Previous Article | Next Article 
Applied and Environmental Microbiology, February 2001, p. 922-928, Vol. 67, No. 2
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.2.922-928.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Portable System for Microbial Sample Preparation
and Oligonucleotide Microarray Analysis
Sergei G.
Bavykin,1
James P.
Akowski,1
Vladimir M.
Zakhariev,2
Viktor E.
Barsky,2
Alexander N.
Perov,2 and
Andrei D.
Mirzabekov1,2,*
BioChip Technology Center, Argonne National
Laboratory, Argonne, Illinois 60439,1 and
Engelhardt Institute of Molecular Biology, Moscow 117984, Russia2
Received 5 June 2000/Accepted 7 November 2000
 |
ABSTRACT |
We have developed a three-component system for microbial
identification that consists of (i) a universal syringe-operated silica
minicolumn for successive DNA and RNA isolation, fractionation, fragmentation, fluorescent labeling, and removal of excess free label
and short oligonucleotides; (ii) microarrays of immobilized oligonucleotide probes for 16S rRNA identification; and (iii) a
portable battery-powered device for imaging the hybridization of
fluorescently labeled RNA fragments with the arrays. The minicolumn combines a guanidine thiocyanate method of nucleic acid isolation with
a newly developed hydroxyl radical-based technique for DNA and RNA
labeling and fragmentation. DNA and RNA can also be fractionated through differential binding of double- and single-stranded forms of
nucleic acids to the silica. The procedure involves sequential washing
of the column with different solutions. No vacuum filtration steps,
phenol extraction, or centrifugation is required. After hybridization,
the overall fluorescence pattern is captured as a digital image or as a
Polaroid photo. This three-component system was used to discriminate
Escherichia coli, Bacillus subtilis, Bacillus
thuringiensis, and human HL60 cells. The procedure is rapid:
beginning with whole cells, it takes approximately 25 min to obtain
labeled DNA and RNA samples and an additional 25 min to hybridize and
acquire the microarray image using a stationary image analysis system
or the portable imager.
| |
INTRODUCTION |
Traditional methods of bacterial
identification are usually based on morphological and/or physiological
features of a microorganism or on analysis of 16S rRNA gene sequences
(59). These methods can require considerable amounts of
time. Recently, PCR and other amplification technologies were
introduced for bacterial identification (33).
Immunological methods (16) and mass spectrometry
(18) have also been adapted for this purpose but are
expensive or cumbersome. DNA microchip technology (37)
advantageously combines a rapid, high-throughput platform for
nucleic acid hybridization with low cost and the potential for
automation, although sample preparation procedures, including DNA
and RNA isolation, fragmentation, and labeling, are still limiting
steps (32, 44). Another limitation of microarray
technology is the lack of portable and inexpensive devices for the
acquisition of hybridization patterns (5). We have
addressed these shortcomings through the development of a rapid and
simple system for sample preparation and microarray analysis.
| |
MATERIALS AND METHODS |
Preparation of silica syringe-operated columns.
A silica
suspension (50 µl) was prepared as described previously
(4) and loaded into a 25-mm-long sterile centrifuge device containing a polysulfone filter with a diameter of 6.5 mm and a pore
size of 0.2 µm (Whatman, Fairfield, N.J.). The column was sealed
against the end of a 10-ml syringe without any glue, using the O-ring
from a 1.5-ml screw-cap microcentrifuge tube introduced between the
syringe and the top of the column, and washed once with 500 µl of
diethylpyrocarbonate-treated water.
Isolation of total nucleic acids.
Bacterial strains
Bacillus subtilis B-459, B. thuringiensis 4Q281,
and Escherichia coli BL21, as well as human HL60 cells, were
used as the starting material. Gram-positive cells were pretreated by
incubation with 25 µl of a lysozyme solution (100 mg/ml) at 37°C
for 5 min before lysis. A cell pellet obtained from 1 ml of log-phase
bacterial cells (2 × 107 to 2 × 108
cells/ml) grown in standard Luria-Bertani medium (45) or
human HL60 cell cultures (6 × 106 cells/ml) grown as
described previously (49) was lysed by adding 550 µl of
mixture (9:4) of lysis (L) and binding (B) buffers. L buffer was
composed of 4.5 M guanidine thyocianate (GuSCN) and 100 mM EDTA (pH 8);
B buffer contained 4 M GuSCN, 135 mM Tris-HCl (pH 6.4), 3.5% (wt/vol)
Triton X-100, 17.5 mM EDTA, and 215 mM MgCl2. The lysate
was applied to a silica minicolumn, which was washed by using a syringe
with 0.5 ml of the applied L-B buffer mixture (9:4) (twice), 0.5 ml of
70% (vol/vol) ethanol (twice), and 0.5 ml of 100% ethanol (once). The
column was dried by forcing 5 ml of air through it with a syringe. The
bound nucleic acids were either eluted from the column with 1 mM HEPES
(pH 7.5) or directly subjected to labeling and fragmentation.
RNA and DNA isolation and fractionation.
A cell pellet
obtained from 1 ml of log-phase culture was lysed by the addition of
450 µl of L buffer (gram-positive cells were pretreated with lysozyme
as described above). DNA was isolated by passing the lysate over a
syringe-operated column, allowing DNA to bind to the silica. B buffer
(200 µl) was added to the flowthrough RNA fraction, which was then
applied to the analogous fresh column. The first column, containing
bound DNA, was washed five times with 0.5 ml of L buffer, twice with
0.5 ml of 70% (vol/vol) ethanol, and once with 0.5 ml of 100%
(vol/vol) ethanol. The second column, containing bound RNA, was washed
twice with 0.5 ml of the L-B buffer mixture (9:4) and then with ethanol
as described for isolation of total nucleic acids (see above).
Fractionated DNA or RNA was either eluted as described above or
directly subjected to labeling and fragmentation on the column.
Labeling, fragmentation, and hybridization.
