Previous Article | Next Article 
Applied and Environmental Microbiology, November 2001, p. 5127-5133, Vol. 67, No. 11
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.11.5127-5133.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Clostridium beijerinckii Cells Expressing
Neocallimastix patriciarum Glycoside Hydrolases Show
Enhanced Lichenan Utilization and Solvent Production
Ana M.
López-Contreras,1,2,*
Hauke
Smidt,1
John
van
der Oost,1
Pieternel A. M.
Claassen,2
Hans
Mooibroek,2 and
Willem
M.
de Vos1
Laboratory of
Microbiology1 and Agrotechnological
Research Institute (ATO),2 Wageningen
University and Research Centre, Wageningen, The Netherlands
Received 16 April 2001/Accepted 1 August 2001
 |
ABSTRACT |
Growth and the production of acetone, butanol, and ethanol by
Clostridium beijerinckii NCIMB 8052 on
several polysaccharides and sugars were analyzed. On
crystalline cellulose, growth and solvent production were observed only
when a mixture of fungal cellulases was added to the medium. On
lichenan growth and solvent production occurred, but this polymer was
only partially utilized. To increase utilization of these polymers and
subsequent solvent production, the genes for two new glycoside
hydrolases, celA and celD from the
fungus Neocallimastix patriciarum, were cloned
separately into C. beijerinckii. To do this, a secretion
vector based on the pMTL500E shuttle vector and containing the promoter
and signal sequence coding region of the Clostridium
saccharobutylicum NCP262 eglA gene was
constructed and fused either to the celA gene or the
celD gene. Stable C. beijerinckii
transformants were obtained with the resulting plasmids, pWUR3
(celA) and pWUR4 (celD). The recombinant
strains showed clear halos on agar plates containing carboxymethyl
cellulose upon staining with Congo red. In addition, their culture
supernatants had significant endoglucanase activities (123 U/mg of
protein for transformants harboring celA and 78 U/mg of protein for transformants harboring celD). Although
C. beijerinckii harboring either celA or
celD was not able to grow, separately or in mixed
culture, on carboxymethyl cellulose or microcrystalline cellulose, both
transformants showed a significant increase in solvent production
during growth on lichenan and more extensive degradation of
this polymer than that exhibited by the wild-type strain.
 |
INTRODUCTION |
The anaerobic conversion of
carbohydrates into acetone, butanol, and ethanol, which is known as ABE
fermentation, by several strains of Clostridium spp. was
first described more than half a century ago. Interest in industrial
applications of this process was lost following the development of the
petrochemical industry, and currently ABE fermentation plants are
operated only in the People's Republic of China (7).
Recently, however, there has been increased interest in the production
of chemicals and energy by using renewable resources as starting
materials. Biomass is a widely available substrate, and utilization of
biomass for production of energy carriers is considered an
environmentally friendly process (3). For ABE fermentation
the most interesting substrates appear to be agricultural or domestic
organic wastes due to their low price, wide availability, and
appropriate sugar compositions (3, 14). These materials
contain mainly two major sugar polymers: cellulose, an insoluble,
linear, unbranched homopolysaccharide consisting of glucose units
linked by
-1,4 glycosidic bonds; and hemicellulose, which consists
of noncellulosic polysaccharides, including xylans, mannans, and
glucans. The cellulose fibrils are partially arranged in a crystalline
structure, integrated with hemicellulose, and embedded in lignin (a
complex polyphenolic compound). Therefore, in contrast to other
substrates used in the past, such as starch or molasses,
lignocellulosic substrates are very recalcitrant to degradation, and an
expensive hydrolysis step is often necessary prior to fermentation.
Many solventogenic clostridia can utilize a wide range of
carbohydrates, including mono- and disaccharides (such as glucose, cellobiose, fructose, maltose, or xylose), which are generated during
degradation of plant polysaccharides. However, none of the known
solventogenic species is able to utilize cellulose, although some of
these species do show some cellulase activity (13). With
respect to other polysaccharides, most of the solvent-producing clostridia can efficiently ferment starch, and Clostridium
acetobutylicum ATCC 824 utilizes xylan, although not very
efficiently (17). During the last decade, important
advances in our knowledge concerning the physiology and genetics of
solventogenic clostridia have been made. Genetic tools for
transformation have been developed for a number of strains, including
Clostridium beijerinckii NCIMB 8052 (23).
Transformation of this strain with suitable genes coding for active
extracellular hydrolytic enzymes would increase its substrate
utilization range and, eventually, enable it to degrade cellulose and
hemicellulose more efficiently. Cloning and expression of the
Clostridium cellulovorans engB gene in C. acetobutylicum have been described. However, the recombinant
strain exhibited increased extracellular endoglucanase activity but was not able to grow on cellulose as a sole carbon source
(12). The engB gene from C. cellulovorans codes for a glycoside hydrolase that belongs to
family 5 of glycoside hydrolases and exhibits endoglucanase and
xylanase activities but not hydrolytic activity on crystalline
cellulose (8).
