Previous Article | Next Article 
Applied and Environmental Microbiology, February 2001, p. 791-798, Vol. 67, No. 2
Department of Microbiology, Oregon State University,
Corvallis, Oregon 97331-3804, and Western Dairy Center,
Utah State University, Logan, Utah
Received 18 May 2000/Accepted 20 October 2000
An unusual, spontaneous, phage sk1-resistant mutant (RMSK1/1) of
Lactococcus lactis C2 apparently blocks phage DNA entry
into the host. Although no visible plaques formed on RMSK1/1, this host
propagated phage at a reduced efficiency. This was evident from
center-of-infection experiments, which showed that 21% of infected
RMSK1/1 formed plaques when plated on its phage-sensitive parental
strain, C2. Moreover, viable cell counts 0 and 4 h after infection
were not significantly different from those of an uninfected culture.
Further characterization showed that phage adsorption was normal, but
burst size was reduced fivefold and the latent period was increased
from 28.5 to 36 min. RMSK1/1 was resistant to other, but not all,
similar phages. Phage sensitivity was restored to RMSK1/1 by
transformation with a cloned DNA fragment from a genomic library of a
phage-sensitive strain. Characterization of the DNA that restored phage
sensitivity revealed an open reading frame with similarity to sequences
encoding lysozymes ( Bacteriophage infection of lactic
acid-producing starter cultures is the most persistent problem in
manufacturing fermented milk products. Although naturally occurring
bacteriophage resistance mechanisms have been applied successfully in
the development of new bacteriophage-resistant starter cultures, novel
bacteriophages have arisen that overcome these resistances
(49). Starter strains bearing latent prophage may serve as
a source of genes in the continuous evolution of bacteriophages
(7, 24, 60) and their hosts.
To expand the range of possibilities for development of phage-resistant
starter strains, we continue to identify host genes that affect phage
replication. These genes are a potential source of novel phage
resistance. A prototypical example is pip, a gene carried by
many strains of Lactococcus lactis (4, 43),
which encodes a cell surface protein required for infection by phages of the c2 species (34). Strains of L. lactis
have been developed with site-specific mutations in pip that
render the resultant strain completely resistant to phages of the c2
species (30, 43).
Bacteriophages of the 936 species (38) are the most
frequently problematic phage in buttermilk and cheddar cheese plants (10, 48). Phage sk1 is a small, isometric bacteriophage of the 936 species (38) that infects several strains of
L. lactis, a bacterium used in culturing cheddar cheese,
sour cream, and buttermilk. The entire genome of phage sk1 has been
sequenced (11). Previously, phage sk1-resistant mutants of
L. lactis C2 that have cell wall compositions
indistinguishable from that of L. lactis C2 and that adsorb
phage sk1 particles normally were isolated (55). In this
study, one of these phage sk1-resistant strains, RMSK1/1, was restored
to a phage-sensitive phenotype by transformation with a library of
L. lactis genomic DNA. An analysis of the cloned DNA
revealed similarities to specific regions of other lactococcal phages,
which suggests a mechanism for suppressing phage resistance in RMSK1/1.
Bacterial strains, phages, media, and growth conditions.
Lactococcus lactis subsp. lactis strain C2, its
phage sk1-resistant derivative, RMSK1/1 (55), plasmid-free
derivatives LM2301 and LM0230 (61), and MM210 (Table
1) were propagated in M17 (53) supplemented with 0.5% glucose (M17G) at 30°C.
Where necessary, erythromycin was added at 5 µg/ml (E5). Calcium
chloride was added at 10 mM in M17G medium (M17GC) for propagation of
lactococcal phages. Phages sk1 and 64 are phages of the 936 species
from the collection of T. Klaenhammer (North Carolina State
University). Phages p2, 712, and jj50 are phages of the 936 species
from the collection of S. Moineau (Université Laval) (25,
39). Escherichia coli strains DH5
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.2.791-798.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Cloning of Genomic DNA of Lactococcus
lactis That Restores Phage Sensitivity to an Unusual Bacteriophage
sk1-Resistant Mutant
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-1,4-N-acetylmuramidase) and lysins
from various bacteria, a fungus, and phages of
Lactobacillus and Streptococcus and also
revealed DNA homologous to noncoding sequences of temperate phage of
L. lactis, DNA similar to a region of phage sk1, a gene
with similarity to tRNA genes, a prophage attachment site, and open
reading frames with similarities to sun and to sequences
encoding phosphoprotein phosphatases and protein kinases. Mutational
analyses of the cloned DNA showed that the region of homology with
lactococcal temperate phage was responsible for restoring the
phage-sensitive phenotype. The region of homology with DNA of
lactococcal temperate phage was similar to DNA from a previously
characterized lactococcal phage that suppresses an abortive infection
mechanism of phage resistance. The region of homology with lactococcal
temperate phage was deleted from a phage-sensitive strain, but the
strain was not phage resistant. The results suggest that the cloned DNA
with homology to lactococcal temperate phage was not mutated in the
phage-resistant strain. The cloned DNA apparently suppressed the
mechanism of resistance, and it may do so by mimicking a region of
phage DNA that interacts with components of the resistance mechanism.
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
and HB101 were
grown in Luria-Bertani broth at 37°C with shaking or in Luria-Bertani
broth supplemented with 1.5% agar and, when required, ampicillin at
100 µg/ml, chloramphenicol at 50 µg/ml, or tetracycline at 20 µg/ml.
TABLE 1.
Strains and plasmids
DNA manipulations.
