Previous Article | Next Article 
Applied and Environmental Microbiology, November 2001, p. 5122-5126, Vol. 67, No. 11
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.11.5122-5126.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Characterization of the Reduction of Selenate and
Tellurite by Nitrate Reductases
Monique
Sabaty,1,*
Cécile
Avazeri,1
David
Pignol,1,2 and
André
Vermeglio1
CEA/Cadarache, DSV, DEVM, Laboratoire de
Bioénergétique Cellulaire, 13108 St. Paul lez Durance
Cedex,1 and Laboratoire de
Cristallographie et Cristallogénèse des Protéines,
Institut de Biologie Structurale JP Ebel CEA-CNRS, 38027 Grenoble Cedex
1,2 France
Received 29 March 2001/Accepted 9 August 2001
 |
ABSTRACT |
Preliminary studies showed that the periplasmic nitrate reductase
(Nap) of Rhodobacter sphaeroides and the membrane-bound nitrate reductases of Escherichia coli are able to reduce
selenate and tellurite in vitro with benzyl viologen as an electron
donor. In the present study, we found that this is a general feature of
denitrifiers. Both the periplasmic and membrane-bound nitrate reductases of Ralstonia eutropha, Paracoccus denitrificans,
and Paracoccus pantotrophus can utilize potassium selenate
and potassium tellurite as electron acceptors. In order to characterize
these reactions, the periplasmic nitrate reductase of R. sphaeroides f. sp. denitrificans IL106 was histidine
tagged and purified. The Vmax and
Km were determined for nitrate, tellurite, and
selenate. For nitrate, values of 39 µmol · min
1 · mg
1 and 0.12 mM were obtained
for Vmax and Km,
respectively, whereas the Vmax values for
tellurite and selenate were 40- and 140-fold lower, respectively. These
low activities can explain the observation that depletion of the
nitrate reductase in R. sphaeroides does not modify the MIC
of tellurite for this organism.
 |
INTRODUCTION |
Selenium is part of the amino
acid selenocysteine present in numerous enzymes and is essential to all
living cells (42). Furthermore, selenium can help prevent
cancer and other diseases (11). However, at high
concentrations this compound, predominantly in the form of selenate and
selenite oxyanions, is toxic and can cause some environmental problems;
for example, in the San Joaquin Valley in central California, bird
malformations due to selenium have been reported
(28). Tellurium is not an essential element and is
relatively rare in the environment, but it can be found at high
concentrations near waste discharge sites. It is also extremely toxic,
and the MIC for Escherichia coli is approximately 2 µg of
potassium tellurite per ml (3). Nevertheless, some gram-negative organisms are resistant to potassium tellurite
(24). Different explanations for resistance have been
proposed; these include exclusion, increased efflux, and reduction to
the less toxic metallic form. Several genetic determinants have been
shown to confer tellurite resistance (15, 27, 44, 45, 48, 50). Although physiological functions can be attributed to some of these determinants (for example, tpm and tehB,
which exhibit homology with methyl transferases [1, 8,
19] and arsRDABC, which encodes an oxyanion efflux
transporter [45]), most of them exhibit no similarity to
each other or to the locus encoding any enzyme whose function is known.
Therefore, the mechanisms which allow these loci to confer resistance
remain largely unknown (46). When reduction occurs,
intracellular deposition of tellurium can be observed, and bacteria
form black colonies (20, 24). Resistance to selenium
oxides is also partially attributed to reduction and accumulation of
the red amorphous Se0 form in the cell (12,
14; M. Bébien, J.-P. Chauvin, J.-M. Adriano, S. Grosse,
and A. Verméglio, submitted for publication). For instance, the
photosynthetic bacterium Rhodobacter sphaeroides accumulates
tellurium and selenium after reduction of tellurite and selenite salts
(25; Bébien et al., submitted). It is, however, unable to significantly reduce selenate to the metallic form
(47; Bébien et al., submitted). For some species,
like Thauera selenatis, Sulfurospirillum barnesii,
Bacillus selenitireducens, or Bacillus arsenicoselenatis (21, 30, 43), the reduction of
selenate involves a respiratory pathway, generating a proton motive
force. In T. selenatis, a specific selenate reductase
(37) has been purified. This enzyme does not reduce
nitrate, nitrite, chlorate, or sulfate.
Reduction of selenium and tellurium oxides has often been associated
with denitrification. The association of denitrification enzymes with
reduction of selenate is based on the observation that nitrate
reduction and selenate reduction in situ have similar profiles as a
function of the depth of the sediment (29). Moreover, in
T. selenatis, selenite reduction is due to the nitrite
reductase (11), and in E. coli, mutants
with mutations that affect nitrate reductase synthesis show a
marked hypersensitivity to tellurite (3). Two classes of
respiratory nitrate reductases have been identified: membrane-bound
enzymes and periplasmic enzymes (6). The occurrence of a
membrane-bound nitrate reductase has been shown and studied in detail
in a large number of denitrifiers (51). This enzyme, which
is synthesized under anaerobic conditions, is composed of three
subunits: a 112- to 140-kDa catalytic
subunit (NarG) with a
molybdopterin cofactor, a soluble 52- to 64-kDa
subunit (NarH) with
one [3Fe-4S] and three [4Fe-4S] centers, and a 19- to 25-kDa
membrane diheme b quinol-oxidizing
subunit (NarI). A
periplasmic nitrate reductase was isolated and first described in
photosynthetic bacteria (36). This enzyme has also been
found in many denitrifiers (5, 39, 40). In R. sphaeroides f. sp. denitrificans, the periplasmic
nitrate reductase consists of a 91-kDa molybdenum-containing catalytic
subunit (NapA) and a 17-kDa diheme cytochrome c (NapB). This
enzyme, which so far has been only partially purified
(35), is responsible for the first reduction step during
the denitrification process (18, 34). Previous studies
have shown that this enzyme and the membrane-bound E. coli
nitrate reductases are able to reduce tellurite and selenate in vitro
(3, 33).