To provide an alternative approach, we directed our attention to
cloning glycoside hydrolase genes from eukaryotic microorganisms and
focused on the genes from the anaerobic rumen fungus
Neocallimastix patriciarum, which grows on crystalline
cellulose as a sole carbon source and exhibits high cellulolytic and
hemicellulolytic activities. Another reason why we chose this fungus
was its low DNA G+C content and its codon usage, which is compatible
with that of C. beijerinckii (30). Several
cDNAs coding for cellulases from this fungus have been cloned and
functionally expressed in Escherichia coli (6, 29,
30). These cDNAs include the celA gene coding for
cellobiohydrolase (EC 3.2.1.91), an exoenzyme that releases
cellobiose as a main product from crystalline cellulose
(6). N. patriciarum CelA belongs to
family 6 of the glycoside hydrolases (5;
http://afmb.cnrs-mrs.fr/~pedro/CAZY/db.html), and its production is
induced during fungal growth in the presence of cellulose. Another
well-characterized gene is the N. patriciarum celD gene,
which encodes an endoglucanase (EC 3.2.1.4) belonging to family 5 of
the glycoside hydrolases (5, 6). CelD is constitutively
produced by the fungus and exhibits activity towards carboxymethyl
cellulose (CMC) and, to a lesser extent, towards Avicel
(microcrystalline cellulose) and amorphous cellulose (29). It is generally assumed that enzymes with complementary activities, such as exoglucanases (cellobiohydrolases) and endoglucanases, act
synergistically during degradation of crystalline cellulose.
In this study we describe the growth of and solvent production by
C. beijerinckii NCIMB 8052 on different glucose polymers, including lichenan, CMC, and crystalline cellulose. In media with crystalline cellulose, growth and solvent production were observed only
when a mixture of fungal cellulases was added to the medium. Subsequently, we cloned the N. patriciarum celA and
celD genes individually into C. beijerinckii
NCIMB 8052 using a secretion vector. Extracellular production of the
fungal enzymes by C. beijerinckii transformants was
observed, and substrate utilization by transformants was also studied
in different combinations.
 |
MATERIALS AND METHODS |
Bacterial strains, media, and growth conditions.
C.
beijerinckii NCIMB 8052 was kindly supplied by M. Young
(University of Wales, Aberystwyth, United Kingdom). Clostridium saccharobutylicum NCP262 was kindly provided by S. R. Reid
(University of Capetown, Capetown, South Africa). Stock cultures were
maintained as spore suspensions in sterile 10% (vol/vol) glycerol at
20°C. Spore suspensions were heat shocked for 1 min at 100°C (for
strain NCIMB 8052) or for 3 min at 75°C (for strain NCP262) in a
water bath prior to inoculation. For production of precultures,
vegetative cells were grown in a semisynthetic medium described
previously (19) or in clostridial basal medium (CBM)
(20) overnight at 37°C. For growth experiments the same
media were supplemented with 1.5% (wt/vol) glucose (Merck, Darmstadt,
Germany), 3% (wt/vol) cellobiose (Sigma), 6% (wt/vol) Avicel (Merck),
6% (wt/vol) Sigmacell (type 50; Sigma), 1 or 2% (wt/vol) CMC (low or
high viscosity; Sigma), or 2% (wt/vol) lichenan (Sigma) as the carbon
source, as indicated below. For simultaneous saccharification and
fermentation experiments, media were supplemented with Cellulast 1.5L
(Novozymes, Bagsvaerd, Denmark) at a concentration of 2%
(weight of Celluclast 1.5L/weight of substrate), unless indicated
otherwise, at the beginning of the fermentation (zero time). All
experiments were performed anaerobically in a Coy anaerobic chamber
(Coy Laboratory Products, Grass Lake, Mich.) under a 20%
CO2-4% H2-76%
N2 atmosphere unless indicated otherwise.
For vector construction E. coli XL1 blue (Stratagene) was
used. This strain was usually grown in Luria-Bertani broth as described previously (25). When necessary, media were supplemented
with ampicillin (50 µg/ml), isopropyl-
-thiogalactopyranoside
(IPTG) (50 µg/ml),
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside
(X-Gal) (40 µg/ml), or erythromycin (10 µg/ml).
Plasmids pNPCA (6) and pBSFD (29) containing
the cDNA sequences of the celA and celD genes,
respectively, were kindly supplied by G.-P. Xue (CSIRO Tropical
Agriculture, St. Lucia, Australia). Plasmid pMTL500E (21),
used as cloning vector for C. beijerinckii, was kindly
supplied by M. Young.
Transformation procedures, DNA manipulation, and PCR.
All
general DNA manipulations in E. coli were carried out
essentially as described previously (24). Transformation
of C. beijerinckii NCIMB 8052 was performed by
electroporation as described previously (21).
Restriction endonucleases and modification enzymes were purchased from
Roche Diagnostics, Eurogentec, or Qiagen.
DNA isolation from E. coli was performed with a Wizard Plus
SV miniprep kit (Promega Inc.). Plasmid DNA was isolated from C. beijerinckii by the modified alkaline lysis method described previously (21). Genomic DNA from C. saccharobutylicum NCP262 was isolated by the method of Pospiech
and Neumann (22).