The silica
column containing bound RNA, DNA, or both was sealed at the bottom with
a cap from a microcentrifuge tube and preheated in a sand bath at
95°C for 2 min. Freshly prepared labeling cocktail (150 µl)
containing 5 mM 1,10-phenanthroline, 500 µM CuSO4, 1 mM
lissamine-rhodamine B ethylenediamine (Molecular Probes, Inc., Eugene,
Oreg.), 2 mM H2O2, 20 mM sodium phosphate (pH
7.0), and 20 mM NaCNBH3 was applied to the minicolumn (the
H2O2 was added immediately before application
of the cocktail to the column), which was then sealed to prevent
evaporation. After incubation of the mixture for 10 min at 95°C, the
reaction was stopped by adding 9 µl of 500 mM EDTA (pH 8.0). Nucleic
acids were precipitated on the column by adding 15 µl of 5 M ammonium
acetate and 450 µl of 100% (vol/vol) ethanol followed by a 5-min
incubation at room temperature. Excess fluorescent label was removed by
washing the column twice with 1.5 ml of 100% (vol/vol) ethanol. The
column was then dried with forced air. The labeled product was eluted twice with 45 to 60 µl of 1 mM HEPES (pH 7.5). The eluant was adjusted to contain 5 mM EDTA, 1 M GuSCN, and 50 mM HEPES (pH 7.5) and
filtered through a 0.45-µm-pore-size Millex-HV syringe filter
(Millipore, Bedford, Mass.). The resulting solution (30 µl),
containing 5 to 15 µg of nucleic acids, including 1 to 3.5 µg of
16S rRNA, was applied to the oligonucleotide microarray covered with a
0.5-mm-deep, 13-mm-diameter CoverWell gasketed incubation chamber
(Grace Bio-Labs, Inc., Bend, Oreg.) and incubated for 20 min at room temperature.
Optional removal of small fragments and traces of free
label.
A polypropylene, 4.5-mm-diameter, Wizard syringe Minicolumn
(Promega, Inc., Madison, Wis.) containing 70 µl of Q Sepharose (Pharmacia Biotech, Uppsala, Sweden) was conditioned by being washed
twice with 0.5 ml of diethylpyrocarbonate-treated H2O, once
with 0.5 ml of 2 M LiClO4, and then twice again with 0.5 ml
of H2O. After the 10-min labeling and fragmentation step
(see above), the contents of a silica minicolumn were expelled into a
microcentrifuge tube containing 9 µl of 500 mM EDTA (pH 8.0). The
same tube was used to collect material rinsed from the silica column
with 1 ml of hot (95°C) 1 mM sodium phosphate (pH 7.0). This solution
of labeled nucleic acids and free label was then applied to the Q
Sepharose column. The Q Sepharose column was washed with 1 ml of 100 mM
LiClO4 to remove unincorporated label and small nucleic
acid fragments (shorter than 20 bases). Nucleic acids were eluted with
100 µl of 0.5 M GuSCN. The eluant was adjusted to contain 5 mM EDTA,
1 M GuSCN, and 50 mM HEPES (pH 7.5), and 30 µl of the resulting
solution was applied to the microarray as described above.
Oligonucleotide synthesis and oligonucleotide array
fabrication.
Oligonucleotide microarrays were constructed with 10 oligonucleotide probes, each approximately 20 bases in length, with the following sequences (5'
3'): EU1, ACCGCTTGTGCGGGCCC; EU2,
TGCCTCCCGTAGGAGTCT; U1, GA/TATTACCGCGGCT/GGCTG; U2,
ACGGGCGGTGTGTA/GCAA; BSG1, ATTCCAGCTTCACGCAGTC; BSG2,
ACAGATTTGTGGGATTGGCT; BS1, AAGCCACCTTTTATGTTTGA; BS2,
CGGTTCAAACAACCATCCGG; BCG1, CGGTCTTGCAGCTCTTTGTA; and BCG2,
CAACTAGCACTTGTTCTTCC (Probe targets are described in the legend
to Fig. 3). The sequences of probes U1, U2, EU1 and EU2 were chosen
following the recommendations of Amann et al. (1). All
other probe sequences were selected using original software developed
in our laboratory (Y. Lysov, unpublished data), where each potential
probe was tested against all available 16S rRNA sequences (from GenBank
and RDP) by a function that estimates the relative duplex stability
according to the number and position of mismatches. If the 16S rRNA of
any microorganism that did not belong to the genus of interest formed
stable duplexes with any oligonucleotide being considered as a
potential probe for the microchip, this oligonucleotide was excluded
from the list of probes. Oligonucleotides were synthesized with a 394 DNA/RNA Synthesizer (Perkin-Elmer/Applied BioSystems, Foster City,
Calif.) using standard phosphoramidite chemistry. 5'-Amino-Modifier C6 (Glen Research, Sterling, Va.) was linked to the 5' ends of
oligonucleotides. The microarray matrix, containing 100- by 100- by
20-µm polyacrylamide gel pads fixed on a glass slide and placed 200 µm from each other, was manufactured using photopolymerization
(25) and activated as described previously
(41). Individual 1 mM amino-oligonucleotide solutions
(0.006 µl) were applied to each gel pad containing aldehyde groups
(53) which were designed and implemented by the Argonne National Laboratory state-of-the-art computer-based robot-arrayer Quadrate II (61). Schiff bases coupling the
oligonucleotides with aldehyde groups within the gel pads were
stabilized by reduction with NaCNBH3 (41).
Microchip analysis.
Hybridization signals were acquired with
a stationary wide-field fluorescence microscope (2, 61) or
with the portable imager. Before analysis, hybridization solution was
removed from the microarrays, which were then washed twice at room
temperature with 150 µl of washing buffer (60 mM sodium phosphate
[pH 7.4], 900 mM NaCl, 6mM EDTA, 1% [wt/vol] Tween 20) for 15 s. The microarrays were imaged wet (covered with a thin film of washing
buffer) when used with the fluorescence microscope or dry when used
with the portable analyzer (2 to 30 s of exposure).
The portable imager was designed and manufactured in collaboration with
the State Optical Institute (GOI, St. Petersburg, Russia). The portable
battery-powered imager utilizes a wide-field, high-aperture,
long-working-distance lens objective with the following parameters:
field of view, 4.2 mm in diameter; numeric aperture, 0.5; working
distance, 2.0 mm; magnification, ×20; spatial resolution, 1.5 µm.
Microarrays are fixed at the focal point of the objective and
illuminated by two 3-mW green (532-nm) diode lasers (DeHarpporte Trading Co., Eden Prairie, Minn.). The lasers are situated near the
body of the objective such that the excitation light strikes the sample
at an angle of 82° to the objective axis. Cylindrical lenses are
positioned at the ends of the lasers to provide uniform illumination of
the objective field of view. An XF3024 (590DF35) emission filter (Omega
Optical, Brattleboro, Vt.) with a transmission maximum at 590 nm is
used to cut off excitation light. In contrast to the use of expensive
scanners that measure fluorescence intensity in one moment for one spot
only and summarize signals from the photomultiplier, in our analyzer
the images of 180 (12 × 15) individual gel elements are
simultaneously projected onto the surface of ISO-3000 Polaroid film
(3.25 by 4.25 in.).
| |
RESULTS |
System overview.