In the present study, we found that this is a general feature and that
nitrate reductases of other denitrifiers are also able to reduce
selenate and tellurite. In addition, purification of the periplasmic
nitrate reductase of R. sphaeroides f. sp.
denitrificans IL106 after histidine tagging allowed us to
characterize this activity and to determine the
Vmax and Km for each substrate.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and growth conditions.
R.
sphaeroides f. sp. denitrificans IL106,
Paracoccus denitrificans DSM 65, Paracoccus
pantotrophus DSM 2944, and Ralstonia eutropha DSM 428 were grown at 30°C in Sistrom minimal medium supplemented with
succinate as the carbon source (7) under anaerobic or
aerobic conditions (100 ml of culture in 250-ml Erlenmeyer flask, 275 rpm). When necessary, the medium was supplemented with 40 mM
KNO3. E. coli strains were grown at 37°C in
Luria-Bertani medium. When appropriate, tetracycline, spectinomycin,
and streptomycin were added at concentrations of 1, 50, and 50 µg · ml
1, respectively, for R. sphaeroides and at concentrations of 20, 50, and 50 µg · ml
1 for E. coli.
MIC.
The MIC was defined as the lowest concentration of
inhibitor that prevented growth of R. sphaeroides at 30°C
on agar plates. Once autoclaved, Sistrom agar was cooled to 50°C, and
K2TeO3 or Na2SeO4 was
added to each flask from a stock solution. The plates were incubated
under dark aerobic conditions or under phototrophic conditions (75 mol
of photons · m
2 · s
1) in
anaerobic jars (GENanaer; BioMérieux).
Preparation of cell extracts and electrophoresis.
Cells were
resuspended in 50 mM Tris-HCl (pH 8) and disrupted with a French press
at 7 MPa. The crude extract was centrifuged at 10,000 × g for 10 min at 4°C to remove unbroken cells, and then the
supernatant was centrifuged at 200,000 × g for
1.5 h at 4°C. The supernatant (soluble fraction) was removed,
and the pellet (membrane fraction) was resuspended in the same buffer. Triton X-100 (0.1%) was added to the samples, and proteins were separated on nondenaturing polyacrylamide gels (7.5% acrylamide, 0.1%
Triton X-100). The running buffer contained 25 mM Tris-HCl, 192 mM
glycine, and 0.02% Triton X-100 (pH 8.3).
Activity staining was done in 50 mM Tris-HCl (pH 8) containing 2 mM methyl viologen for nitrate reductase activity and in 50 mM Tris-HCl
(pH 9.1) containing 2 mM benzyl viologen for tellurite and
selenate reduction. The viologen dyes were reduced with sodium dithionite before 40 mM KNO3,
K2TeO3, or
Na2SeO4 was added.
Addition of a histidine tag to Nap.
A six-histidine tag
sequence was introduced at the C terminus of NapB. To do this, we
amplified a 3.2-kb fragment with primers M13rev (
48) (Stratagene) and
NB6H (5'AAGGTACCTCAGTGAT GGTGATGGTGGTGTTCCGCCTCGTTGCTGGCCGG3') by
using pMS538, a pRK415 derivative containing napABC
(34), as the template. The PCR product was cloned into
pGEMT Easy (Promega). The resulting plasmid was then digested with
EcoRI to obtain a 1.3-kb fragment (containing the terminal
796 bp of napA and napB modified). This fragment
was used to replace the 2.8-kb EcoRI fragment of pMS538. The
resulting plasmid, pMS611, contained napAB genes carrying a
His tag sequence fused to the end of the napB coding frame.
These genes are under the control of lac and tet promoters of pRK415 (34). To increase the levels of
transcription of these genes in R. sphaeroides, we
introduced the stronger promoter of the R. sphaeroides puc
operon upstream of napA. To do this, the 0.7-kb
PstI-XbaI fragment of pPS400 (32),
containing the puc promoter, was cloned into pMS611 digested
with PstI and XbaI. The resulting plasmid
(pMS617) was moved from E. coli to R. sphaeroides nap mutant MS523 (34) by standard procedures
(9).
Purification of the His-tagged periplasmic nitrate
reductase.