The oligonucleotides used for mutagenesis or PCR were purchased from
Eurogentec. The DNA fragments containing the desired mutations were
cloned into pGEMT-Easy (Promega Inc.). The mutations were verified by
sequencing with an automated laser fluorescent ALF DNA sequencer
(Amersham Pharmacia Biotech), using fluorescently labeled M13 universal
and reverse primers. The promoter plus signal peptide fragment from the
eglA gene of C. saccharobutylicum NCP262 was obtained by PCR as a 0.37-kb XhoI/NcoI
fragment. The primers used were based on the sequence of the
eglA gene (31) and included forward primer
5'GCCTCGAGCAAACTGCTTCCCCTAATTCCC3' and reverse primer 5'GCCATGGTTGCAGCTTCAGCTTTATAA3';
XhoI and NcoI sites (underlined) were added at
the 5' and 3' ends of the fragment, respectively. The NcoI
site was added in such a way that it allowed the in-frame fusion of the
genes to be cloned downstream. The celA gene was amplified
from plasmid pNPCA by PCR performed with forward primer 5'GCACGCGTGTGGTGGTGCCTGGGCTCAATG3' and reverse
primer 5'GCTCTAGATTAAAATGATGGTCTAGC3'; this
resulted in introduction of MluI and XbaI sites
(underlined) at the 5' and 3' ends of the gene, respectively. The
celA fragment was cloned after the promoter-signal sequence
fragment in pMTL500E as an MluI/XbaI fragment,
resulting in pWUR3 (Fig. 1). The
celD gene was amplified from plasmid pBFSD by PCR performed
with forward primer 5'GCCATGGAAGCTATACGATTTCGAACC3'
and reverse primer
5'GCTCTAGATTAGTTGGTTCTTCTGG3'; this resulted in
introduction of NcoI and XbaI sites (underlined) at the 5' and 3' ends of the gene, respectively. The 1.2-kb
celD fragment obtained was cloned as a
NcoI/XbaI fragment after the promoter-signal sequence in pMTL500E, resulting in pWUR4.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic representation of the constructions in
pMTL500E that generated pWUR3 (A) and pWUR4 (B). Amino acids in
boldface type are amino acids of the CelA or CelD protein. The position
of the C. saccharobutylicum eglA promoter (P) is
indicated, as is the position of the signal sequence (SP). The fungal
cDNA is indicated by the striped arrow. The restriction sites in the
fusions are underlined.
|
|
Analytical methods.
The concentrations of solvents
(acetone, butanol, and ethanol) and acids (acetic and butyric acids)
were determined in clear supernatants of centrifuged culture samples by
high-performance liquid chromatography as described previously by using
propionic acid as an internal standard (10). Separation
was carried out by using a Shodex KC-311 (Shodex, Tokyo, Japan)
column at 80°C and 3 mM
H2SO4 as the eluent at a
flow rate of 1 ml/min. A refractive index detector (Waters 410;
Millipore) and a UV absorbance detector (model VWM2141; Pharmacia) were
used in series. The concentrations of most of the metabolites were
determined from the refractive index chromatograms; the only exception
was the concentration of butyric acid, which was determined from UV
chromatograms at 210 nm.
Preparation of culture samples for enzyme assays.
Cells were
sedimented by centrifugation at 10,000 × g at 4°C
for 15 min. The culture supernatant was collected and concentrated (approximately 30-fold) by ultrafiltration through a Millipore PM10
membrane at 4°C. Low-molecular-weight compounds and medium components
were removed from the concentrated material by dilution with 4 volumes
of ice-cold 20 mM sodium phosphate buffer (pH 6.0); this was followed
by reconcentration by ultrafiltration. This process was repeated three
times, and the resulting fractions were used for enzymatic activity
determinations. C. beijerinckii cell extracts were prepared
as follows. One milliliter of culture cells was harvested by
centrifugation, resuspended in 0.1 ml of 50 mM Tris-HCl (pH 8.0)
buffer, and sonicated with a Branson Sonifier. Cell debris was removed
by centrifugation (10,000 × g for 10 min), and the
resulting supernatant was used for enzymatic activity determinations.
Cellulase activity assays.
E. coli and C. beijerinckii transformants grown on agar plates were screened for
endoglucanase activity by the Congo red staining method of Teather and
Wood (26). Some modifications were made, as follows: CMC
was added to the medium at a concentration of 0.1% (wt/vol), and
carboxymethyl cellulase (CMCase) activity was detected after 2 to 4 days of incubation at 37°C by washing the cells out of the plates
with sterile demineralized water and staining the CMC with Congo red.
Endoglucanase and exoglucanase activities were determined as described
previously (14). The following substrates were used (final
concentrations): 0.5% (wt/vol) CMC, 0.2% (wt/vol) lichenan (Sigma),
0.5% (wt/vol) laminarin (Sigma), and 0.5% (wt/vol) Avicel in 50 mM
citrate buffer (pH 5.7). The substrates were incubated with the enzyme
samples for 60 min at 39°C in a water bath. The reducing sugars
formed were measured by the 3,5-dinitrosalicylic acid method
(9). One unit of activity corresponded to the formation of
1 nmol of reducing sugar (D-glucose) per min. Protein
concentrations in the samples were determined by the Bradford assay
(Bio-Rad).
 |
RESULTS |
Growth of C. beijerinckii NCIMB 8052 on
(hemi)cellulosic substrates.
To analyze the potential for acetone,
butanol, and ethanol production on substrates other than the
well-studied compounds starch and mono- and disaccharides
(16), C. beijerinckii NCIMB 8052 was grown on
various forms of cellulose and lichenan (Table 1). Because microcrystalline cellulose
and lichenan were insoluble, growth on these substrates could not be
quantified accurately, and growth was indicated as positive or
negative. In media with microcrystalline cellulose (Avicel and
Sigmacell) or soluble cellulose (CMC) there was virtually no growth.