We combined a silica minicolumn,
oligonucleotide microarrays, and a portable imager to produce a simple
and inexpensive system for bacterial identification. A procedure was
developed for nucleic acid isolation, labeling, and fragmentation
within a single syringe-operated silica minicolumn. The process
requires no vacuum filtration step, phenol-chloroform extraction, CsCl
fractionation, or centrifugation. A flowchart of the protocol is shown
in Fig. 1. There are three main steps in
the procedure: (i) cell lysis and nucleic acid isolation (this may also
include DNA and RNA fractionation), (ii) fluorescent labeling and
fragmentation of nucleic acids (DNA or RNA can be labeled using the
same protocol), and (iii) removal of short oligonucleotides and unbound
dye.
View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
Flowchart of the isolation, fractionation,
fragmentation, and labeling of nucleic acids with subsequent removal of
excess free label, using a silica minicolumn.
|
|
Nucleic acid purification and fractionation.
Using the silica
minicolumn, one can isolate total nucleic acids or fractionated DNA and
RNA from gram-negative bacteria within several minutes; the procedure
requires only an additional 5 min of lysozyme pretreatment for
gram-positive microorganisms (Fig. 1). Electrophoretic analysis of
total nucleic acids and fractionated DNA and RNA isolated from B. subtilis using the minicolumn is shown in Fig.
2A. The yields of isolated total nucleic
acids, pure RNA, and pure DNA were 91, 77, and 34%, respectively
(Table 1). The recovery of fractionated
DNA could be increased considerably, up to an 86% yield, by reducing
the number of L buffer washes applied to the DNA-silica column, but
this resulted in increased RNA admixture.
View larger version (84K):
[in this window]
[in a new window]
|
FIG. 2.
Nucleic acids isolated, fractionated, labeled with
lissamine-rhodamine B, and fragmented on a silica syringe-operated
column. (A) Isolated total nucleic acids (lane 1), partially
fractionated DNA (lane 2), purified DNA (lane 3), and purified RNA
(lane 4) from B. subtilis were analyzed by electrophoresis
in 1% agarose. M,  -HindIII DNA marker. (B) Total nucleic
acids from B. thuringiensis fractionated in a denaturing
7.5% polyacrylamide gel (46) before (lane 1) and after
(lanes 2 and 3) labeling and fragmentation; fluorescence of labeled and
fragmented product before (lane 3) and after (lane 2) ethidium bromide
staining. M, single-stranded 20- and 50-base size markers.
|
|
Nucleic acid fragmentation and fluorescent labeling.
The newly
developed labeling and fragmentation procedure that was performed with
the syringe-operated column devised in this study requires only 10 to
12 min to complete (Fig. 1). The extent of fluorescent-dye
incorporation and the length of the nucleic acid fragments may be
varied over a wide range through manipulation of
bis(1,10-phenanthroline)copper(I) [(OP)2Cu]
and H2O2 concentrations, reaction temperature,
and duration of the reaction. To avoid the influence of secondary
structure on nucleic acid fragmentation and to increase the rate of the
reaction, we performed the reaction at 95°C (for 10 min). This
resulted in the production of labeled fragments 20 to 100 bases in
length (Fig. 2B) with the same efficiency for both RNA and DNA (data
not shown). The intrinsic fluorescence of lissamine-rhodamine-labeled
nucleic acids was apparent when this material was subjected to
denaturing polyacrylamide gel electrophoresis and viewed with a
transilluminator (Fig. 2B, lane 3). The same gel stained with ethidium
bromide (lanes 1, 2, and M) revealed the total population of nucleic
acid fragments. The coincidence of the patterns appearing as smears
without any visible bands suggests this hydroxyl radical-based method
provides sequence-independent labeling and fragmentation.
Removal of short nucleic acid fragments and unbound label.
On
completion of the labeling reaction, nucleic acids were precipitated by
the addition of ethanol to the minicolumn and free dye was eliminated
by washing the column with 100% ethanol. This procedure removed most
of the free dye and oligonucleotides shorter than 5 bases
(45). The resulting samples were hybridized on microarrays
containing 20-mer oligonucleotide probes and, after a standard washing
procedure, were visualized (Fig. 3) with
both a stationary fluorescence microscope and the portable device (Fig. 4). When signals are to be measured
during hybridization (e.g., in kinetics experiments), the trace amounts
of unbound dye and labeled fragments shorter than 15 to 20 bases may be
removed to further minimize background by using a Sepharose Q
minicolumn instead of ethanol precipitation and washing (see Materials
and Methods). This step requires only 5 min.
View larger version (58K):
[in this window]
[in a new window]
|
FIG. 3.
Hybridization of total nucleic acids with an
oligonucleotide microarray. Total nucleic acids were isolated and
labeled using the silica minicolumn. (A) The arrangement of probes (see
Materials and Methods for a list of sequences) immobilized on the
microarray for identification of U1 and U2 ("all life"), EU1 and
EU2 (all eubacteria), BSG1 and BSG2 (B. subtilis group
bacteria), BS1 and BS2 (B. subtilis spp), and BCG1 and BCG2
(B. cereus group bacteria). (B and C) Analysis of E. coli with a stationary microscope (B) and the portable imager (C).
(D to G) Normalized fluorescent signal intensities for labeled total
nucleic acids from human HL60 cells (D), E. coli (E),
B. thuringiensis (F), and B. subtilis (G).
Hybridization results were obtained with the stationary fluorescent
microscope (B and D to G) or with the portable imager (C). Fluorescence
intensities were quantified using Image, a custom LabVIEW program
(National Instruments, Austin, Tex.).
|
|
Hybridization and visualization of hybridization results.
Labeled nucleic acids were eluted from the silica minicolumn with
low-ionic-strength buffer. The fragmented and labeled 16S rRNA (1 to
3.5 µg in 30 µl of hybridization buffer) was applied to a
microarray of immobilized 20-mer oligonucleotide probes for recognition
of "life" in general, all eubacteria, and microorganisms that
belong to the B. subtilis group, the B. cereus
group, and B. subtilis spp. (Fig. 3A).
To provide for hybridization of labeled nucleic acids at room
temperature, we developed a GuSCN-based hybridization buffer.