Restriction endonuclease digestion,
agarose gel electrophoresis, and DNA ligation were done by standard
procedures described by Sambrook et al. (52), according to
the recommendations of the enzyme suppliers (New England Biolabs,
Beverly, Mass.). Ligation products were transformed into competent
cells of E. coli DH5 (Gibco-BRL, Gaithersburg, Md.).
Plasmids were isolated from E. coli with Qiagen (Chatsworth,
Calif.) kits. Plasmids were isolated from L. lactis with
Qiagen miniprep kits after the pelleted cells had been treated with 30 mg of lysozyme per ml for 30 min at 30°C.
Genomic library construction, transformation, and screening of
transformants.
Partially MboI-digested LM2301 DNA was
ligated to BamHI-digested pSA3 (17) as
described previously (34). Ligation products were
transformed into MAX efficiency-competent cells of E. coli DH5 (Gibco-BRL, Rockville, Md.). Plasmid DNA was purified from pooled chloramphenicol-resistant, tetracycline-sensitive colonies to
form the LM2301 library. The library was transferred by electroporation of RMSK1/1 as described previously (37). RMSK1/1 colonies
carrying library plasmids were screened for phage sk1 sensitivity by
patching colonies to M17GCE5 plates and M17GCE5 plates spread (using a sterile glass rod) with 107 PFU of phage sk1. Plasmids were
isolated from phage sk1-sensitive isolates and transformed into
E. coli DH5 for characterization. Plasmids were
transferred by electroporation back into RMSK1/1 and tested for phage
sk1 sensitivity. One of two genomic fragments that restored phage
sensitivity to RMSK1/1 was named p17. Subclones were constructed in
pSA3 by standard methods (52) and electroporated into
RMSK1/1. Transformants were evaluated for phage sk1 sensitivity.
Phage sensitivity assay. Strains were cultured overnight in M17GE5 broth. Lawns were prepared with 0.1 ml of culture and 3 ml of M17G top agar (0.4% agar) either with or without 30 µl of 1 M CaCl2 (final concentration of 10 mM in the top agar). One-microliter portions of serial 10-fold dilutions of stocks of phages sk1, p2, 64, 712, and jj50 were spotted onto the lawns.
DNA sequence analysis. Subclones of the original plasmids were constructed for sequencing as follows. The pGB305 portion of pSA3 was deleted from the library plasmids by digestion with AvaI followed by transformation of E. coli to select for recircularized plasmids bearing the insert DNA and pACYC184 as a vector. HindIII and EcoRI fragments from the pACYC184 subclones were shotgun cloned into pUC19. The pACYC184 and pUC19 subclones were sequenced with fluorescent dideoxy termination chemistry on an ABI 377 automated DNA sequencer (Applied Biosystems Incorporated, Foster City, Calif.) at the Center for Gene Research and Biotechnology at Oregon State University, Corvallis, Oreg. Primers included pUC universal primers, tetracycline resistance gene primers (5' TACTTGGAGCCACTATCGACTACGCGATCA 3' and 5' ATGCGTCCGGCGTAGA 3'), and primers designed from previous sequence determinations. Primers were synthesized at the Center for Gene Research and Biotechnology on an ABI 380B DNA synthesizer using phosphoramidite chemistry (2). Sequences were assembled with Staden software (19) and analyzed with the Genetics Computer Group package (20). Similarity searches were done with the BLAST (basic local alignment search tool) programs (1) at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/BLAST).
Construction of site-directed mutants.
The region of p17
downstream of the XbaI site was deleted by cutting p17 with
XbaI. The large XbaI fragment was isolated from an agarose gel, ligated, and transformed into E. coli,
forming p17
XbaI.
XbaI created
p17XbaIAvaI, which has a single
HindIII site internal to the lysL gene.
p17XbaIAvaI was digested with
HindIII, treated with Klenow fragment (Gibco-BRL) in the
presence of all four deoxynucleoside triphosphates, and then ligated.
This created a frameshift mutation and an NheI site at the
former HindIII site. The XbaI-SalI
fragment (the SalI site is in the vector pACYC184)
containing the lysL-nhe allele was then cloned into pGhost6
(6), an allele replacement vector with
temperature-sensitive replication. L. lactis strain LM2301
was transformed by electroporation with the pGhost-lysL-nhe plasmid. Homologous integration of pGhost-lysL-nhe was
selected by shifting cultures to 37°C while maintaining selection for
the erythromycin resistance encoded by pGhost6. The integrated vector subsequently was excised by growing integrants without erythromycin at
30°C. Temperature-shifted colonies were screened for erythromycin sensitivity and the presence of the lysL-nhe allele by PCR
with primers 5' TTAAAACTGTTAAAGAGGTT 3' and 5'
TACTATATTATTCATACCTTGCT 3'.
To delete nucleotides 818 to 2049, p17AvaI was digested
with AflIII and SwaI, treated with Klenow
fragment (Gibco-BRL) in the presence of all four deoxynucleoside
triphosphates, purified from a gel, ligated, and then transformed into
DH5. The XbaI-SalI fragment containing the
p17(Afl-Swa) allele was cloned into pGhost6 and used to
replace the wild-type allele as described above. The presence of the
(Afl-Swa) allele was detected by analytical PCR using
primer pair 5' GGCCACAGAGGGAACTAACTATATA 3' and 5'
CTGCAGCACATATCTTGGTTATTA 3' (Pacific Oligos, Lismore, Australia).
Growth and cell viability.