Five 1-liter cultures of nap mutant
MS523 containing pMS617 in trans were grown semiaerobically
(1-liter culture in a 2-liter Erlenmeyer flask, 150 rpm) until the end
of the exponential phase. A periplasmic extract was prepared as
previously described (31), concentrated, and diluted
several times with 20 mM phosphate buffer (pH 8)-250 mM NaCl in order
to change the final buffer. The resulting extract was loaded on a
column containing 2 ml of Ni-NTA agarose resin (Qiagen). The
column was washed (0.5 ml/min) with the same buffer and then with 20 mM
phosphate buffer (pH 8)-250 mM NaCl-15 mM imidazole to remove
nonspecifically bound contaminants. The nitrate reductase was finally
eluted with 20 mM phosphate buffer (pH 8)-250 mM NaCl-100 mM imidazole.
Enzyme assay.
Nitrate, tellurite, and selenate reductase
activities were spectrophotometrically assayed at 600 nm and 30°C by
using reduced benzyl viologen as the electron donor
(
600nm = 14.8 M
1 · cm
1). Each reaction mixture (4 ml) contained 50 mM
Tris-HCl (pH 7) and 0.5 mM benzyl viologen. The anaerobic cuvette was
degassed and sparged with argon prior to addition of 10 µl of freshly
prepared 60 mM Na2S2O4 to reduce
the benzyl viologen. Even under these conditions trace oxygen
contamination caused slow oxidation of the viologen dye. To eliminate
participation of oxygen, at the beginning of each assay a volume of
buffer was injected into the cuvette and the initial rate of oxidation
was measured. The value obtained was subtracted from the value obtained
after injection of the enzyme in the presence of the substrate. For
each assay, 2.3, 70, and 120 µg of purified enzyme were used to
measure nitrate, tellurite, and selenate reduction activities, respectively.
 |
RESULTS AND DISCUSSION |
Reduction of tellurite and selenate by periplasmic and
membrane-bound nitrate reductases of several species.
Despite the
increased number of studies on the resistance of microorganisms to
selenium and tellurium oxides, the precise mechanisms of resistance and
reduction remain elusive. We tried to find specific reductases for
these compounds in R. sphaeroides. Tellurite reduction,
selenite reduction, and selenate reduction with methyl viologen as the
electron donor were assayed on nondenaturing gels. For tellurite
reduction and selenate reduction, only one band of activity was
detected; this band had an Rf identical to that
of the periplasmic nitrate reductase (2). In E. coli, it has been shown that the membrane-bound nitrate reductases
NR A and NR Z are also able to reduce these oxyanions (2,
3). In order to determine if this is a general feature, we
tested the capacities of nitrate reductases from several denitrifiers to reduce tellurite and selenate. Soluble and membrane extracts were
loaded on nondenaturing electrophoresis gels. For soluble extracts,
cells were grown under aerobic conditions. Under these conditions,
R. sphaeroides IL106, P. denitrificans, and
P. pantotrophus express a periplasmic nitrate reductase
(Nap) (4, 31, 38, 49). As shown in Fig.
1 (lanes A), these enzymes did not
migrate with the same Rf under nondenaturing
conditions. The main difference was observed with R. eutropha Nap, which remained in the stacking gel under our
electrophoresis conditions (data not shown). For each species, the
enzyme responsible for tellurite reduction (lanes B) and selenate
reduction (lanes C) migrated with the same Rf as
Nap. In mutant MS523 of R. sphaeroides, which does not
synthesize Nap, neither tellurite nor selenate reductase activity was
observed.

View larger version (87K):
[in this window]
[in a new window]
|
FIG. 1.
Nondenaturing electrophoresis of soluble extracts and
membranes of R. sphaeroides f. sp. denitrificans
wild type and nap mutant MS523, P. denitrificans,
P. pantotrophus, and R. eutropha. Gels were
stained for nitrate reductase (lanes A), tellurite reductase (lanes B),
or selenate reductase (lanes C) activity with dithionite-reduced methyl
viologen or benzyl viologen.
|
|
The capacities of membrane-bound nitrate reductases (Nar) to reduce
tellurite and selenate were also tested. To do this, cells
were grown
under anaerobic conditions in the presence of nitrate.
As observed
previously for
E. coli (
3), the enzyme
responsible
for reduction of tellurite (lanes B) and selenate (lanes C)
had
the same
Rf as the nitrate reductase
activity (lanes A) in
P. denitrificans,
P. pantotrophus, and
R. eutropha. This shows that
the
ability of the periplasmic and membrane-bound nitrate reductases
to
reduce tellurite and selenate is a general feature of different
denitrifying species. The capacity of membrane-bound nitrate reductases
to reduce various substrates, such as bromate and chlorate, is
a
well-known phenomenon (
13,
26). However, periplasmic
nitrate
reductases are not able to reduce these two compounds and until
now seemed to be specific for nitrate (
5,
22). The
capacity
of nitrate reductases to reduce such different substrates is
quite
surprising since the substrates have different conformations;
nitrate is planar, while chlorate and selenate are tetrahedral
and
tellurite is
trigonal.
We recently obtained NapAB crystals from
R. sphaeroides.
Cocrystallization of the enzyme with the different substrates is
also
in progress. The resulting crystallographic structures should
provide a
precise image of the binding of the different substrates
at the active
site.
Purification of the His-tagged nitrate reductase.
The capacity
of nitrate reductase to reduce selenate and tellurite has been observed
previously only with cell extracts. Thus, it was interesting to test
this property with a purified enzyme. Periplasmic nitrate reductases of
several species have been purified previously (5, 22, 40).