GuSCN
destabilizes nucleic acid duplexes and increases hybridization
rates
(
52,
55). In our hands, unambiguous diagnostic
hybridization
patterns on the microarray could be detected within 20 min of
hybridization (Fig.
3).
After hybridization, the microchip was washed and then analyzed using
either a stationary wide-field fluorescence microscope
coupled with a
cooled charge-coupled device (CCD) camera (
2,
61) or the
portable microchip imager. Exposure times of 2 to
30 s produced
clear images on the Polaroid film (Fig.
3C). The
sample patterns and
intensities obtained with the portable device
(Fig.
3C) were very
similar to the images obtained with the stationary
fluorescence
microscope (Fig.
3B). Labeled nucleic acids from
Escherichia
coli, B. subtilis, B. thuringiensis, and human HL60
leukemia cells produced hybridization patterns characteristic
for each
organism (Fig.
3D to
3G). We carried out our experiments
with two to
four repeats, and the most common data are shown in
Fig.
3.
Hybridization experiments were performed several times
both on the same
and on the different microchips, and similar
results were obtained in
both cases (data not
shown).
The portable Polaroid microchip analyzer allows qualitative
determination of microorganisms in collected samples. For fast
and
simple detection of targeted microorganisms and approximate
estimation
of their amounts in the sample, the portable microchip
analyzer should
be provided with standard images obtained from
a chip after
hybridization with nucleic acids obtained from a
known number of
analyzed bacterial cells and photographed with
a fixed exposure
time.
The design of the analyzer allows a lens adapter to be attached and
coupled with 35-mm film or a CCD camera. Polaroid or 35-mm
negative
films can be scanned to obtain 8-bit digital images;
a CCD camera
allows images to be obtained with a larger dynamic
range and provides a
quantitative estimation of obtained images.
The analyzer with a CCD
camera tested successfully for identification
of drug-resistant strains
of
Mycobacterium tuberculosis (Y. Barsky
et. al.,
unpublished
data).
| |
DISCUSSION |
The main goal of this work was to develop a rapid and inexpensive
procedure for analysis of different microorganisms using biological
microchip technology. One of the bottlenecks in the use of biological
microchips for nucleic acid analyses is sample preparation time
(32, 44). A number of standard biochemical procedures such
as cell fractionation and lysis (9), chromatography (43), electrophoresis (6, 28, 43), sample
concentration (28), PCR (29), DNA ligation
and phosphorylation (15), thermodynamic analysis of
hybridization (17), immunoassay (34, 35), and single-base extension analysis (15) are already performed
routinely on microchips. Moreover, some current microchips combine
microarrays and biological microlaboratories in the same device
(6, 9, 28, 29, 35, 43, 44, 46, 50). Therefore, we have sought to develop our procedures with future miniaturization and automation in mind.
rRNA is a "universal chronometric cellular molecule"
(59). Up to 80% of bacterial RNA is rRNA. One cell of
E. coli can contain about 20,000 copies of rRNA. Therefore,
rRNA analysis is a common, rather sensitive, and relatively simple
method of bacterial identification (59). The use of
microarrays in microbial identification has been demonstrated
(21, 24). We recently utilized oligonucleotide probes to
rRNA to develop a microarray that is able to differentiate very closely
related microorganisms within the B. cereus group, i.e.,
organisms whose 16S rRNAs differ from each other in only one nucleotide
(unpublished data). In the present study we demonstrate the potential
of our new multicomponent system by using a simple 16S rRNA microarray
containing 20-mer probes (Fig. 3A). This limited microarray should not
be considered a final device for identification of bacterial groups or
species but only a tool for demonstration of perfect work by the
three-component system for bacteria identification as a whole.
GuSCN is known to be powerful lysing agent for many types of cell and
also an inactivator of various nucleases (4, 10, 11, 38,
45). Nucleic acids bind to silica in the presence of high
concentrations of salt (3, 4). To create a
syringe-operated minicolumn for nucleic acid purification and
fractionation, we modified the previously developed batch protocols
(3, 4) by simplifying the procedure and making it more
rapid. To eliminate all centrifugation steps, we used a
syringe-operated column format. As a result, our protocol requires only
two buffers, and it is possible to isolate total nucleic acids or
fractionate DNA and RNA from gram-negative bacteria in 3 to 5 min (Fig.
1) instead of the previously described 40- to 60-min procedure
requiring four buffers (3, 4).
Free radical oxidants are well-known tools for the modification of DNA
and RNA (7). Redox-active coordination complexes such as
(OP)2Cu and Fe · EDTA, are commonly used as "chemical nucleases" to introduce single-strand breaks in nucleic acids (36, 39, 51). Treatment of DNA or RNA with
(OP)2Cu results in abstraction of a hydrogen atom from the
sugar moiety, producing a carbon-based radical that can rearrange to an
abasic site as a result of deglycosylation followed by fragmentation of
the nucleic acid (39). Aldehydes and lactones formed at
the site of scission may be used for conjugation of amino derivatives
with the nucleic acid fragments (19, 42). We recently used
this idea to create a new method for sequence-independent fragmentation
and fluorescent labeling of nucleic acids with (OP)2Cu and
Fe · EDTA complexes (unpublished data). We utilize
(OP)2Cu chemistry for sample preparation on the silica
minicolumn. Here we demonstrated labeling and fragmentation of total
nucleic acids for cell identification (Fig. 3). The (OP)2Cu silica minicolumn method may also be used for labeling and
fragmentation of pure RNA and DNA (data not shown). We successfully
recruited this method for on-microchip identification of whole (about
1,550 bases in length) B. subtilis 16S rRNA, utilizing the
same experimental conditions. However, it was necessary to change the
concentration of hydrogen peroxide or (OP)2Cu complex in
the labeling cocktail considerably (see Materials and Methods) for
identification of 300-base RNA fragments and PCR-amplified
double-stranded DNA of 16S rRNA genes of B. cereus group bacteria.
The most popular methods for nucleic acid labeling are currently based
on time-consuming enzymatic procedures such as those involving reverse
transcriptases (13, 48, 56, 57, 60), terminal transferases
(23, 58), kinases (58), random priming (22, 27), or PCR (8, 12, 20, 21, 26, 30, 31, 47,
54). Most of these protocols also demand careful nucleic acid
purification, separate sample fragmentation procedures (which considerably improve the specificity of hybridization), and a final
precipitation or gel filtration step to eliminate excess label.