Very small amounts of solvents were produced, which resulted from
utilization of residual glucose in the medium (concentration, less than
4 g/liter), which probably originated from impurities in the substrates
added and from the inoculum (10% [vol/vol] from an overnight culture
grown in the presence of 6% [wt/vol] glucose). In medium
containing cellobiose as a carbon source, the growth and solvent
production levels were similar to those in the same media containing
glucose (Table 1). Growth and solvent production were also observed in
medium containing lichenan, but a residue was left after fermentation,
indicating that utilization of this polymer was incomplete.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Growth of and production of solvents (acetone and
butanol) by C. beijerinckii on semisynthetic medium with
different substrates in absence or presence of cellulolytic
enzymesa
|
|
In order to study the possibility of increasing solvent production from
cellulose (Avicel, Sigmacell, or CMC) or lichenan, a commercial
cellulase mixture, Celluclast 1.5L, was added to media along with
these substrates at the same time as the inoculum. This enzyme mixture
is obtained by fermentation from the fungus Trichoderma
reesei and catalyzes the breakdown of cellulose into glucose,
cellobiose, and higher glucose polymers since it has mainly cellulase
activity and exhibits relatively low
-glucosidase activity (2,
4). When the cellulolytic enzymes were added to medium
containing CMC as the sole carbon source, no growth was observed.
This did not change even when the initial amount of cellulases
was increased fivefold. However, in media containing microcrystalline
cellulose supplemented with the cellulolytic enzymes, significant
growth and solvent production were observed. The growth of C. beijerinckii on microcrystalline cellulose supplemented with
cellulases was slower than the growth on glucose, since the optimal
temperature of Celluclast 1.5L is higher (60°C) than the incubation
temperature of the cultures (37°C) and growth depended on
hydrolysis of cellulose. C. beijerinckii is able to utilize cellobiose, and addition of a purified preparation of fungal
-glucosidases (Novozyme N188) to medium containing microcrystalline
cellulose supplemented with Celluclast 1.5L did not significantly
affect solvent production (data not shown). Finally, addition of
cellulolytic enzymes did not significantly improve the production of
solvents on lichenan, and a solid residue was still present in the
medium after fermentation.
These results indicate that C. beijerinckii NCIMB 8052 can
utilize the products of degradation of crystalline cellulose by the
T. reesei cellulases added (Celluclast 1.5L) for growth and solvent production. In addition, C. beijerinckii grew to
some extent on lichenan, and solvent production on this polymer
increased, although slightly, when the mixture of fungal cellulases was
added to the medium. Therefore, we expected that sufficient production of appropriate glycoside hydrolase enzymes by C. beijerinckii should enable it to utilize cellulose or lichenan
more efficiently without exogenous addition of enzymes.
Cloning and expression of the N. patriciarum celA
and celD cDNAs using a clostridial secretion
vector.
To allow extracellular production of fungal glycoside
hydrolases by C. beijerinckii, a clostridial secretion
vector was designed. This vector was based on the 6.4-kb shuttle vector
pMTL500E and the well-characterized promoter and signal peptide coding
sequences of the
-1,4-endoglucanase (eglA) gene from
C. saccharobutylicum NCP262 (31).
In-frame fusions between the eglA signal peptide sequence
and the N. patriciarum celA or celD coding
sequence were created by adding adequate restriction sites at the 3'
end of the eglA sequence as well as at the 5' end of the
celA or celD coding sequence (Fig. 1).
Transformants of E. coli harboring the resulting 6.8-kb plasmid pWUR3 (celA) or the 6.9-kb plasmid pWUR4
(celD) were readily obtained and were found to have the
expected configuration upon sequence analysis of the fusion sites (Fig.
1). Subsequently, E. coli transformants harboring either
pWUR3 or pWUR4 were analyzed for production of endoglucanase activity.
Both strains were found to produce clear halos around colonies grown in
agar plates supplemented with CMC upon staining with Congo red (results
not shown). This confirmed that the N. patriciarum celA and
celD genes were functionally expressed in E. coli
(5, 15).
The expression plasmids pWUR3 and pWUR4 were subsequently introduced by
electroporation into C. beijerinckii. While transformants with pWUR4 were obtained at a frequency similar to that observed with
cloning vector pMTL500E (~102
transformants/µg of DNA), the transformation frequency of pWUR3 was
more than 10-fold lower. However, restriction analysis showed that the
size and architecture of the expression plasmids isolated from C. beijerinckii transformants were as expected in all of the
transformant colonies tested.
To prevent plasmid loss, erythromycin was added to the media at a
concentration of 10 µg/ml when the transformants were cultivated. To
detect production of the fungal glycoside hydrolase activity by the
C. beijerinckii wild-type strain or the clones harboring pWUR3, pWUR4, or the cloning vector pMTL500E, colonies were grown on
agar plates supplemented with 0.2% (wt/vol) CMC. Subsequently, CMCase
activity was determined by staining CMC with Congo red (26). Around the colonies of C. beijerinckii
harboring pWUR3 or pWUR4 clear halos were visible, indicating that
degradation of CMC occurred. These halos were significantly larger than
the halos around colonies of the untransformed strain or the
transformant harboring pMTL500E (Fig. 2).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 2.
