
1990.
General microbiology of recA: environmental and evolutionary significance.
Annu. Rev. Microbiol.
44:365-394[Medline].
|
| 11.
|
Nakotte, S.,
M. Schaffer,
M. Böhringer, and P. Dürre.
1998.
Electroporation of, plasmid isolation from and plasmid conservation in Clostridium acetobutylicum DSM792.
Appl. Microbiol. Biotechnol.
50:564-567[CrossRef][Medline].
|
| 12.
|
Nuyts, S.,
L. Van Mellaert,
P. Lambin, and J. Anné.
2001.
Efficient isolation of total RNA from Clostridium without DNA contamination.
J. Microbiol. Methods
44:235-238[CrossRef][Medline].
|
| 13.
|
Nuyts, S.,
J. Theys,
W. Landuyt,
L. Van Mellaert,
P. Lambin, and J. Anné.
2001.
Increasing specificity of anti-tumor therapy: cytotoxic protein delivery by non-pathogenic clostridia under regulation of radio-induced promoters.
Anticancer Res.
21:857-862[Medline].
|
| 14.
|
Nuyts, S.,
L. Van Mellaert,
J. Theys,
W. Landuyt,
P. Lambin, and J. Anné.
2001.
The use of radio-induced bacterial promoters in anaerobic conditions: a means to control gene expression in Clostridium-mediated therapy for cancer.
Radiat. Res.
155:716-726[CrossRef][Medline].
|
| 15.
|
Nuyts, S.,
L. Van Mellaert,
J. Theys,
W. Landuyt,
E. Bosmans,
J. Anné, and P. Lambin.
2001.
Radio-responsive recA promoter significantly increases TNF production in recombinant clostridia after 2 Gy irradiation.
Gene Ther.
8:1197-1201[CrossRef][Medline].
|
| 16.
|
Old, L. J.
1985.
Tumour necrosis factor.
Science
230:630-636[Free Full Text].
|
| 17.
|
Oultram, J. M.,
Loughlin,
T. J. Swinfield,
J. K. Brehm,
D. E. Thompson, and N. P. Minton.
1988.
Introduction of plasmids into whole cells of Clostridium acetobutylicum by electroporation.
FEMS Microbiol. Lett.
56:83-88[CrossRef].
|
| 18.
|
Pawelek, J. M.,
K. Brooks, and D. Bermudes.
1997.
Tumor-targeted Salmonella as novel anticancer vector.
Cancer Res.
54:4537-4544.
|
| 19.
|
Platt, J.,
S. Sodi,
M. Kelley,
S. Rockwell,
D. Bermudes,
K. B. Low, and J. Pawelek.
2000.
Antitumour effects of genetically engineered Salmonella in combination with radiation.
Eur. J. Cancer
36:2397-2402.
|
| 20.
|
Sambrook, J. E.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 21.
|
Theys, J.,
W. Landuyt,
S. Nuyts,
L. Van Mellart,
E. Bosmans,
A. Rijnders,
W. Van den Bogaert,
A. van Oosterom,
J. Anné, and P. Lambin.
2001.
Improvement of Clostridium tumour targeting vectors evaluated in rat rhabdomyosarcomas.
FEMS Immunol. Med. Microbiol.
30:37-41[CrossRef][Medline].
|
| 22.
| Theys, J., W. Landuyt, S. Nuyts, L. Van Mellaert, P. Lambin, and J. Anné. Specific targeting of cytosine
deaminase to solid tumors by engineered Clostridium
acetobutylicum. Cancer Gene Ther., in press.
|
| 23.
|
Theys, J.,
S. Nuyts,
W. Landuyt,
L. Van Mellaert,
C. Dillen,
M. Böhringer,
P. Dürre,
P. Lambin, and J. Anné.
1999.
Stable Escherichia coli-Clostridium acetobutylicum shuttle vector for secretion of murine tumor necrosis factor alpha.
Appl. Environ. Microbiol.
65:4295-4300[Abstract/Free Full Text].
|
| 24.
|
Van der Lelie, D.,
L. Regniers,
B. Borremans,
A. Provoost, and L. Verschaeve.
1997.
The VITOTOX test, an SOS bioluminescence Salmonella typhimurium test to measure genotoxicity kinetics.
Mutat. Res.
389:279-290[Medline].
|
| 25.
|
Van Mellaert, L.,
C. Dillen,
P. Proost,
E. Sablon,
R. Deleys,
A. Van Broekhoven,
H. Heremans,
J. Van Damme,
H. Eyssen, and J. Anné.
1994.
Efficient secretion of biologically active mouse tumor necrosis factor by Streptomyces lividans.
Gene
150:153-158[CrossRef][Medline].
|
| 26.
|
Vile, R. G.,
S. J. Russell, and N. R. Lemoine.
2000.
Cancer gene therapy: hard lessons and new courses.
Gene Ther.
7:2-8[CrossRef][Medline].
|
| 27.
|
Winterling, K. W.,
D. Chafin,
J. F. Hayes,
J. Sun,
A. S. Levine,
R. E. Yasbin, and R. Woodgate.
1998.
The Bacillus subtilis DinR binding site: redefinition of the consensus sequence.
J. Bacteriol.
180:2201-2211[Abstract/Free Full Text].
|
| 28.
|
Yazawa, K.,
M. Fujimori,
J. Amano,
Y. Kano, and S. Tanuguchi.
2000.
Bifidobacterium longum as a delivery system for cancer gene therapy: selective localization and growth in hypoxic tumors.
Cancer Gene Ther.
7:269-274[CrossRef][Medline].
|
| 29.
|
Zappe, H.,
W. A. Jones,
D. T. Jones, and D. R. Woods.
1988.
Structure of an endo- -1,4-glucanase gene from Clostridium actebutylicum P262 showing homology with endoglucanase genes from Bacillus spp.
Appl. Environ. Microbiol.
54:1289-1292[Abstract/Free Full Text].
|
Applied and Environmental Microbiology, October 2001, p. 4464-4470, Vol. 67, No. 10
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.10.4464-4470.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.