An exponential-phase culture
(optical density at 600 nm [OD600] 
0.1) of RMSK1/1 or
C2 in M17G-10 mM CaCl2 was infected with 3 × 108 PFU of phage sk1 (MOI 10) and incubated at either
20 or 30°C. Identical cultures were prepared without phage. The
OD600 was measured at approximately 30- or 60-min intervals
for 4.5 to 6 h. Samples of RMSK1/1 were taken immediately and 2 to
4 h after addition of phage to the infected culture. The samples
were diluted and plated in triplicate on M17G plates. The number of
viable cells was determined by counting the colonies on the plates
after an overnight incubation at 30°C. The numbers of viable cells
are expressed as averages of two separate experiments ± standard
deviations (SD). Growth rates were calculated using linear regression
over the interval from 0 to 240 min after addition of phage. Each curve is an average of two separate experiments (see Fig. 1).
Adsorption of phage to plasma membranes in vitro. Plasma membranes were prepared from L. lactis (50) and E. coli (40) as described earlier. Phage adsorption to membranes was measured in vitro as follows. Membranes (2 µg) (as measured by phospholipid) were mixed with approximately 2.5 × 102 PFU in 25 µl of 25 mM bis-Tris (pH 6.8) and incubated at 0°C for 1 to 2 h. Duplicate 10-µl aliquots were removed and the titers were determined (53) on strain LM2301 or LM0230. The amount of inactivation was calculated by subtracting the average titer of a reaction mixture with membranes from the average titer of a control reaction mixture without membranes, dividing by the latter, subtracting from 1.00, and multiplying by 100.
Center-of-infection experiments.
Overnight cultures of C2
and RMSK1/1 were diluted 2 × 10
2 in M17G and grown
to an OD600 of approximately 0.1. An aliquot of each
culture was diluted and plated in duplicate on M17GC plates for viable
cell counts. Calcium was added to a final concentration of 10 mM and
phage sk1 was added to an MOI of 3.6 × 103. A
no-cell control was included by substituting M17G for bacteria and
treating it the same as the infected cultures. The infected cultures
were incubated at 30°C for 10 min and immediately diluted 101 into ice-cold M17G. Half of each diluted and cooled
culture was centrifuged at 12,000 × g for 3 min at 4°C,
and the supernatant was removed. The titers of samples were determined
in duplicate on M17GC top agar and plates using either strain C2 or
C2(pSA3) as the indicator. Erythromycin (5 µg/ml) was included in the
top agar and plates when C2(pSA3) was used as the indicator.
One-step growth experiment.
Cultures were prepared as
described above for center-of-infection experiments, except incubation
at 30°C was continued for 120 min and aliquots were taken every 10 min and diluted 102. Strain C2 was used as the indicator
for the plaque assay.
Electroporation with phage DNA. DNA was isolated from phage sk1 and phage c2 as described previously (60), except that no DNase or RNase was added. Phage DNA and pSA3 DNA was electroporated into strains LM2301, C2, RMSK1/1, and MM210 as described previously (37). After 1.5 h in the recovery medium, those electroporated with phage DNA were centrifuged and titers of the supernatants were determined on LM2301. Those electroporated with pSA3 were diluted and plated on M17GE5. PFU or CFU per milliliter of recovery media were calculated.
Testing cloned DNA for replication-origin activity.
The
1.3-kb HindIII-XbaI fragment of
p17XbaI was subcloned into pSA3HindIII.
pSA3HindIII lacks the origin of replication of pSA3
(associated with gram-positive organisms) and was constructed by
digesting pSA3 with HindIII, removing the small
HindIII fragment, and ligating the large
HindIII fragment. The ligation reaction product was
transformed into E. coli DH5 and selected on
chloramphenicol. L. lactis LM2301 was electroporated with
pSA3HindIII, pSA3HindIII containing
the 1.3-kb HindIII-XbaI fragment, and pSA3.
The electroporation frequencies were compared.
Nucleotide sequence accession numbers. The EMBL data library accession numbers for gene sequences determined in this study are AJ132604 and LLA132604.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Characterization of phage sk1-resistant strain RMSK1/1. No plaques were detected on RMSK1/1 with 936 species phage sk1, p2, jj50, or 64. However, RMSK1/1 was fully sensitive (efficiency of plating [EOP] = 1) to another 936 species phage, phage 712.
Although no plaques of phage sk1 were visible on RMSK1/1, when transformed with the cloning vector pSA3, the transformant RMSK1/1(pSA3) formed tiny (0.1-mm) plaques with an EOP of 0.1 at 20°C but formed no plaques at 30°C. Plaques of phage sk1 formed at 20°C on RMSK1/1(pSA3) were harvested. When the phage was plated on RMSK1/1, no plaques formed. When it was plated on RMSK1/1(pSA3) at 20°C, the plaques were again much smaller than those formed on strain C2 (the parental strain of RMSK1/1), and the EOP was approximately 0.1. The growth rate at 30°C and viable cell count of RMSK1/1 infected with phage sk1 at an MOI of 10 were not significantly different from those of an uninfected culture (Fig. 1). The growth rates (means ± SD, n = 2) were 0.75 ± 0.02 h and 0.77 ± 0.03 h for infected and uninfected cultures, respectively. The numbers (means ± SD, n = 2) of viable cells from infected and uninfected cultures at time zero were 1.14 × 107 ± 0.046 × 107 CFU/ml and 1.06 × 107 ± 0.23 × 107 CFU/ml, respectively. Two hours after infection the numbers of viable cells in the infected and uninfected cultures were 1.04 × 108 ± 0.14 × 108 CFU/ml and 1.10 × 108 ± 0.25 × 108 CFU/ml, respectively.
|
) at time zero with phage sk1 at an MOI of 30 and the other half
was left uninfected (
). A culture of strain C2 was prepared in an
identical manner (
, infected; ×, uninfected). Growth at 30°C was
monitored by spectroscopy at 600 nm for 270 min. Each point is the mean
of two separate experiments. The error bars indicate SD.
|
Restoration of phage sk1 sensitivity to RMSK1/1.