Endoglucanase activity plate assay with C.
beijerinckii NCIMB 8052 harboring pMTL500E, pWUR3
(celA), or pWUR4 (celD). Cells were grown
on agar plates supplemented with 0.2% (wt/vol) CMC for 48 h. CMC
was stained with Congo red, and hydrolysis of CMC is indicated by clear
halos around cells.
|
|
Enzymatic degradation of different polymeric substrates was determined
in both cell extracts and concentrated extracellular medium from
early-stationary-phase cultures of wild-type and recombinant C. beijerinckii grown on CBM with cellobiose or glucose as the carbon
source. We determined these activities after 24 h of growth because at this time all of the sugar had been utilized and because in
previous studies the highest levels of endoglucanase activity in
supernatants of solvent-producing clostridial cultures were found at
the end of the exponential growth phase or the early stationary phase
(1, 13). No significant differences in glycoside hydrolase
activity were found in cultures grown on cellobiose and cultures grown
on glucose (results not shown). In the wild-type strain or transformant
harboring pMTL500E, no hydrolytic activity with CMC was detectable, but
the transformants harboring pWUR3 (celA) or pWUR4
(celD) showed significant endoglucanase activity (Table
2). The CMCase activity was predominantly
(around 70% of the total activity) located in the culture supernatant
(data not shown). This indicates that the fungal cellulases were
produced in an active form and efficiently secreted into the medium.
The recombinant enzymes were not detectable on a sodium dodecyl
sulfate-polyacrylamide gel electrophoresis gel, even after silver
staining (results not shown).
Lichenase activity was found in all cultures of C. beijerinckii, independent of the presence of the plasmids that
were constructed. However, higher levels of activity were found in the
cultures of C. beijerinckii harboring the fungal cellulase
genes. CelA has higher lichenase activity than CelD (6,
29), and in agreement with this, C. beijerinckii
harboring pWUR3 showed the highest lichenase activity (Table 2).
The activities of the cultures producing the fungal enzymes were also
determined with laminarin, a polymer composed of
-1,3-linked glucose
residues. We tested this substrate because we expected that the
lichenase activity found in wild-type and recombinant cultures could be
due to hydrolysis of
-1,3 linkages in lichenan by clostridial
enzymes. We did not find laminarinase activity in cell extracts of
E. coli harboring pWUR3 or pWUR4. There was not a
significant difference in the laminarinase activities determined for
the wild-type and recombinant cultures (Table 2).
Substrate utilization by C. beijerinckii producing
fungal glycoside hydrolases.
Cultures of untransformed C. beijerinckii or cultures harboring pMTL500E, pWUR3, or pWUR4 were
grown in CBM containing glucose, cellobiose, lichenan, Avicel, or CMC
as the sole carbon source. In media containing glucose or cellobiose as
the carbon source the transformants grew as well as the wild type. None
of the strains grew in media containing CMC or Avicel. Also, cocultures
of C. beijerinckii harboring pWUR3 and C. beijerinckii harboring pWUR4 did not grow on these substrates.
Cultures were also grown in CBM containing 1% (wt/vol) CMC (high or
low viscosity) or 6% (wt/vol) Avicel supplemented with cellobiose
or glucose at a concentration of 1 or 0.1% (wt/vol). CMC and Avicel
were not utilized by any of the strains, even after extended incubation
(14 days). As expected, the growth and solvent production of these
cultures were comparable to those of cultures containing only the
sugars as carbon sources (results not shown).
In media containing lichenan, cultures of C. beijerinckii
harboring the celA or celD gene produced
significantly more solvents than the untransformed wild type or the
transformant harboring the pMTL500E vector produced (Fig.
3). C. beijerinckii harboring pWUR3 grown on lichenan produced an amount of solvents similar to the
amount produced by the wild-type strain grown on glucose at the
same concentration in CBM when a 1% (vol/vol) inoculum was used (4.9 and 5.4 g of solvents per liter, respectively). At the
concentration used in the media, lichenan was partially insoluble, and
after fermentation residual undegraded polymer remained in all of the
cultures except those of C. beijerinckii harboring pWUR3
(results not shown). This indicates that there was extensive
degradation of this polymer by the fungal cellulase CelA, which can be
explained by the high lichenase activity found in cultures of C. beijerinckii expressing the celA gene (Table 2).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 3.
Production of solvents by and growth of C.
beijerinckii NCIMB 8052 carrying no plasmid (×), pMTL500E
( ), pWUR4 ( ), or pWUR3 ( ) on CBM containing 20 g of
lichenan per liter as the sole carbon source. The 1% (vol/vol)
inoculum was obtained from an overnight preculture grown in the
presence of 1.5% (wt/vol) glucose. Because lichenan was insoluble and
cultures were very turbid, growth was estimated by measuring the
protein contents of cell extracts of culture samples. Solvents were
produced at acetone/butanol ratios between 1:2 and 1:3. Averages based
on two independent experiments are shown. The error bars indicate
standard deviations based on at least triplicate samples.
|
|
 |
DISCUSSION |
C. beijerinckii NCIMB 8052 belongs to the group of
well-known solventogenic clostridia, and its physiology and substrate
utilization range have been the subjects of a number of studies
(16). In this study we found that saccharification of
cellulose, growth, and solvent production take place simultaneously
when the medium is supplemented with fungal cellulolytic enzymes (Table
1). Remarkably, growth on CMC (either high or low viscosity) was not
observed even when the same cellulases were added to the medium at high concentrations (Table 1). Since the bacteria can grow in media containing CMC and supplemented with glucose or cellobiose, the presence of toxic impurities in this substrate can be ruled out as an
explanation for this observation. It seems likely that the carboxymethyl groups that are present in 7 of the 10 glucose residues in CMC confer a negative charge that could inhibit utilization of the
oligosaccharides generated by the bacteria.