However, the purification procedure required three or four different
chromatrographic steps, and there was loss of activity at each step. In
R. sphaeroides IL106, Nap has a high specific activity, but
a small amount is synthesized (31). We therefore decided
to add a six-histidine tag to the cytochrome subunit NapB to facilitate
purification of the enzyme by immobilized-metal affinity
chromatography. Plasmid pMS538 containing napABC
(34) was modified by adding six codons for histidine to
the 3' end of napB (see Materials and Methods), resulting in plasmid pMS611. This plasmid was introduced into nap mutant
MS523 so that only the tagged enzyme (NapAB-6His) would be synthesized. To increase the level of synthesis, we cloned the puc
promotor upstream of napA in pMS611 (the puc
operon encodes the LHIII light harvesting proteins). With the resulting
plasmid (pMS617), the level of expression of NapAB-6His was 10-fold
higher than the level of expression with pMS611. Different growth
conditions were tested to obtain the largest amount of synthesized Nap.
A better yield was obtained under dark semiaerobic conditions than
under phototrophic conditions. This is quite surprising since
puc operon expression is greater under phototrophic
conditions (17). Expression of the enzyme was maximal at
the end of the exponential phase. A periplasmic extract was prepared
and loaded onto an Ni-NTA agarose column (see Materials and Methods).
From 5 liters of culture, around 5 mg of purified protein with a
specific activity of 30 µmol of nitrate reduced · min
1 · mg
1 was obtained. The purity
of the enzyme was tested by gel electrophoresis (Fig.
2). Analysis of the purified enzyme
preparation by using a sodium dodecyl sulfate-polyacrylamide gel
electrophoresis gel stained with silver (Fig. 2A) revealed only two
bands; these bands had apparent molecular weights of 91,000 and 17,000, which corresponded to the molecular weights of the NapA and NapB
subunits, respectively. As observed previously for nitrate reductases
from other species (5), NapB does not stain with Coomassie
blue and stains very weakly with silver. Nondenaturing gels loaded with
purified enzyme were stained for tellurite and selenate reductase
activity (Fig. 2B). The results obtained with the soluble cell extract
were confirmed with the purified enzyme. This implies that Nap does not
require the presence of a possible product present in the cell extract that could comigrate on a nondenaturing gel. However, the amount of enzyme necessary to see significant tellurite or selenate
reductase activity on the gel was greater than the amount
necessary for nitrate. This suggests that the affinity for the
substrate and/or the rate of reduction of the enzyme was higher for
nitrate than for tellurite or selenate. We therefore determined the
Vmax and Km values of Nap
for each substrate.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Silver-stained sodium dodecyl sulfate-polyacrylamide
gel. Lane 1, periplasmic extract of R. sphaeroides (8 µg
of protein); lane 2, His-tagged purified Nap (0.5 µg of protein). MW,
molecular weight. (B) Nondenaturing electrophoresis of His-tagged
purified Nap. Gels were stained for reductase activity with
dithionite-reduced methyl viologen. Lane 1, nitrate reductase activity
(1 µg of protein); lane 2, tellurite reductase activity (25 µg of
protein); lane 3, selenate reductase activity (25 µg of protein);
lane 4, gel stained with Coomassie brillant blue (5 µg of protein).
|
|
Determination of Km and
Vmax values for reduction of tellurite and
selenate by Nap.
The reduction activities were measured
spectrophotometrically in an anaerobic cuvette by measuring the
oxidation of benzyl viologen. In order to obtain significant
activities, 2, 70, and 120 µg of purified enzyme (4.7 mg · ml
1) were used for nitrate reduction, tellurite
reduction, and selenate reduction, respectively. From Lineweaver-Burk
plots (Fig. 3) the Vmax and Km values were
calculated for each substrate. The Km for
nitrate was 0.12 mM, and the Vmax was 39 µmol · min
1 · mg of
protein
1. These values are very similar to the values
obtained for P. pantatrophus or R. eutropha
(5, 40), which is consistent with the high level of
sequence homology between the Nap enzymes. For selenate reduction, the
Km and Vmax values were
0.27 mM and 0.27 µmol · min
1 · mg
1, respectively. These values can be compared only to
the values obtained for the only selenate reductase purified so far,
the selenate reductase of T. selenatis, which has
Km and Vmax values of
0.016 mM and 40 µmol · min
1 · mg
1, respectively (37). The large difference
between the selenate reductase and Nap specific activities shows that
Nap is not an efficient selenate reductase; both the affinity of the
enzyme for the substrate and the substrate turnover rate are
extremely low compared to those of the T. selenatis enzyme.
The Nap affinity for tellurite is also very low, with a
Km value of 0.6 mM. The catalytic efficiency
(Vmax/Km) of Nap, which
takes into account the affinity and the turnover rate of the enzyme, is
200 times lower for tellurite and 300 times lower for selenate than for nitrate.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Lineweaver-Burk plots: kinetics of reduction of nitrate,
tellurite, and selenate by purified Nap when methyl viologen is the
electron donor. Vmax is expressed in micromoles
of substrate reduced per minute per milligram of enzyme. The
correlation coefficients for the nitrate, tellurite, and selenate plots
are 0.92, 0.88, and 0.88, respectively.
|
|
The very low selenate reductase activity of Nap in vitro could explain
the finding that in
R. sphaeroides, even when a significant
amount of Nap is synthesized, the selenate is not reduced to elemental
selenium, while selenite is reduced (
47; Bébien et
al., submitted).