RMSK1/1 was
transformed with a library of wild-type chromosomal DNA and screened
for restoration of phage sk1 sensitivity at 30°C. Despite the partial
restoration of phage sensitivity at 20°C by the cloning vector pSA3
alone, two library transformants were clearly more phage sensitive than
the control transformant RMSK1/1(pSA3) at 30°C. The two library
transformants contained overlapping regions of DNA cloned in opposite
orientations on the vector. One of the cloned fragments (named p17) is
depicted in Fig. 2a. Although the cloned
DNA restored the EOP to 1.0, the plaque diameter (~0.5 mm) was about
half of that formed on strain C2 or LM2301. Phage eluted from these
small plaques produced larger plaques on strain C2 or LM2301 and no
plaques on RMSK1/1.
|
XbaI) that contained the
lysozyme gene and the contiguous downstream 736 bp restored sensitivity
of RMSK1/1 to phages sk1, p2, jj50, and 64 (Fig. 2c), although the
plaque size was about half of that formed on strain C2.
Analysis of lysL.
The only ORF in subclone
p17XbaI was designated lysL. Proteins most
similar to LysL were lysozymes (-1,4-N-acetylmuramidase) of Chalaropsis spp. (31% identical and 44% similar
[26]), Clostridium acetobutylicum (26%
identical and 45% similar [15]), and
Streptomyces globisporus (27% identical and 43% similar
[45]) and lysins of virulent phage LL-H of
Lactobacillus delbrueckii subsp. lactis (27%
identical and 44% similar [47]), of lytic phages
Cp-1 and Cp-9 of Streptococcus pneumoniae (30 and 28%
identical and 45 and 43% similar, respectively [31,
32]), and of temperate phages mv4 of L. delbrueckii subsp. lactis (27% identical and 43%
similar [58]) and adh of Lactobacillus
gasseri (27% identical and 42% similar
[36]) (Fig. 3).
|
35 region) and 225 through 230 (10 region). A potential ribosome-binding site
(21) was identified at nucleotides 447 through 455. A
region of imperfect dyad symmetry, which might serve as a
rho-independent transcriptional terminator, was identified downstream
of lysL at nucleotides 1322 through 1332 and 1337 through 1347.
A frameshift allele (lysL-nhe) was constructed and
transformed into RMSK1/1. p17XbaI containing either the
mutated lysL-nhe allele or wild-type lysL
restored phage sk1 sensitivity to RMSK1/1. The mutated allele was used
to replace the wild-type lysL allele in L. lactis
LM2301. The resultant lysL mutant was fully sensitive to
phage sk1.
Analysis of the lysL-sunL intergenic region.
Starting 309 bp distal to lysL was DNA similar to that of
temperate lactococcal bacteriophage of the P335 species (Fig. 2d), including BK5-T (8), rlt (57), lc3
(46), and Tuc2009 (3). These regions of the
phage genomes contain sequences involved in transcription termination
and homologous recombination and are from 173 to 197 bp distal to the
respective lysin genes. An alignment of these similar nucleotide
sequences revealed a 266-bp stretch of DNA that interrupts the region
of similarity in L. lactis (Fig.
4). The 266-bp intervening sequence is
bordered by a set of inverted repeats and contains another set in the
exact middle of the sequence.
|
XbaI was constructed that spanned
nucleotides 818 to 2049 and is termed p17Afl-Swa. This
deletion construct did not restore phage sensitivity to RMSK1/1 in
trans. Furthermore, the same region was deleted from the
chromosome of LM2301 and did not confer resistance to phage sk1.
To detect the potential origin of replication function, nucleotides 609 to 1903 were cloned into a plasmid (pSA3HindIII) that
lacked an origin of replication associated with gram-positive organisms
but included a selectable marker in L. lactis. No
transformant of strain C2 or RMSK1/1 could be isolated, although the
same amount of control plasmid (pSA3) produced between 50 and 4.5 × 103 transformants/ml.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
This study shows that the resistance of strain RMSK1/1 to infection by phage sk1 is caused by a blockage of phage DNA entry into the host. This conclusion is supported by evidence that the resistance is not due to lack of adsorption to either the cell wall or plasma membrane (55) (Table 2). The lack of inhibition of adsorption by rhamnose shows that there was no binding to the cell wall in the membrane preparation. Specificity of adsorption of phage sk1 to lactococcal membranes was shown by the lack of adsorption to membranes from E. coli. The inactivation of phage sk1 shows that adsorption to membranes in vitro was irreversible and that the phage had committed the final step leading to ejection of its DNA from the capsid (5). Circumventing by electroporation the blocked entry of phage DNA shows that steps of phage propagation subsequent to entry into the host cytoplasm are normal. Additionally, the lack of cell death upon infection (Fig. 1) eliminates a classical abortive infection mechanism (22, 33). At an MOI of 10, all cells were infected, but only about 21% of them lysed, as indicated by the efficiency of the center-of-infection assay. Moreover, the restriction and/or modification mechanism cannot account for the results (22), because plaques that formed on RMSK1/1(pSA3) did not plaque with an EOP of 1, nor did they form plaques on RMSK1/1. Of the four known mechanisms of resistance in L. lactis (27, 33, 42), only blockage of phage DNA entry is consistent with our results.