Addition of fungal cellulases (Celluclast 1.5L) to a medium with
microcrystalline cellulose as the sole carbon source enabled C. beijerinckii to grow on this substrate (Table 1). Celluclast 1.5L
contains a mixture of different cellulases, including exo- and
endoglucanases, which act synergistically in degradation of sugar
polymers (4, 15).
For cloning of the N. patriciarum glycoside hydrolase genes
we used the promoter and signal sequences of the eglA gene
from C. saccharobutylicum NCP262 (31),
which appeared to be adequate to control expression of a cellulase
gene. This system has been used recently for cloning of another
heterologous gene in C. acetobutylicum (27);
the only difference was that the signal peptide sequence used was one
codon shorter. In this study we predicted a signal peptide with 38 amino acids (28) and showed that this is effective in directing the secretion of fungal cellulases. Although both CelD and
CelA were successfully produced and excreted into the extracellular
medium in an active form by C. beijerinckii NCIMB 8052 (Fig. 2 and Table 2), the transformant strains, alone or in
combination, failed to utilize Avicel or Sigmacell as a carbon source
under the conditions tested. While this finding could be attributed to
a number of things, one of the possible explanations is that the levels
of the fungal enzymes produced were too low to efficiently degrade
cellulose. Moreover, the degradation of cellulose is a complex reaction
in which many enzymes are involved, and it is likely that more than the
two new fungal glycoside hydrolases is necessary for efficient
hydrolysis of this substrate.
In contrast to the results obtained with other solventogenic clostridia
(13), no CMCase activity was found in liquid cultures of
C. beijerinckii NCIMB 8052 (Table 2) or in plate assays
(Fig. 2). The experiment was repeated with a new culture of strain
NCIMB 8052 received from the National Collections of Industrial, Food and Marine Bacteria, and the same results were obtained (data not
shown). Since CMC is a soluble derivative of cellulose that is
considered a typical substrate for endoglucanases, we concluded that
this strain does not produce endo-
-1,4-glucanase activity, which
contrasts with the conclusions of previous reports (12, 18). C. beijerinckii NCIMB 8052 showed
extracellular hydrolytic activity on lichenan (
-1,3/
-1,4
glucan) and laminarin (
-1,3 glucan), indicating that it
produces
-1,3-glucanases and lichenases. These enzymes, which have
been placed in family 16 of the glycoside hydrolases, are widely
distributed in bacteria (11). A number of lichenases (EC
3.2.1.73), endo-
-1,3-glucanases (EC 3.2.1.39), and
1,3(4)-
-glucanases (EC 3.2.1.6) have been characterized at the
genetic level in several Bacillus spp. and Clostridium thermocellum. In solventogenic clostridia these activities have not been studied in detail yet, and this is the first report of lichenase and laminarinase activities in C. beijerinckii
NCIMB 8052. During growth of wild-type or transformant strains on
lichenan, the acetone/butanol ratio in the media varied between 1:2 and 1:3, in contrast to the ratio found during growth on glucose
(1:4). The influence of substrate concentration on the
solvent ratio has been described previously (25).
Transformants harboring pWUR3 or pWUR4 showed increased extracellular
lichenase activity as a result of expression of either the
celA or celD gene. This increased activity
resulted in increased solvent production when lichenan was the
substrate (Fig. 3). Only the transformant carrying pWUR3 was able to
utilize lichenan completely, which resulted in clear media after
fermentation, whereas the turbidity did not disappear in cultures of
the other strains. This observation is in agreement with the fact
that in cell extracts of E. coli, fungal CelA exhibits
approximately fivefold-higher lichenase activity than CelD (6,
29). Remarkably, the solvent production by the pWUR3-harboring
transformant on lichenan was comparable to the solvent production
by the wild-type strain on glucose.
This is the first example of cloning of cellulase genes from a
eukaryotic organism into C. beijerinckii. The N. patriciarum celA and celD genes were functionally
expressed in C. beijerinckii NCIMB 8052, and the resulting
enzymes were exported to the medium. However, the recombinant strains
individually or in cocultures did not grow on microcrystalline
cellulose or CMC as a sole carbon source. It is likely that more
proteins are needed for efficient degradation of cellulose to support
growth. The C. beijerinckii strains producing the
fungal enzymes showed increased utilization of lichenan, a
polymer very similar to the mixed 1,3-/1,4-
-glucans that are part of
the cell walls of cereals such as barley, rice, and sorghum. In
conclusion, we show that cloning of fungal genes into
Clostridium strains can produce strains with a substrate utilization range different from that of the wild-type strain. This may
open possibilities for generating solventogenic strains that are able
to grow on polymeric substrates suitable for economically viable ABE fermentation.
 |
ACKNOWLEDGMENTS |
We thank J. Springer for technical assistance.