As a result, sample isolation and fractionation steps (generally 1 h or more) usually precede separate labeling-fragmentation-purification routines, which adds 2 to 3 h. Recently developed chemical
labeling methods also require a considerable time to perform (more than 3 h) (14, 40). Our entire minicolumn procedure,
from cell lysis to removal of excess fluorescent label, can be executed within 20 to 30 min.
Instrumentation required for the detection and identification of
fluorescent hybridization signals represents one of the most expensive
aspects of microarray technology. Our stationary laboratory fluorescent
microscope was assembled at a price of about $60,000, while the market
cost of a laser scanner is generally $40,000-$110,000 (5).
In contrast, the projected cost of our laser diode/Polaroid film-based
portable imager is considerably lower (about $2,000). The wide-field,
high-aperture, long-working-distance objective provides the ability to
analyze 180 individual probes simultaneously, which is enough to permit
the design of arrays specific for many different microorganisms.
Coupling of our portable analyzer with a CCD camera and PC provides the
possibility of quantifying image analysis while not substantially
increasing its price; however, this converts the system to a stationary device.
We think that our portable multicomponent system can be successfully
used under laboratory or field conditions for rapid microbial (or
eukaryote) identification in medical, agricultural, or environmental applications.
| |
ACKNOWLEDGMENTS |
This work was supported by the Defense Advanced Research Project
Agency under Interagency Agreement AO-E428 and by the Russian Human
Genome Program grant 5/2000.
We express our gratitude to John Kelly, Isaac Barsky, and Lev Agroskin
for many helpful consultations. We are also grateful to Yuri Lysov for
selection of probe sequences and to Gennadiy Yershov and Anne Gemmell
for chip manufacture.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: BioChip
Technology Center, Argonne National Laboratory, 9700 S. Cass Ave.,
Argonne, IL 60439. Phone: (630) 252-3161. Fax: (630) 252-9155. E-mail: amir{at}everest.bim.anl.gov.
| |
REFERENCES |
| 1.
|
Amann, R. I.,
W. Ludwig, and K.-H. Schleifer.
1995.
Phylogenetic identification and in situ detection of individual microbial cells without cultivation.
Microbiol. Rev.
59:143-169[Abstract/Free Full Text].
|
| 2.
|
Barsky, Y.,
A. Grammatin,
A. Ivanov,
E. Kreindlin,
E. Kotova,
V. Barskii, and A. Mirzabekov.
1998.
Wide-field luminescence microscopes for analyzing biological microchips.
J. Opt. Technol.
65:938-941.
|
| 3.
|
Beld, M.,
C. Sol,
J. Goudsmit, and R. Boom.
1996.
Fractionation of nucleic acids into single-stranded and double-stranded forms.
Nucleic Acids Res.
24:2618-2619[Free Full Text].
|
| 4.
|
Boom, R.,
C. J. A. Sol,
M. M. M. Salimans,
C. L. Jansen,
P. M. E. Wertheim-van Dillen, and J. van der Noordaa.
1990.
Rapid and simple method for purification of nucleic acids.
J. Clin. Microbiol.
28:495-503[Abstract/Free Full Text].
|
| 5.
|
Bowtell, D. D. L.
1999.
Options available from start to finishfor obtaining expression data by microarray.
Nat. Genet.
21:25-32[CrossRef][Medline].
|
| 6.
|
Burns, M. A.,
B. N. Johnson,
S. N. Brahmasandra,
K. Handique,
J. R. Webster,
M. Krishnan,
T. S. Sammarco,
P. M. Man,
D. Jones,
D. Heldsinger,
C. H. Mastrangelo, and D. T. Burke.
1998.
An integrated nanoliter DNA analysis device.
Science
282:484-487[Abstract/Free Full Text].
|
| 7.
|
Burrows, C. J., and J. G. Muller.
1998.
Oxidative nucleobase modifications leading to strand scission.
Chem. Rev.
98:1109-1151[CrossRef][Medline].
|
| 8.
|
Chee, M.,
R. Yang,
E. Hubbell,
A. Berno,
X. C. Huang,
D. Stern,
J. Winkler,
D. J. Lockhart,
M. S. Morris, and S. P. A. Fodor.
1996.
Accessing genetic information with high-density DNA arrays.
Science
274:610-614[Abstract/Free Full Text].
|
| 9.
|
Cheng, J.,
E. L. Sheldon,
L. Wu,
A. Uribe,
L. O. Gerrue,
J. Carrino,
M. J. Heller, and J. P. O'Connell.
1998.
Preparation and hybridization analysis of DNA/RNA from E. coli on microfabricated bioelectronic chips.
Nat. Biotechnol.
16:541-546[CrossRef][Medline].
|
| 10.
|
Chirgwin, J. M.,
A. E. Przybyla,
R. J. MacDonald, and W. J. Rutter.
1979.
Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease.
Biochemistry
24:5294-5299.
|
| 11.
|
Ciulla, T. A.,
R. M. Sklar, and S. L. Hauser.
1988.
A simple method for DNA purification from peripheral blood.
Anal. Biochem.
174:485-488[CrossRef][Medline].
|
| 12.
|
Cronin, M. T.,
R. V. Fucini,
S. M. Kim,
R. S. Masino,
R. M. Wespi, and C. G. Miyada.
1996.
Cystic fibrosis mutation detection by hybridization to light-generated DNA probe arrays.
Hum. Mutat.
7:244-255[CrossRef][Medline].
|
| 13.
|
DeRisi, J. L.,
V. R. Iyer, and P. O. Brown.
1997.
Exploring the metabolic and genetic control of gene expression on a genomic scale.
Science
278:680-686[Abstract/Free Full Text].
|
| 14.
|
de Saizieu, A.,
U. Certa,
J. Warrington,
C. Gray,
W. Keck, and J. Mous.
1998.
Bacterial transcript imaging by hybridization of total RNA to oligonucleotide arrays.
Nat. Biotechnol.
16:45-48[Medline].
|
| 15.
|
Dubilei, S.,
E. Kirillov,
Y. Lysov, and A. Mirzabekov.
1997.
Fractionation, phosphorylation and ligation on oligonucleotide microchip to enhance sequencing by hybridization.
Nucleic Acids Res.
25:2259-2265[Abstract/Free Full Text].
|
| 16.
|
Ezzell, J. W., Jr.,
T. G. Abshire,
S. F. Little,
B. C. Lidgerding, and C. Brown.
1990.
Identification of Bacillus anthracis by using monoclonal antibody to cell wall galactose-N-acetylglucosamine polysaccharide.