Also, the reduction of tellurite by the bacterium is
not due to
the Nap reductase alone since an
R. sphaeroides
nap mutant (MS523)
is still able to reduce tellurite (data not
shown). To determine
the possible role of Nap in the resistance of the
bacteria to
tellurite, we determined the MICs for the wild type and the
nap mutant.
MICs.
The MICs of tellurite for the wild type and
nap mutant MS523 were determined on plates. The plates were
incubated at 30°C under dark aerobic conditions or phototrophic
conditions. As observed previously for several species of
photosynthetic bacteria (24), the MIC depends on the
growth conditions; the MICs were 100 and 280 ppm for aerobic and
phototrophic conditions, respectively. However, under both types of
conditions, the MICs of tellurite were identical for the wild type and
the nap mutant. Deletion of the gene encoding the
periplasmic nitrate reductase in R. sphaeroides IL106 did
not, therefore, modify its resistance to tellurite. However, this
situation is different from that encountered in E. coli, in
which mutants depleted in the two membrane-bound nitrate reductases are hypersensitive to tellurite; the MIC is 0.03 µg · ml
1, compared to 2 µg · ml
1
for the wild type (3). However, even for the wild type,
these values are quite low compared to the value for R. sphaeroides (100 µg · ml
1 under aerobic
conditions). This means that even if in R. sphaeroides the
nitrate reductase contributes to the same extent as the nitrate reductases of E. coli to resistance to tellurite, its
participation is masked by other reducing pathways and mechanisms which
must be present in vivo in R. sphaeroides but not in
E. coli.
This study showed that despite the capacity of Nap to reduce tellurite
and selenate in vitro, the catalytic activity of the
enzyme for these
substrates is low and the resistance of
R. sphaeroides to
these substrates cannot be attributed to their reduction by
Nap.
Efforts to isolate specific selenate, selenite, or tellurite
reductases
in this species by using biochemical approaches have
been unsuccessful.
A genetic study is now in progress, and some
mutants that are not able
to reduce oxyanions have already been
isolated (Bébien et al.,
submitted).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: CEA/Cadarache,
DSV, DEVM, Laboratoire de Bioénergétique Cellulaire, 13108 St. Paul lez Durance Cedex, France. Phone: (33) 4 42 25 35 70. Fax:
(33) 4 42 25 47 01. E-mail: address: msabaty{at}cea.fr.
 |
REFERENCES |
| 1.
|
Alonso, G.,
C. Gomes,
C. Gonzalez, and V. R. Lemoine.
2000.
On the mechanism of resistance to channel-forming colicins (PacB) and tellurite, encoded by plasmid Mip233 (IncH13).
FEMS Microbiol. Lett.
192:257-261[CrossRef][Medline].
|
| 2.
|
Avazéri, C.,
J. Pommier,
G. Giordano,
F. Blasco, and A. Verméglio.
1995.
Reduction of oxyanions by photosynthetic bacteria and Escherichia coli: role of the nitrate reductase in the reduction of tellurite and selenate, p. 423-426.
In
P. Mathis (ed.), Photosynthesis: from light to biosphere. Kluwer, Dordrecht, The Netherlands.
|
| 3.
|
Avazéri, C.,
R. J. Turner,
J. Pommier,
J. H. Weiner,
G. Giordano, and A. Verméglio.
1997.
Tellurite reductase activity of nitrate reductase is responsible for the basal resistance of Escherichia coli to tellurite.
Microbiology
143:1181-1189[Abstract/Free Full Text].
|
| 4.
|
Bell, L. C.,
D. J. Richardson, and S. J. Ferguson.
1990.
Periplasmic and membrane-bound nitrate reductases in Thiosphaera pantotropha: the periplasmic enzyme catalyses the first step in aerobic denitrification.
FEBS Lett.
265:85-87[CrossRef][Medline].
|
| 5.
|
Berks, B. C.,
D. J. Richardson,
C. Robinson,
A. Reilly,
R. T. Aplin, and S. J. Ferguson.
1994.
Purification and characterization of the periplasmic nitrate reductase from Thiosphaera pantotropha.
Eur. J. Biochem.
220:117-124[Medline].
|
| 6.
|
Berks, B. C.,
S. J. Ferguson,
J. W. B Moir, and D. J. Richardson.
1995.
Enzymes and associated electron transport systems that catalyse the respiratory reduction of nitrogen oxides and oxyanions.
Biochim. Biophys. Acta
1232:97-173[Medline].
|
| 7.
|
Cohen-Bazire, G.,
W. R. Sistrom, and R. Y. Stanier.
1956.
Kinetic studies of pigment synthesis by non-sulfur purple bacteria.
J. Cell. Comp. Physiol.
49:25-68.
|
| 8.
|
Cournoyer, B.,
S. Watanabe, and A. Vivian.
1998.
A tellurite-resistance genetic determinant from phytopathogenic pseudomonads encodes a thiopurine methyltransferase: evidence of a widely-conserved family of methyltransferases.