The normal growth rate and cell viability of phage sk1-infected cultures of RMSK1/1 (Fig. 1) were somewhat surprising, considering that RMSK1/1 can replicate phage, as indicated by results from both electroporation and the center-of-infection experiments. The absence of centers of infection on the indicator strain C2(pSA3) showed that centers which formed on indicator strain C2 resulted not from a reversible dissociation of phage from the surface of RMSK1/1 but instead from infection and replication of phage sk1 in RMSK1/1.
An explanation for this is that the reduced frequency of infection of RMSK1/1 coupled to the reduced burst size and increased latent period results in arithmetic instead of exponential increase in phage titer. As exponential cell growth occurs, the proportion of infected cells decreases, making it difficult to detect small changes in cell numbers by optical density or viable cell count.
The resistance of RMSK1/1 to four of five 936 species phages shows that many, but not all, 936 species phage are inhibited by the mechanism of resistance in RMSK1/1. We speculate that the genome of phage 712 differs from that of the other phages in a region that may be a target for blocking phage DNA entry into the host. Alternatively, phage 712 may have an inherently larger burst size and shorter latent period.
The phage sk1 resistance of strain RMSK1/1 was suppressed in three ways. First, reducing the growth temperature to 20 from 30°C may have inactivated a cold-sensitive host component associated with the mechanism of resistance. Alternatively, it may have had an indirect effect via a temperature-induced change in cell wall or membrane structure or via reduced growth rate or metabolism. RMSK1/1 was also rendered partially phage sk1 sensitive by the plasmid pSA3. This effect could have been caused indirectly by a reduced growth rate or metabolism. Recent results indicate that RMSK1/1 is resistant to phage sk1 at 20°C in growth media other than M17G (B. Geller, unpublished results). This suggests that the mechanism of resistance is not cold sensitive.
The third means of suppression of phage sk1 resistance of RMSK1/1 was the introduction of a region of genomic DNA of L. lactis LM2301. The region responsible for suppression was subcloned and found to contain a gene with similarity to lysozymes plus the contiguous downstream 736 bp of noncoding DNA with similarity to temperate phage of L. lactis.
The predicted LysL protein was similar to lysins of virulent phage LL-H of L. delbrueckii subsp. lactis (47), of lytic phages Cp-1 and Cp-9 of S. pneumoniae (31, 32), and of temperate phages mv4 of L. delbrueckii subsp. lactis (58) and adh of L. gasseri (36). lysL is distinct from acmA (9) and lysA (44), genes encoding autolytic lysozymes in L. lactis strains MG1363 and AM2, respectively. lysL is also distinct from the lysin gene of phage sk1 (11). Although the involvement of host lysozymes in phage release is not without precedent (51), disruption of the lysL gene did not affect phage sk1 sensitivity. LysL is not involved in the mechanism of phage sk1 resistance in RMSK1/1 or in the restoration of sensitivity by the cloned DNA.
The DNA distal to lysL contained noncoding DNA with similarity to DNA distal to lysin genes of temperate lactococcal bacteriophage of the P335 species. In these phage, this region contains terminator sequences and sequences involved in homologous recombination. An alignment of these similar nucleotide sequences revealed a 266-bp stretch of DNA that disrupts the region of similarity and contains two sets of inverted repeats. The symmetry of the inverted repeats in the 266-bp stretch suggests a possible insertion sequence or antitermination machinery.
The similarity of lysL with lysin genes of Lactobacillus and Streptococcus and the similarities of downstream regions with temperate lactococcal phage of the P335 species suggest that this may be the site of previous prophage integration. Lysogeny is the rule rather than the exception for lactococcal strains (16, 18, 54). Indeed, strain C2, the parent of strains RMSK1/1, LM0230, and LM2301, harbors a prophage that produces a small, isometric virion upon induction with UV light (54). The sequences upstream of lysL are not similar to upstream sequences of phage lysin genes, and the regulatory sequences present in lytic and temperate phages of L. lactis (60) were not present in the 5,832 bp sequenced. These differences suggest that this is not a functional prophage but rather a region that had been the site of previous prophage integration activity.
The DNA distal to lysL was responsible for the suppression of the phage sk1 resistance of RMSK1/1. This is evident from the fact that deletion of this region from the cloned plasmid eliminated suppression of phage sk1 resistance in RMSK1/1. Both orientations of the cloned DNA in the cloning vector restored phage sensitivity. This suggests that transcription of the DNA that restored phage sensitivity from a promoter in the vector is not required.
Deletion of the region distal to lysL from the chromosome of LM0230 did not cause phage sk1 resistance. This shows that a deletion in this region of the chromosome is not the cause of phage sk1 resistance in RMSK1/1.
The mechanism by which this noncoding DNA restores phage sk1 sensitivity is unknown. However, the characteristics of this cloned region are similar to those of a region of phage 31 DNA that is involved in its sensitivity to an abortive infection mechanism, AbiA (23). Both regions lack ORFs, contain two sets of inverted repeats, and eliminate phage resistance when cloned in trans. Experimental data suggest that the phage 31 region does not bind directly to AbiA but may require a phage-specific factor for its inhibitory effect. When introduced on a multicopy plasmid, the cloned DNA may exert its effect by mimicking part of the phage genome and adsorbing a protein or RNA that blocks phage propagation. Perhaps in phage-sensitive strains a single, chromosomal copy of the cloned DNA would be insufficient to remove enough of the putative injection-blocking component to cause phage resistance. In any case, the identification of an endogenous DNA sequence that suppresses the phage resistance of RMSK1/1 will be useful in elucidating the molecular details of the mechanism of phage resistance.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported in part by grants from the U.S. Department of Agriculture, Dairy Management, Inc., and the Western Dairy Center.