J. Clin. Microbiol.
28:223-231[Abstract/Free Full Text].
|
| 17.
|
Fotin, A. V.,
A. L. Drobyshev,
D. Y. Proudnikov,
A. N. Perov, and A. D. Mirzabekov.
1998.
Parallel thermodynamic analysis of duplex on oligodeoxyribonucleotide microchips.
Nucleic Acids Res.
26:1515-1521[Abstract/Free Full Text].
|
| 18.
|
Fox, A. J.,
J. Gilbart, and S. Morgan.
1990.
Analytical microbiology: a perspective, p. 1-17.
In
A. Fox, L. Larsson, S. Morgan, and G. Odham (ed.), Analytical microbiology methods: chromatography and mass spectrometry. Plenum Press, New York, N.Y.
|
| 19.
|
Gavin, I. M.,
S. M. Melnik,
N. P. Yurina,
M. I. Khabarova, and S. G. Bavykin.
1998.
Zero-length protein-nucleic acid crosslinking by radical-generating coordination complexes as a probe for analysis of protein-DNA interactions in vitro and in vivo.
Anal. Biochem.
263:26-30[CrossRef][Medline].
|
| 20.
|
Gilles, P. N.,
D. J. Wu,
C. B. Foster,
P. J. Dillon, and S. J. Chanock.
1999.
Single nucleotide polymorphic discrimination by an electronic dot blot assay on semiconductor microchips.
Nat. Biotechnol.
17:365-370[CrossRef][Medline].
|
| 21.
|
Gingeras, T. R.,
G. Ghandour,
E. Wang,
A. Berno,
P. M. Small,
F. Drobniewski,
D. Alland,
E. Desmond,
M. Holodniy, and J. Drenkow.
1998.
Simultaneous genotyping and species identification using hybridization pattern recognition analysis of generic Mycobacterium DNA arrays.
Genome Res.
8:435-448[Abstract/Free Full Text].
|
| 22.
|
Guiliano, D.,
M. Ganatra,
J. Ware,
J. Parrot,
J. Daub,
L. Moran,
H. Brennecke,
J. M. Foster,
T. Supali,
M. Blaxter,
A. L. Scott,
S. A. Williams, and B. E. Slatko.
1999.
Chemiluminescent detection of sequential DNA hybridizations to high-density, filter-arrayed cDNA libraries: a subtraction method for novel gene discovery.
BioTechniques
27:146-152[Medline].
|
| 23.
|
Gunderson, K. L.,
X. C. Huang,
M. S. Morris,
R. J. Lipshutz,
D. J. Lockhart, and M. Chee.
1998.
Mutation detection by ligation to complete n-mer DNA arrays.
Genome Res.
8:1142-1153[Abstract/Free Full Text].
|
| 24.
|
Guschin, D. Y.,
B. K. Mobarry,
D. Proudnikov,
D. A. Stahl,
B. E. Rittmann, and A. D. Mirzabekov.
1997.
Oligonucleotide microchips as genosensors for determinative and environmental studies in microbiology.
Appl. Environ. Microbiol.
63:2397-2402[Abstract].
|
| 25.
|
Guschin, D.,
G. Yershov,
A. Zaslavsky,
A. Gemmell,
V. Shick,
D. Proudnikov,
P. Arenkov, and A. Mirzabekov.
1997.
Manual manufacturing of oligonucleotide, DNA, and protein microchips.
Anal. Biochem.
250:203-211[CrossRef][Medline].
|
| 26.
|
Hacia, J. G.,
C. B. Lawrence,
M. S. Chee,
S. P. A. Fodor, and F. S. Collins.
1996.
Detection of heterozygous mutations in BRCAI using high density oligonucleotide arrays and two-color fluorescence analysis.
Nat. Genet.
14:441-447[CrossRef][Medline].
|
| 27.
|
Hermanson, G. T.
1996.
Bioconjugate techniques.
Academic Press, Inc., San Diego, Calif.
|
| 28.
|
Khandurian, J.,
S. C. Jacobson,
L. C. Waters,
R. S. Foote, and J. M. Ramsey.
1999.
Microfabricated porous membrane structure for sample concentration and electrophoretic analysis.
Anal. Chem.
71:1815-1819[Medline].
|
| 29.
|
Kopp, M. U.,
A. J. de Mello, and A. Manz.
1998.
Chemical amplification: continuous-flow PCR on a chip.
Science
280:1046-1048[Abstract/Free Full Text].
|
| 30.
|
Kozal, M. J.,
N. Shah,
N. Shen,
R. Yang,
R. Fucini,
T. C. Merigan,
D. D. Richman,
D. Morris,
E. Hubbell,
M. Chee, and T. R. Gingeras.
1996.
Extensive polymorphisms observed in HIV-1 clade B protease gene using high-density oligonucleotide arrays.
Nat. Med.
2:753-759[CrossRef][Medline].
|
| 31.
|
Lockhart, D. J.,
H. Dong,
M. C. Byrne,
M. T. Follettie,
M. V. Gallo,
M. S. Chee,
M. Mittmann,
C. Wang,
M. Kobayashi,
H. Horton, and E. L. Brown.
1996.
Expression monitoring by hybridization to high-density oligonucleotide arrays.
Nat. Biotechnol.
14:1675-1680[CrossRef][Medline].
|
| 32.
|
Marshall, A., and J. Hodgson.
1998.
DNA chips: an array of possibilities.
Nat. Biotechnol.
16:27-31[CrossRef][Medline].
|
| 33.
|
Martin, G. P., and E. Timmers.
1997.
PCR and its modifications for the detection of infectious diseases, p. 79-99.
In
H. Lee, S. Morse, and O. Olsvik (ed.), Nucleic acid amplification technologies: application to disease diagnosis. Eaton Publishing, Natick, Mass.
|
| 34.
|
Mendoza, L. G.,
P. McQuary,
A. Mongan,
R. Gangadharan,
S. Brignac, and M. Eggers.
1999.
High-throughput microarray-based enzyme-linked immunosorbent assay (ELISA).
BioTechniques
27:778-788[Medline].
|
| 35.
|
Ouellette, J.
1998.
Biosensors: microelectronics marries biology.
Ind. Physicist
4:11-14.
|
| 36.
|
Papavassiliou, A. G.
1995.
Chemical nucleses as probes for studying DNA-protein interactions.
Biochem. J.
305:345-357.
|
| 37.
|
Phimister, B. (ed.).
1999.
The chipping forecast.