Biochim. Biophys. Acta
1397:161-168[Medline].
|
| 9.
|
Davis, J.,
T. J. Donohue, and S. Kaplan.
1988.
Construction, characterization, and complementation of a puf mutant of Rhodobacter sphaeroides.
J. Bacteriol.
170:320-329[Abstract/Free Full Text].
|
| 10.
|
Demoll-Decker, H., and J. M. Macy.
1993.
The periplasmic nitrite reductase of Thauera selenatis may catalyse the reduction of selenite to elemental selenium.
Arch. Microbiol.
160:241-247.
|
| 11.
|
Ganther, H. E.
1999.
Selenium metabolism, selenoproteins and mechanisms of cancer prevention: complexities with thioredoxin reductase.
Carcinogenesis
20:1657-1666[Abstract/Free Full Text].
|
| 12.
|
Gerrard, T. L.,
J. N. Telford, and H. H. Williams.
1974.
Detection of selenium deposits in Escherichia coli by electron microscopy.
J. Bacteriol.
119:1057-1060[Abstract/Free Full Text].
|
| 13.
|
Iobbi, C.,
C. L. Santini,
V. Bonnefoy, and G. Giordano.
1987.
Biochemical and immunologicol evidence for a second nitrate reductase in Escherichia coli K-12.
Eur. J. Biochem.
168:451-459[Medline].
|
| 14.
|
Kessi, J.,
M. Ramuz,
E. Wehrli,
M. Spycher, and R. Bachofen.
1999.
Reduction of selenite and detoxification of elemental selenium by the phototrophic bacterium Rhodospirillum rubrum.
Appl. Environ. Microbiol.
65:4735-4740.
|
| 15.
|
Kormutakova, R.,
L. Klucar, and J. Turna.
2000.
DNA sequence analysis of the tellurite-resistance determinant from clinical strain of Escherichia coli and identification of essential genes.
Biometals
13:135-139[CrossRef][Medline].
|
| 16.
|
Laüchi, A.
1993.
Selenium in plants: uptake, function and environmental toxicity.
Bot. Acta
106:455-468.
|
| 17.
|
Lee, J. K., and S. Kaplan.
1995.
Transcriptional regulation of puc operon expression in Rhodobacter sphaeroides.
J. Biol. Chem.
270:20453-20458[Abstract/Free Full Text].
|
| 18.
|
Liu, H.-P.,
S. Takio,
T. Satoh, and I. Yamamoto.
1999.
Involvement in denitrification of the napKEFDABC genes encoding the periplasmic nitrate reductase system in the denitrifying phototrophic bacterium Rhodobacter sphaeroides f. sp. denitrificans.
Biosci. Biotechnol. Biochem.
63:530-536[CrossRef][Medline].
|
| 19.
|
Liu, M. F.,
R. J. Turner,
T. L. Winstone,
A. Saetre,
M. Dyllick-Brenzinger,
G. Jickling,
L. W. Tari,
J. H. Weiner, and D. E. Taylor.
2000.
Escherichia coli TehB requires S-adenosylmethionine as a cofactor to mediate tellurite resistance.
J. Bacteriol.
182:6509-6513[Abstract/Free Full Text].
|
| 20.
|
Lloyd Jones, G.,
A. M. Osborn,
D. A. Ritchie,
P. Strike,
J. L. Hobman,
N. L. Brown, and D. A. Rouch.
1994.
Accumulation and intracellular fate of tellurite resistant in Escherichia coli: a model for the mechanism of resistance.
FEMS Microbiol. Lett.
118:113-120[CrossRef][Medline].
|
| 21.
|
Macy, J. M.,
T. A. Michel, and D. A. Kirsch.
1989.
Selenate reduction by a Pseudomonas species: a new mode of anaerobic respiration.
FEMS Microbiol. Lett.
61:195-198.
|
| 22.
|
McEwan, A. G.,
H. G. Wetzstein,
O. Meyer,
J. B. Jackson, and S. J. Ferguson.
1987.
The periplasmic nitrate reductase of Rhodobacter capsulatus; purification, characterisation and distinction from a single reductase for trimethylamine-N-oxide, dimethylsulphoxide and chlorate.
Arch. Microbiol.
147:340-345[CrossRef].
|
| 23.
|
Menendez, C.,
J. Igloi,
H. Heninger, and R. Brandsch.
1995.
A pAO1-encoded molybdeopterin cofactor gene (moaA of Arthrobacter nicotinovorans): characterization and site-directed mutagenesis of the encoded protein.
Arch. Microbiol.
164:142-151[CrossRef][Medline].
|
| 24.
|
Moore, M. D., and S. Kaplan.
1992.
Identification of intrinsic high-level resistance to rare-earth oxides and oxyanions in members of the class Proteobacteria: characterization of tellurite, selenite, and rhodium sesquioxide reduction in Rhodobacter sphaeroides.
J. Bacteriol.
174:1505-1514[Abstract/Free Full Text].
|
| 25.
|
Moore, M. D., and S. Kaplan.
1994.
Members of the family Rhodospirillaceae reduce heavy-metal oxyanions to maintain redox poise during photosynthetic growth.
ASM News
60:17-23.
|
| 26.
|
Morpeth, F., and D. Boxer.