This work was supported in part by an EU Madam Curie fellowship (grant
FAIR-CT96-5047) to A. M. López-Contreras.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratory of
Microbiology, Hesselink van Suchtelenweg 4, 6703 CT Wageningen, The
Netherlands. Phone: 31 317 483 110. Fax: 31 317 483 829. E-mail:
ana.lopez-contreras{at}algemeen.micr.wau.nl.
 |
REFERENCES |
| 1.
|
Allcock, E. R., and D. R. Woods.
1981.
Carboxymethyl cellulase and cellobiase production by Clostridium acetobutylicum in an industrial fermentation medium.
Appl. Environ. Microbiol.
41:539-541[Abstract/Free Full Text].
|
| 2.
|
Breuil, C.,
M. Chan,
M. Gilbert, and J. N. Saddler.
1992.
Influence of -glucosidase on the filter paper activity and hydrolysis of lignocellulosic substrates.
Biores. Technol.
39:139-142[CrossRef].
|
| 3.
|
Claassen, P. A. M.,
J. B. van Lier,
A. M. López-Contreras,
E. W. J. van Niel,
L. Sijtsma,
A. J. M. Stams,
S. S. de Vries, and R. A. Weusthuis.
1999.
Utilisation of biomass for the supply of energy carriers.
Appl. Microbiol. Biotechnol.
52:741-755[CrossRef].
|
| 4.
|
Claeyssens, M., and G. Aerts.
1992.
Characterisation of cellulolytic activities in commercial Trichoderma reesei preparations: an approach using small chromogenic substrates.
Biores. Technol.
39:143-146[CrossRef].
|
| 5.
|
Coutinho, P. M., and B. Henrissat.
1999.
Carbohydrate-active enzymes: an integrated database approach, p. 3-12.
In
H. J. Gilbert, G. Davies, B. Henrissat, and B. Svensson (ed.), Recent advances in carbohydrate bioengineering. The Royal Society of Chemistry, Cambridge, United Kingdom.
|
| 6.
|
Denman, S.,
G.-P. Xue, and B. Patel.
1996.
Characterization of a Neocallimastix patriciarum cellulase cDNA (celA) homologous to Trichoderma reesei cellobiohydrolase II.
Appl. Environ. Microbiol.
62:1889-1896[Abstract].
|
| 7.
|
Dürre, P.
1998.
New insights and novel developments in clostridial acetone/butanol/isopropanol fermentation.
Appl. Microbiol. Biotechnol.
49:639-648[CrossRef][Medline].
|
| 8.
|
Foong, F.,
T. Hamamoto,
O. Osheyov, and R. H. Doi.
1991.
Nucleotide sequence and characteristics of endoglucanase gene engB from Clostridium cellulovorans.
J. Gen. Microbiol.
137:1729-1736[Medline].
|
| 9.
|
Ghose, T. K.
1987.
Measurement of cellulase activities.
Pure Appl. Chem.
59:257-268.
|
| 10.
|
Gosselink, R. J. A.,
J. E. G. van Dam, and F. H. A. Zomers.
1995.
Combined HPLC analysis of organic acids and furans formed during organosolv pulping of fiber hemp.
J. Wood Chem. Technol.
15:1-25.
|
| 11.
|
Gueguen, Y.,
W. Voorhorst,
J. van der Oost, and W. M. de Vos.
1997.
Molecular and biochemical characterization of an endo- -1,3-glucanase of the hyperthermophilic archeon Pyrococcus furiosus.
J. Biol. Chem.
50:31258-31264.
|
| 12.
|
Kim, A. Y.,
G. T. Attwood,
S. M. Holt,
B. A. White, and H. P. Blaschek.
1994.
Heterologous expression of endo- -1,4-D-glucanase from Clostridium cellulovorans in Clostridium acetobutylicum ATCC 824 following transformation of the engB gene.
Appl. Environ. Microbiol.
60:337-340[Abstract/Free Full Text].
|
| 13.
|
Lee, S. F.,
C. W. Forsberg, and L. N. Gibbins.
1985.
Cellulolytic activity of Clostridium acetobutylicum.
Appl. Environ. Microbiol.
50:220-228[Abstract/Free Full Text].
|
| 14.
|
Lopez-Contreras, A. M.,
P. A. M. Claassen,
A. Mooibroek, and W. M. de Vos.
2000.
Utilisation of saccharides in extruded domestic organic waste by Clostridium acetobutylicum ATCC 824 to produce acetone, butanol and ethanol.
Appl. Microbiol. Biotechnol.
54:162-167[CrossRef][Medline].
|
| 15.
|
Medve, J.,
J. Karlsson,
D. Lee, and F. Tjerneld.
1998.
Hydrolysis of microcrystalline cellulose by cellobiohydrolase I and endoglucanase II from Trichoderma reesei: adsorption, sugar production pattern, and synergism of the enzymes.
Biotechnol. Bioeng.
59:621-634[CrossRef][Medline].
|
| 16.
|
Mitchell, W. J.
1998.
Physiology of carbohydrate to solvent conversion by clostridia.
Adv. Microb. Physiol.
39:31-130[Medline].
|
| 17.
|
Mitchell, W. J.,
K. A. Albasheri, and M. Yazdanian.
1995.
Factors affecting utilization of carbohydrates by clostridia.
FEMS Rev.
17:317-319[CrossRef].
|
| 18.
|
Montoya, D.,
S. Espitia,
E. Silva, and W. H. Schwarz.
2000.
Isolation of mesophilic solvent-producing clostridia from Colombian sources: physiological characterization, solvent production and polysaccharide hydrolysis.