We thank Sylvain Moineau (Université Laval) for phages p2, 712, and jj50 and Chun-Qiang Liu (University of New South Wales) for critically reading the manuscript.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, Nash Hall 220, Oregon State University, Corvallis, OR 97331-3804. Phone: (541) 737-1845. Fax: (541) 737-0496. E-mail: gellerb{at}orst.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402 |
| 2. | Alvarado-Urbina, G., R. Chiarello, E. Roberts, G. Vilain, F. Jurik, L. Christensen, C. Carmona, L. Fang, M. Watterson, and R. Crea. 1986. Rapid automated synthesis via diisopropyl phosphoramidite in situ activation. Chemical synthesis and cloning of a calmodulin gene. Biochem. Cell Biol. 64:548-555[Medline]. |
| 3. |
Arendt, E. K.,
C. Daly,
G. F. Fitzgerald, and M. van de Guchte.
1994.
Molecular characterization of lactococcal bacteriophage Tuc2009 and identification and analysis of genes encoding lysin, a putative holin, and two structural proteins.
Appl. Environ. Microbiol.
60:1875-1883 |
| 4. | Babu, K. S., W. S. Spence, M. M. Monteville, and B. L. Geller. 1995. Characterization of a cloned gene (pip) from Lactococcus lactis required for phage infection. Dev. Biol. Stand. 85:569-575[Medline]. |
| 5. | Beumer, J., E. Hannecart-Pokorni, and C. Godard. 1984. Bacteriophage receptors. Bull. Inst. Pasteur 82:173-253. |
| 6. |
Biswas, I.,
A. Gruss,
S. D. Ehrlich, and E. Maguin.
1993.
High-efficiency gene inactivation and replacement for gram-positive bacteria.
J. Bacteriol.
175:3628-3635 |
| 7. | Bouchard, J. D., and S. Moineau. 2000. Homologous recombination between a lactococcal bacteriophage and the chromosome of its host strain. Virology 270:65-75[CrossRef][Medline]. |
| 8. | Boyce, J. D., B. E. Davidson, and A. J. Hillier. 1995. Sequence analysis of the Lactococcus lactis temperate bacteriophage BK5-T and demonstration that the phage DNA has cohesive ends. Appl. Environ. Microbiol. 61:4089-4098[Abstract]. |
| 9. |
Buist, G.,
J. Kok,
K. J. Leenhouts,
M. Dabrowska,
G. Venema, and A. J. Haandrikman.
1995.
Molecular cloning and nucleotide sequence of the gene encoding the major peptidoglycan hydrolase of Lactococcus lactis, a muramidase needed for cell separation.
J. Bacteriol.
177:1554-1563 |
| 10. | Casey, C. N., E. Morgan, C. Daly, and G. F. Fitzgerald. 1993. Characterization and classification of virulent lactococcal bacteriophages isolated from a cheddar cheese plant. J. Appl. Bacteriol. 74:268-275. |
| 11. | Chandry, P. S., S. C. Moore, J. D. Boyce, B. E. Davidson, and A. J. Hillier. 1997. Analysis of the DNA sequence, gene expression, origin of replication and modular structure of the Lactococcus lactis lytic bacteriophage sk1. Mol. Microbiol. 26:49-64[CrossRef][Medline]. |
| 12. |
Christiansen, B.,
M. G. Johnsen,
E. Stenby,
F. K. Vogensen, and K. Hammer.
1994.
Characterization of the lactococcal temperate phage TP901-1 and its site-specific integration.
J. Bacteriol.
176:1069-1076 |
| 13. | Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V. Gordon, K. Eiglmeier, S. Gas, C. E. Barry III, F. Tekaia, K. Badcock, D. Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin, S. Holroyd, T. Hornsby, K. Jagels, A. Krogh, J. McLean, S. Moule, L. Murphy, S. Oliver, J. Osborne, M. A. Quail, M. A. Rajandream, J. Rogers, S. Rutter, K. Seeger, S. Skelton, S. Squares, R. Sqares, J. E. Sulston, K. Taylor, S. Whitehead, and B. G. Barrell. 1998. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393:537-544[CrossRef][Medline]. |
| 14. |
Croux, C.,
B. Canard,
G. Goma, and P. Soucaille.
1992.
Purification and characterization of an extracellular muramidase of Clostridium acetobutylicum ATCC 824 that acts on non-N-acetylated peptidoglycan.
Appl. Environ. Microbiol.
58:1075-1081 |
| 15. | Croux, C., and J. L. García. 1991. Sequence of the lyc gene encoding the autolytic lysozyme of Clostridium acetobutylicum ATCC824: comparison with other lytic enzymes. Gene 104:25-31[CrossRef][Medline]. |
| 16. | Cuesta, P., J. E. Suarez, and A. Rodriguez. 1995. Incidence of lysogeny in wild lactococcal strains. J. Dairy Sci. 78:998-1003[Abstract]. |
| 17. |
Dao, M. L., and J. J. Ferretti.
1985.
Streptococcus-Escherichia coli shuttle vector pSA3 and its use in the cloning of streptococcal genes.
Appl. Environ. Microbiol.
49:115-119 |
| 18. | Davidson, B. E., I. B. Powell, and A. J. Hillier. 1990. Temperate bacteriophages and lysogeny in lactic acid bacteria. FEMS Microbiol. Rev. 87:79-90[CrossRef]. |
| 19. |
Dear, S., and R. Staden.
1991.
A sequence assembly and editing program for efficient management of large projects.
Nucleic Acids Res.