1985.
Kinetic analysis of respiratory nitrate reductase from Escherichia coli K12.
Biochemistry
24:40-46[CrossRef][Medline].
|
| 27.
|
O'Gara, J. P.,
M. Gomelsky, and S. Kaplan.
1997.
Identification and molecular genetic analysis of multiple loci contributing to high-level tellurite resistance in Rhodobacter sphaeroides 2.4.1.
Appl. Environ. Microbiol.
63:4713-4720[Abstract].
|
| 28.
|
Ohlendorf, H. M., and G. M. Santolo.
1994.
Kesterson Reservoir past, present and future: an ecological risk assessment, p. 69-117.
In
J. R. Frankenberger, and S. Benson (ed.), Selenium in the environment. Marcel Dekker, New York, N.Y.
|
| 29.
|
Oremland, R. S.
1994.
Biogeochemical transformation of selenium in anoxic environments, p. 389-420.
In
J. R. Frankenberger, and S. Benson (ed.), Selenium in the environment. Marcel Dekker, New York, N.Y.
|
| 30.
|
Oremland, R. S.,
J. Switzer Blum,
C. W. Culbertson,
P. T. Visscher,
L. G. Miller,
P. Dowdle, and F. E. Strohmaier.
1994.
Isolation, growth, and metabolism of an obligately anaerobic, selenate-respiring bacterium, strain SES-3.
Appl. Environ. Microbiol.
60:3011-3019[Abstract/Free Full Text].
|
| 31.
|
Sabaty, M.,
J. Gagnon, and A. Verméglio.
1994.
Induction by nitrate of cytoplasmic and periplasmic proteins in the photodenitrifier Rhodobacter sphaeroides forma sp. denitrificans under anaerobic or aerobic condition.
Arch. Microbiol.
162:335-343[CrossRef][Medline].
|
| 32.
|
Sabaty, M., and S. Kaplan.
1996.
mgpS, a complex regulatory locus involved in the transcriptional control of the puc and puf operons in Rhodobacter sphaeroides 2.4.1.
J. Bacteriol.
178:35-45[Abstract/Free Full Text].
|
| 33.
|
Sabaty, M.,
M. Bébien,
C. Avazéri,
V. Yurkov,
P. Richaud, and A. Verméglio.
1998.
Reduction of tellurite and selenite by photosynthetic bacteria, p. 4123-4128.
In
G. Garab (ed.), Photosynthesis: mechanisms and effects. Kluwer, Dordrecht, The Netherlands.
|
| 34.
|
Sabaty, M.,
C. Schwintner,
S. Cahors,
P. Richaud, and A. Verméglio.
1999.
Nitrite and nitrous oxide reductase regulation by nitrogen oxides in Rhodobacter sphaeroides f. sp. denitrificans IL106.
J. Bacteriol.
181:6028-6032[Abstract/Free Full Text].
|
| 35.
|
Satoh, T.
1981.
Soluble dissimilatory nitrate reductase containing cytochrome c from a photodenitrifier, Rhodopseudomonas sphaeroides forma sp. denitrificans.
Plant Cell Physiol.
22:443-452[Abstract/Free Full Text].
|
| 36.
|
Sawada, E., and T. Satoh.
1980.
Periplasmic location of dissimilatory nitrate and nitrite reductases in a denitrifying phototrophic bacterium.
Plant Cell Physiol.
21:205-210[Abstract/Free Full Text].
|
| 37.
|
Schröder, I.,
S. Rech,
T. Krafft, and J. M. Macy.
1997.
Purification and characterization of the selenate reductase from Thauera selenatis.
J. Biol. Chem.
272:23765-23768[Abstract/Free Full Text].
|
| 38.
|
Sears, H.,
S. Spiro, and D. J. Richardson.
1997.
Effect of carbon substrate and aeration on nitrate reduction and expression of the periplasmic and membrane-bound nitrate reductases in carbon-limited continuous cultures of Paracoccus denitrificans Pd1222.
Microbiology
143:3767-3774[Abstract/Free Full Text].
|
| 39.
|
Sears, H. J.,
S. J. Ferguson,
D. J. Richardson, and S. Spiro.
1993.
The identification of a periplasmic nitrate reductase in Paracoccus denitrificans.
FEMS Microbiol. Lett.
113:107-112[CrossRef].
|
| 40.
|
Siddiqui, R. A.,
U. Warnecke-Eberz,
A. Hengsberger,
B. Schneider, and B. Freidrich.
1993.
Structure and function of a periplasmic nitrate reductase in Alcaligenes eutrophus H16.
J. Bacteriol.
175:5867-5876[Abstract/Free Full Text].
|
| 41.
|
Solomon, P. S.,
A. L. Shaw,
I. Lane,
G. R. Hanson,
T. Palmer, and A. G. McEwan.
1999.
Characterization of a molybdenum cofactor biosynthetic gene cluster in Rhodobacter capsulatus which is specific for the biogenesis of dimethylsulfoxide reductase.
Microbiology
145:1421-1429[Abstract/Free Full Text].
|
| 42.
|
Stadtman, T. C.
1996.
Selenocysteine.
Annu. Rev. Biochem.