Nat. Genet.
21(Suppl.):1-60.
|
| 38.
|
Pitcher, D. G.,
N. A. Saunders, and R. J. Owens.
1989.
Rapid extraction of bacterial genomic DNA with guanidium thiocyanate.
Lett. Appl. Microbiol.
8:151-156.
|
| 39.
|
Pogozelski, W. K., and T. D. Tullius.
1998.
Oxidative strand scission of nucleic acids: routes initiated by hydrogen abstraction from the sugar moiety.
Chem. Rev.
98:1089-1107[CrossRef][Medline].
|
| 40.
|
Proudnikov, D., and A. Mirzabekov.
1996.
Chemical methods of DNA and RNA fluorescent labeling.
Nucleic Acids Res.
24:4535-4532[Abstract/Free Full Text].
|
| 41.
|
Proudnikov, D.,
E. Timofeev, and A. Mirzabekov.
1998.
Immobilization of DNA in polyacrylamide gel for the manufacture of DNA and DNA-oligonucleotide microchips.
Anal. Biochem.
259:34-41[CrossRef][Medline].
|
| 42.
|
Pruss, D.,
I. M. Gavin,
S. Melnik, and S. Bavykin.
1999.
DNA-protein cross-linking applications for chromatin studies in vitro and in vivo.
Methods Enzymol.
304:516-533[Medline].
|
| 43.
|
Regnier, F. E.,
B. He,
S. Lin, and J. Busse.
1999.
Chromatography and electrophoresis on chips: critical elements of future integrated, microfluidic analytical systems for life science.
Trends Biotechnol.
17:101-106[CrossRef][Medline].
|
| 44.
|
Robertson, D.
1998.
Chips advance but cost constraints remain.
Nat. Biotechnol.
16:509[CrossRef].
|
| 45.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 46.
|
Santini, J. T., Jr.,
M. J. Cima, and R. Langer.
1999.
A controlled-release microchip.
Nature
397:335-338[CrossRef][Medline].
|
| 47.
|
Sapolsky, R. J., and R. J. Lipshutz.
1996.
Mapping genomic library clones using oligonucleotide arrays.
Genomics
33:445-456[CrossRef][Medline].
|
| 48.
|
Schena, M.,
D. Shalon,
R. W. Davis, and P. O. Brown.
1995.
Quantitative monitoring of gene expression patterns with a complementary DNA microarray.
Science
270:467-470[Abstract/Free Full Text].
|
| 49.
|
Semizarov, D.,
D. Glesne,
A. Laouar,
K. Schiebel, and E. Huberman.
1998.
A lineage-specific protein kinase crucial for myeloid maturation.
Proc. Natl. Acad. Sci. USA
95:15412-15417[Abstract/Free Full Text].
|
| 50.
|
Service, R. F.
1998.
Microchip arrays put DNA on the spot.
Science
282:396-399[Free Full Text].
|
| 51.
|
Sigman, D. S.
1990.
Chemical nucleases.
Biochemistry
29:9097-9105[CrossRef][Medline].
|
| 52.
|
Thompson, J., and D. Gillespie.
1987.
Molecular hybridization with RNA probes in concentrated solutions of guanidine thiocyanate.
Anal. Biochem.
163:281-291[CrossRef][Medline].
|
| 53.
|
Timofeev, E.,
S. Kochetkova,
A. Mirzabekov, and V. Florentiev.
1996.
Regioselective immobilization of short oligonucleotides to acrylic copolymer gels.
Nucleic Acids Res.
24:3142-3148[Abstract/Free Full Text].
|
| 54.
|
Tyagi, S.,
D. P. Bratu, and F. R. Kramer.
1998.
Multicolor molecular beacons for allele discrimination.
Nat. Biotechnol.
16:49-53[CrossRef][Medline].
|
| 55.
|
Van Ness, J., and L. Chen.
1991.
The use of oligodeoxynucleotide probes in chaotrope-based hybridization solutions.
Nucleic Acids Res.
19:5143-5151[Abstract/Free Full Text].
|
| 56.
|
Wang, K.,
L. Gan,
E. Jeffery,
M. Gayle,
A. M. Gown,
M. Skelly,
P. S. Nelson,
W. V. Ng,
M. Schummer,
L. Hood, and J. Mulligan.
1999.
Monitoring gene expression profile changes in ovarian carcinomas using cDNA microarray.
Gene
229:101-108[CrossRef][Medline].
|
| 57.
|
Wilson, M.,
J. DeRisi,
H. Kristensen,
P. Imboden,
S. Rane,
P. O. Brown, and G. K. Schoolnik.
1999.
Exploring drug-induced alterations in gene expression in Mycobacterium tuberculosis by microarray hybridization.
Proc. Natl. Acad. Sci. USA
96:12833-12838[Abstract/Free Full Text].
|
| 58.
|
Wodicka, L.,
H. Dong,
M. Mittmann,
M. Ho, and D. J. Lockhart.
1997.
Genome-wide expression monitoring in Saccharomyces cerevisiae.
Nat. Biotechnol.
15:1359-1367[CrossRef][Medline].
|
| 59.
|
Woese, C. R.
1987.
Bacterial evolution.
Microbiol. Rev.
51:221-271[Free Full Text].
|
| 60.
|
Yang, G. P.,
D. R. Ross,
W. W. Kuang,
P. O. Brown, and R. J. Weigel.
1999.
Combining SSH and cDNA microarrays for rapid identification of differentially expressed genes.
Nucleic Acids Res.
27:1517-1523[Abstract/Free Full Text].
|
| 61.
|
Yershov, G.,
V. Barsky,
A. Belgovskiy,
E. Kirillov,
E. Kreindlin,
I. Ivanov,
S. Parinov,
D. Guschin,
A. Drobishev,
S. Dubiley, and A. Mirzabekov.
1996.
DNA analysis and diagnostics on oligonucleotide microchips.
Proc. Natl. Acad. Sci. USA
93:4915-4918.
|
Applied and Environmental Microbiology, February 2001, p. 922-928, Vol. 67, No. 2
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.2.922-928.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pozhitkov, A., Chernov, B., Yershov, G., Noble, P. A.
(2005). Evaluation of Gel-Pad Oligonucleotide Microarray Technology by Using Artificial Neural Networks. Appl. Environ. Microbiol.
71: 8663-8676
[Abstract]
[Full Text]
-
Peytavi, R., Raymond, F. R., Gagne, D., Picard, F. J., Jia, G., Zoval, J., Madou, M., Boissinot, K., Boissinot, M., Bissonnette, L., Ouellette, M., Bergeron, M. G.