19:3907-3911 |
| 20. | Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395. |
| 21. | de Vos, W. M., and G. F. M. Simons. 1994. Gene cloning and expression systems in lactococci. In M. J. Gasson, and W. M. de Vos (ed.), Genetics and biotechnology of lactic acid bacteria. Blackie Academic & Professional, Glasgow, United Kingdom. |
| 22. | Dinsmore, P. K., and T. R. Klaenhammer. 1995. Bacteriophage resistance in Lactococcus. Mol. Biotechnol. 4:297-314[Medline]. |
| 23. |
Dinsmore, P. K., and T. R. Klaenhammer.
1997.
Molecular characterization of a genomic region in a Lactococcus bacteriophage that is involved in its sensitivity to the phage defense mechanism AbiA.
J. Bacteriol.
179:2949-2957 |
| 24. |
Durmaz, E., and T. R. Klaenhammer.
2000.
Genetic analysis of chromosomal regions of Lactococcus lactis acquired by recombinant lytic phages.
Appl. Environ. Microbiol.
66:895-903 |
| 25. | Emond, E., B. J. Holler, I. Boucher, P. A. Vandenbergh, E. R. Vedamuthu, J. K. Kondo, and S. Moineau. 1997. Phenotypic and genetic characterization of the bacteriophage abortive infection mechanism AbiK from Lactococcus lactis. Appl. Environ. Microbiol. 63:1274-1283[Abstract]. |
| 26. |
Felch, J. W.,
T. Inagami, and J. H. Hash.
1975.
The N,O-diacetylmuramidase of Chalaropsis species.
J. Biol. Chem.
250:3713-3720 |
| 27. | Forde, A., and G. F. Fitzgerald. 1999. Bacteriophage defence systems in lactic acid bacteria, p. 89-113. In W. N. Konings, O. P. Kuipers, and J. H. J. Juis in't Veld (ed.), Lactic acid bacteria: genetics, metabolism and applications. Kluwer Academic Publishers, Dordrecht, The Netherlands. |
| 28. | Fouche, P. B., and J. H. Hash. 1978. The N,O-diacetylmuramidases of Chalaropsis species. Identification of aspartyl and glutamyl residues in the active site. J. Biol. Chem. 233:6787-6793. |
| 29. |
Foulger, D., and J. Errington.
1998.
A 28 kbp segment from the spoVM region of the Bacillus subtilis 168 genome.
Microbiology
144:801-805 |
| 30. | Garbutt, K., J. Kraus, and B. L. Geller. 1997. Bacteriophage resistance in Lactococcus lactis engineered by replacement of a gene for a bacteriophage receptor. J. Dairy Sci. 80:1512-1519[Abstract]. |
| 31. |
García, E.,
J. L. García,
P. García,
A. Arrarás,
J. M. Sánchez-Puelles, and R. López.
1988.
Molecular evolution of lytic enzymes of Streptococcus pneumoniae and its bacteriophages.
Proc. Natl. Acad. Sci. USA
85:914-918 |
| 32. | García, P., J. L. García, E. García, J. M. Sánchez-Puelles, and R. López. 1990. Modular organization of the lytic enzymes of Streptococcus pneumoniae and its bacteriophages. Gene 86:81-88[CrossRef][Medline]. |
| 33. | Garvey, P. A., C. Hill, and G. F. Fitzgerald. 1996. The lactococcal plasmid pNP40 encodes a third bacteriophage resistance mechanism, one which affects phage DNA penetration. Appl. Environ. Microbiol. 62:676-679[Abstract]. |
| 34. |
Geller, B. L.,
R. G. Ivey,
J. E. Trempy, and B. Hettinger-Smith.
1993.
Cloning of a chromosomal gene required for phage infection of Lactococcus lactis subsp. lactis C2.
J. Bacteriol.
175:5510-5519 |
| 35. |
Green, C. J., and B. S. Vold.
1993.
Staphylococcus aureus has clustered tRNA genes.
J. Bacteriol.
175:5091-5096 |
| 36. |
Henrich, B.,
B. Binishofer, and U. Bläsi.
1995.
Primary structure and functional analysis of the lysis genes of Lactobacillus gasseri bacteriophage  adh.
J. Bacteriol.
177:723-732 |
| 37. |
Holo, H., and I. F. Nes.
1989.
High-frequency transformation, by electroporation, of Lactococcus lactis subsp. cremoris grown with glycine in osmotically stabilized media.
Appl. Environ. Microbiol.
55:3119-3123 |
| 38. | Jarvis, A. W., G. F. Fitzgerald, M. Mata, A. Mercenier, H. Neve, I. B. Powell, C. Ronda, and M. T. Saxelin. 1991. Species and type phages of lactococcal bacteriophages. Intervirology 32:2-9[Medline]. |
| 39. | Josephsen, J., and F. K. Vogensen. 1989. Identification of three different plasmid-encoded restriction/modification systems in Streptococcus lactis subsp. cremoris W56. FEMS Microbiol. Lett. 59:161-166[CrossRef]. |
| 40. | Kaback, H. R. 1971. Bacterial membranes. Methods Enzymol. 22:99-120[CrossRef]. |
| 41. | Keogh, B. P., and P. D. Shimmin. 1974. Morphology of the bacteriophages of lactic streptococci. Appl. Microbiol. 27:411-415[Medline]. |
| 42. | Klaenhammer, T. R., and G. F. Fitzgerald. 1994. Bacteriophage and bacteriophage resistance, p. 106-168. In M. J. Gasson, and W. M. de Vos (ed.), Genetics and biotechnology of lactic acid bacteria. Chapman and Hall, Glasgow, Scotland. |
| 43. | Kraus, J., and B. L. Geller. 1998. Membrane receptor for prolate phages is not required for infection of Lactococcus lactis by small or large isometric phages. J. Dairy Sci. 81:2329-2335[Abstract]. |
| 44. |
Lepeuple, A.-S.,
E. Van Gemert, and M.-P. Chapot-Chartier.
1998.