J. Biotechnol.
79:117-126[CrossRef][Medline].
|
| 19.
|
Nimcevic, D.,
M. Schuster, and J. R. Gapes.
1998.
Solvent production by Clostridium beijerinckii NRRL B592 growing on different potato media.
Appl. Microbiol. Biotechnol.
50:426-428[CrossRef][Medline].
|
| 20.
|
O'Brien, R. W., and J. G. Morris.
1971.
Oxygen and the growth and metabolism of Clostridium acetobutylicum.
J. Gen. Microbiol.
68:307-318[Medline].
|
| 21.
|
Oultram, J. D.,
M. Loughlin,
T.-J. Swinfield,
J. K. Brehm,
D. E. Thompson, and N. P. Minton.
1988.
Introduction of plasmids into whole cells of Clostridium acetobutylicum by electroporation.
FEMS Microbiol. Lett.
56:83-88[CrossRef].
|
| 22.
|
Pospiech, A., and B. Neumann.
1995.
A versatile quick-prep of genomic DNA from Gram-positive bacteria.
Trends Genet.
11:217-218[CrossRef][Medline].
|
| 23.
|
Reysset, G., and M. Sebald.
1993.
Transformation/electrotransformation of clostridia, p. 151-156.
In
D. R. Woods (ed.), The clostridia and bio/technology. Butterworth-Heinemann, Stoneham, Mass.
|
| 24.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 25.
|
Shaheen, R.,
M. Shirley, and D. T. Jones.
2000.
Comparative fermentation studies of industrial strains belonging to four species of solvent-producing clostridia.
J. Mol. Microbiol. Biotechnol.
2:115-124[Medline].
|
| 26.
|
Teather, R. M., and P. J. Wood.
1982.
Use of congo red-polysaccharide interactions in enumeration and characterization of cellulolytic bacteria from the bovine rumen.
Appl. Environ. Microbiol.
43:777-780[Abstract/Free Full Text].
|
| 27.
|
Theys, J.,
S. Nuyts,
W. Landuyt,
L. van Mellaert,
C. Dillen,
M. Böhringer,
P. Dürre,
P. Lambin, and J. Anné.
1999.
Stable Escherichia coli-Clostridium acetobutylicum shuttle vector for secretion of murine tumor necrosis factor alpha.
Appl. Environ. Microbiol.
65:4295-4300[Abstract/Free Full Text].
|
| 28.
|
Von Heijne, G.
1986.
A new method for predicting signal peptide cleavage sites.
Nucleic Acids Res.
14:4683-4690[Abstract/Free Full Text].
|
| 29.
|
Xue, G.-P.,
K. S. Gobius, and C. G. Orpin.
1992.
A novel polysaccharide hydrolase cDNA (celD) from Neocallimastix patriciarum encoding three multi-functional catalytic domains with high endoglucanase, cellobiohydrolase and xylanase activities.
J. Gen. Microbiol.
138:2397-2403[Medline].
|
| 30.
|
Xue, G.-P.,
C. G. Orpin,
K. S. Gobius,
J. H. Aylward, and G. D. Simpson.
1992.
Cloning and expression of multiple cellulase cDNAs from the anaerobic rumen fungus Neocallimatix patriciarum in Escherichia coli.
J. Gen. Microbiol.
138:1413-1420[Medline].
|
| 31.
|
Zappe, H.,
W. A. Jones,
D. T. Jones, and D. R. Woods.
1988.
Structure of an endo- -1,4-glucanase gene from Clostridium acetobutylicum P262 showing homology with endoglucanase genes from Bacillus spp.
Appl. Environ. Microbiol.
54:1289-1292[Abstract/Free Full Text].
|
Applied and Environmental Microbiology, November 2001, p. 5127-5133, Vol. 67, No. 11
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.11.5127-5133.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Mingardon, F., Chanal, A., Lopez-Contreras, A. M., Dray, C., Bayer, E. A., Fierobe, H.-P.
(2007). Incorporation of Fungal Cellulases in Bacterial Minicellulosomes Yields Viable, Synergistically Acting Cellulolytic Complexes. Appl. Environ. Microbiol.
73: 3822-3832
[Abstract]
[Full Text]
-
Lopez-Contreras, A. M., Gabor, K., Martens, A. A., Renckens, B. A. M., Claassen, P. A. M., van der Oost, J., de Vos, W. M.
(2004). Substrate-Induced Production and Secretion of Cellulases by Clostridium acetobutylicum. Appl. Environ. Microbiol.
70: 5238-5243
[Abstract]
[Full Text]
-
Perret, S., Casalot, L., Fierobe, H.-P., Tardif, C., Sabathe, F., Belaich, J.-P., Belaich, A.
(2004). Production of Heterologous and Chimeric Scaffoldins by Clostridium acetobutylicum ATCC 824. J. Bacteriol.
186: 253-257
[Abstract]
[Full Text]
-
Lopez-Contreras, A. M., Martens, A. A., Szijarto, N., Mooibroek, H., Claassen, P. A. M., van der Oost, J., de Vos, W. M.
(2003). Production by Clostridium acetobutylicum ATCC 824 of CelG, a Cellulosomal Glycoside Hydrolase Belonging to Family 9. Appl. Environ. Microbiol.
69: 869-877
[Abstract]
[Full Text]