(2005). Microfluidic Device for Rapid (<15 min) Automated Microarray Hybridization. Clin. Chem.
51: 1836-1844
[Abstract]
[Full Text]
-
Smoot, L.M., Smoot, J.C., Smidt, H., Noble, P.A., Konneke, M., McMurry, Z.A., Stahl, D.A.
(2005). DNA Microarrays as Salivary Diagnostic Tools for Characterizing the Oral Cavity's Microbial Community. ADR
18: 6-11
[Full Text]
-
Pemov, A., Modi, H., Chandler, D. P., Bavykin, S.
(2005). DNA analysis with multiplex microarray-enhanced PCR. Nucleic Acids Res
33: e11-e11
[Abstract]
[Full Text]
-
Chandler, D. P., Jarrell, A. E.
(2004). Automated Purification and Suspension Array Detection of 16S rRNA from Soil and Sediment Extracts by Using Tunable Surface Microparticles. Appl. Environ. Microbiol.
70: 2621-2631
[Abstract]
[Full Text]
-
Nasedkina, T. V., Zharinov, V. S., Isaeva, E. A., Mityaeva, O. N., Yurasov, R. N., Surzhikov, S. A., Turigin, A. Y., Rubina, A. Y., Karachunskii, A. I., Gartenhaus, R. B., Mirzabekov, A. D.
(2003). Clinical Screening of Gene Rearrangements in Childhood Leukemia by Using a Multiplex Polymerase Chain Reaction-Microarray Approach. Clin. Cancer Res.
9: 5620-5629
[Abstract]
[Full Text]
-
Adamczyk, J., Hesselsoe, M., Iversen, N., Horn, M., Lehner, A., Nielsen, P. H., Schloter, M., Roslev, P., Wagner, M.
(2003). The Isotope Array, a New Tool That Employs Substrate-Mediated Labeling of rRNA for Determination of Microbial Community Structure and Function. Appl. Environ. Microbiol.
69: 6875-6887
[Abstract]
[Full Text]
-
Sebat, J. L., Colwell, F. S., Crawford, R. L.
(2003). Metagenomic Profiling: Microarray Analysis of an Environmental Genomic Library. Appl. Environ. Microbiol.
69: 4927-4934
[Abstract]
[Full Text]
-
Urakawa, H., El Fantroussi, S., Smidt, H., Smoot, J. C., Tribou, E. H., Kelly, J. J., Noble, P. A., Stahl, D. A.
(2003). Optimization of Single-Base-Pair Mismatch Discrimination in Oligonucleotide Microarrays. Appl. Environ. Microbiol.
69: 2848-2856
[Abstract]
[Full Text]
-
Chandler, D. P., Newton, G. J., Small, J. A., Daly, D. S.
(2003). Sequence versus Structure for the Direct Detection of 16S rRNA on Planar Oligonucleotide Microarrays. Appl. Environ. Microbiol.
69: 2950-2958
[Abstract]
[Full Text]
-
El Fantroussi, S., Urakawa, H., Bernhard, A. E., Kelly, J. J., Noble, P. A., Smidt, H., Yershov, G. M., Stahl, D. A.
(2003). Direct Profiling of Environmental Microbial Populations by Thermal Dissociation Analysis of Native rRNAs Hybridized to Oligonucleotide Microarrays. Appl. Environ. Microbiol.
69: 2377-2382
[Abstract]
[Full Text]
-
Reyes-Lopez, M. A., Mendez-Tenorio, A., Maldonado-Rodriguez, R., Doktycz, M. J., Fleming, J. T., Beattie, K. L.
(2003). Fingerprinting of prokaryotic 16S rRNA genes using oligodeoxyribonucleotide microarrays and virtual hybridization. Nucleic Acids Res
31: 779-789
[Abstract]
[Full Text]
-
Koizumi, Y., Kelly, J. J., Nakagawa, T., Urakawa, H., El-Fantroussi, S., Al-Muzaini, S., Fukui, M., Urushigawa, Y., Stahl, D. A.
(2002). Parallel Characterization of Anaerobic Toluene- and Ethylbenzene-Degrading Microbial Consortia by PCR-Denaturing Gradient Gel Electrophoresis, RNA-DNA Membrane Hybridization, and DNA Microarray Technology. Appl. Environ. Microbiol.
68: 3215-3225
[Abstract]
[Full Text]
-
Lapa, S., Mikheev, M., Shchelkunov, S., Mikhailovich, V., Sobolev, A., Blinov, V., Babkin, I., Guskov, A., Sokunova, E., Zasedatelev, A., Sandakhchiev, L., Mirzabekov, A.
(2002). Species-Level Identification of Orthopoxviruses with an Oligonucleotide Microchip. J. Clin. Microbiol.
40: 753-757
[Abstract]
[Full Text]
-
Urakawa, H., Noble, P. A., El Fantroussi, S., Kelly, J. J., Stahl, D. A.
(2002). Single-Base-Pair Discrimination of Terminal Mismatches by Using Oligonucleotide Microarrays and Neural Network Analyses. Appl. Environ. Microbiol.
68: 235-244
[Abstract]
[Full Text]
-
Small, J., Call, D. R., Brockman, F. J., Straub, T. M., Chandler, D. P.
(2001). Direct Detection of 16S rRNA in Soil Extracts by Using Oligonucleotide Microarrays. Appl. Environ. Microbiol.
67: 4708-4716
[Abstract]
[Full Text]
-
Mikhailovich, V., Lapa, S., Gryadunov, D., Sobolev, A., Strizhkov, B., Chernyh, N., Skotnikova, O., Irtuganova, O., Moroz, A., Litvinov, V., Vladimirskii, M., Perelman, M., Chernousova, L., Erokhin, V., Zasedatelev, A., Mirzabekov, A.
(2001). Identification of Rifampin-Resistant Mycobacterium tuberculosis Strains by Hybridization, PCR, and Ligase Detection Reaction on Oligonucleotide Microchips. J. Clin. Microbiol.
39: 2531-2540
[Abstract]
[Full Text]
-
Zhang, Y., Price, B. D., Tetradis, S., Chakrabarti, S., Maulik, G., Makrigiorgos, G. M.
(2001). Reproducible and inexpensive probe preparation for oligonucleotide arrays. Nucleic Acids Res
29: e66-e66
[Abstract]
[Full Text]
Top
Abstract
Introduction