Analysis of the bacteriolytic enzymes of the autolytic Lactococcus lactis subsp. cremoris strain AM2 by renaturing polyacrylamide gel electrophoresis: identification of a prophage-encoded enzyme.
Appl. Environ. Microbiol.
64:4142-4148 |
| 45. | Lichenstein, H. S., A. E. Hastings, K. E. Langley, E. A. Mendiaz, M. F. Rohde, R. Elmore, and M. M. Zukowski. 1990. Cloning and nucleotide sequence of the N-acetylmuramidase M1-encoding gene from Streptomyces globisporus. Gene 88:81-86[CrossRef][Medline]. |
| 46. |
Lillehaug, D., and N.-K. Birkeland.
1993.
Characterization of genetic elements required for site-specific integration of the temperate lactococcal bacteriophage LC3 and construction of integration-negative LC3 mutants.
J. Bacteriol.
175:1745-1755 |
| 47. | Mikkonen, M., and T. Alatossava. 1994. Characterization of the genome region encoding structural proteins of Lactobacillus delbrueckii subsp. lactis bacteriophage LL-H. Gene 151:53-59[CrossRef][Medline]. |
| 48. | Moineau, S., M. Borkaev, B. J. Holler, S. A. Walker, J. K. Kondo, E. R. Vedamuthu, and P. A. Vandenbergh. 1996. Isolation and characterization of lactococcal bacteriophages from cultured buttermilk plants in the United States. J. Dairy Sci. 79:2104-2111[Abstract]. |
| 49. |
Moineau, S.,
S. Pandian, and T. R. Klaenhammer.
1994.
Evolution of a lytic bacteriophage via DNA acquisition from the Lactococcus lactis chromosome.
Appl. Environ. Microbiol.
60:1832-1841 |
| 50. |
Monteville, M. R.,
B. Ardestani, and B. L. Geller.
1994.
Lactococcal bacteriophages required a host cell wall carbohydrate and a plasma membrane protein for adsorption and ejection of DNA.
Appl. Environ. Microbiol.
60:3204-3211 |
| 51. |
Ronda-Lain, C.,
R. Lopez,
A. Tapia, and A. Tomasz.
1977.
Role of the pneumococcal autolysin (murein hydrolase) in the release of progeny bacteriophage and in the bacteriophage-induced lysis of the host cells.
J. Virol.
21:366-374 |
| 52. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 53. | Terzaghi, B. E., and W. E. Sandine. 1975. Improved medium for lactic streptococci and their bacteriophages. Appl. Microbiol. 29:807-813. |
| 54. | Terzaghi, B. E., and W. E. Sandine. 1981. Bacteriophage production following exposure of lactic streptococci to ultraviolet radiation. J. Gen. Microbiol. 122:305-311. |
| 55. |
Valyasevi, R.,
W. E. Sandine, and B. L. Geller.
1991.
A membrane protein is required for bacteriophage c2 infection of Lactococcus lactis subsp. lactis C2.
J. Bacteriol.
173:6095-6100 |
| 56. | Valyasevi, R., W. E. Sandine, and B. L. Geller. 1994. Lactococcus lactis ssp. lactis C2 bacteriophage sk1 receptor involving rhamnose and glucose moieties in the cell wall. J. Dairy Sci. 77:1-6. |
| 57. | van Sinderen, D., H. Karsens, J. Kok, P. Terpstra, M. H. J. Ruiters, G. Venema, and A. Nauta. 1996. Sequence analysis and molecular characterization of the temperate lactococcal bacteriophage rlt. Mol. Microbiol. 19:1343-1355[Medline]. |
| 58. |
Vasala, A.,
L. Dupont,
M. Baumann,
P. Ritzenthaler, and T. Alatossava.
1993.
Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.
J. Virol.
67:3061-3068 |
| 59. | von Heijne, G. 1999. Recent advances in the understanding of membrane protein assembly and structure. Q. Rev. Biophys. 32:285-307[CrossRef][Medline]. |
| 60. |
Walker, S. A.,
C. S. Dombroski, and T. R. Klaenhammer.
1998.
Common elements regulating gene expression in temperate and lytic bacteriophages of Lactococcus species.
Appl. Environ. Microbiol.
64:1147-1152 |
| 61. |
Walsh, P. M., and L. L. McKay.
1981.
Recombinant plasmid associated with cell aggregation and high-frequency conjugation of Streptococcus lactis ML3.
J. Bacteriol.
146:937-944 |
Applied and Environmental Microbiology, February 2001, p. 791-798, Vol. 67, No. 2
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.2.791-798.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Patrauchan, M. A., Florizone, C., Eapen, S., Gomez-Gil, L., Sethuraman, B., Fukuda, M., Davies, J., Mohn, W. W., Eltis, L. D.
(2008). Roles of Ring-Hydroxylating Dioxygenases in Styrene and Benzene Catabolism in Rhodococcus jostii RHA1. J. Bacteriol.
190: 37-47
[Abstract] [Full Text] -
Geller, B. L., Ngo, H. T., Mooney, D. T., Su, P., Dunn, N.
(2005). Lactococcal 936-Species Phage Attachment to Surface of Lactococcus lactis. J DAIRY SCI
88: 900-907
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»