65:83-100[CrossRef][Medline].
|
| 43.
|
Switzer Blum, J.,
A. Burns Bindi,
J. Buzzelli,
J. F. Stolz, and R. S. Oremland.
1998.
Bacillus arsenicoselenatis, sp. nov., and Bacillus selenitireducens, sp. nov.: two haloalkaliphiles from Mono Lake, California that respire oxyanions of selenium and arsenic.
Arch. Microbiol.
171:19-30[CrossRef][Medline].
|
| 44.
|
Taylor, D. E.,
Y. Hou,
R. J. Turner, and J. H. Weiner.
1994.
Location of a potassium tellurite resistance operon (tehA tehB) within the terminus of Escherichia coli K-12.
J. Bacteriol.
176:2740-2742[Abstract/Free Full Text].
|
| 45.
|
Turner, R. J.,
Y. Hou,
J. H. Weiner, and D. E. Taylor.
1992.
The arsenical ATPase efflux pump mediates tellurite resistance.
J. Bacteriol.
174:3092-3094[Abstract/Free Full Text].
|
| 46.
|
Turner, R. J.,
J. H. Weiner, and D. E. Taylor.
1995.
The tellurite-resistance determinants tehAtehB and klaAklaBtelB have different biochemical requirements.
Microbiology
141:3133-3140[Abstract/Free Full Text].
|
| 47.
|
Van Fleet-Stalder, V.,
T. G. Chasteen,
I. J. Pickering,
G. N. George, and R. C. Prince.
2000.
Fate of selenate and selenite metabolized by Rhodobacter sphaeroides.
Appl. Environ. Microbiol.
66:4849-4853[Abstract/Free Full Text].
|
| 48.
|
Walter, E. G.,
C. M. Thomas,
J. P. Ibbotson, and D. E. Taylor.
1991.
Transcriptional analysis, translational analysis and sequence of the KilA-tellurite resistance region of plasmid RK2Ter.
J. Bacteriol.
173:1111-1119[Abstract/Free Full Text].
|
| 49.
|
Warnecke-Eberz, U., and B. Friedrich.
1993.
Three nitrate reductase activities in Alcaligenes eutrophus.
Arch. Microbiol.
159:405-409[CrossRef].
|
| 50.
|
Whelan, K. F.,
E. Colleran, and D. E. Taylor.
1995.
Phage inhibition, colicin resistance, and tellurite resistance are encoded by a single cluster of genes on the IncH12 plasmid R478.
J. Bacteriol.
177:5016-5027[Abstract/Free Full Text].
|
| 51.
|
Zumft, W. G.
1997.
Cell biology and molecular basis of denitrification.
Microbiol. Mol. Biol. Rev.
61:533-616[Abstract].
|
Applied and Environmental Microbiology, November 2001, p. 5122-5126, Vol. 67, No. 11
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.11.5122-5126.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ridley, H., Watts, C. A., Richardson, D. J., Butler, C. S.
(2006). Resolution of Distinct Membrane-Bound Enzymes from Enterobacter cloacae SLD1a-1 That Are Responsible for Selective Reduction of Nitrate and Selenate Oxyanions. Appl. Environ. Microbiol.
72: 5173-5180
[Abstract]
[Full Text]
-
Zawadzka, A. M., Crawford, R. L., Paszczynski, A. J.
(2006). Pyridine-2,6-Bis(Thiocarboxylic Acid) Produced by Pseudomonas stutzeri KC Reduces and Precipitates Selenium and Tellurium Oxyanions.. Appl. Environ. Microbiol.
72: 3119-3129
[Abstract]
[Full Text]
-
Pierru, B., Grosse, S., Pignol, D., Sabaty, M.
(2006). Genetic and Biochemical Evidence for the Involvement of a Molybdenum-Dependent Enzyme in One of the Selenite Reduction Pathways of Rhodobacter sphaeroides f. sp. denitrificans IL106.. Appl. Environ. Microbiol.
72: 3147-3153
[Abstract]
[Full Text]
-
Sarret, G., Avoscan, L., Carriere, M., Collins, R., Geoffroy, N., Carrot, F., Coves, J., Gouget, B.
(2005). Chemical Forms of Selenium in the Metal-Resistant Bacterium Ralstonia metallidurans CH34 Exposed to Selenite and Selenate. Appl. Environ. Microbiol.
71: 2331-2337
[Abstract]
[Full Text]
-
Bebien, M., Kirsch, J., Mejean, V., Vermeglio, A.
(2002). Involvement of a putative molybdenum enzyme in the reduction of selenate by Escherichia coli. Microbiology
148: 3865-3872
[Abstract]
[Full Text]
-
Rathgeber, C., Yurkova, N., Stackebrandt, E., Beatty, J. T., Yurkov, V.
(2002). Isolation of Tellurite- and Selenite-Resistant Bacteria from Hydrothermal Vents of the Juan de Fuca Ridge in the Pacific Ocean. Appl. Environ. Microbiol.
68: 4613-4622
[Abstract]
[Full Text]
-
Ranjard, L., Prigent-Combaret, C., Nazaret, S., Cournoyer, B.
(2002). Methylation of Inorganic and Organic Selenium by the Bacterial Thiopurine Methyltransferase. J. Bacteriol.
184: 3146-3149
[Abstract]
[Full Text]