Previous Article | Next Article 
Applied and Environmental Microbiology, February 2001, p. 995-1000, Vol. 67, No. 2
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.2.995-1000.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Molecular Characterization of
Cycloinulooligosaccharide Fructanotransferase from Bacillus
macerans
Hwa-Young
Kim and
Yong-Jin
Choi*
Graduate School of Biotechnology, Korea
University, Seoul 136-701, Korea
Received 31 July 2000/Accepted 4 December 2000
 |
ABSTRACT |
Cycloinulooligosaccharide fructanotransferase (CFTase) converts
inulin into cyclooligosaccharides of 
-(2
1)-linked
D-fructofuranose by catalyzing an intramolecular
transfructosylation reaction. The CFTase gene was cloned and
characterized from Bacillus macerans CFC1. The CFTase gene
encoded a polypeptide of 1,333 amino acids with a calculated
Mr of 149,563. Western blot and zymography
analyses revealed that the CFTase with a molecular mass of 150 kDa
(CFT150) was processed (between Ser389 and Phe390 residue) to form a
107-kDa protein (CFT107) in the B. macerans CFC1 cells. The
processed CFT107 was similar in its mass to the previously purified
CFTase from B. macerans CFC1. The CFT107 enzyme was
produced by B. macerans CFC1 but was not detected from the
recombinant Escherichia coli cells, indicating that the
processing event occurred in a host-specific manner. The two CFTases
(CFT150 and CFT107) exhibited the same enzymatic properties, such as
influences of pH and temperature on the enzyme activity, the
intermolecular transfructosylation ability, and the ability of
hydrolysis of cycloinulooligosaccharides produced by the cyclization
reaction. However, the thermal stability of CFT107 was slightly higher
than that of CFT150. The most striking difference between the two
enzymes was observed in their Km values; the
value for CFT150 (1.56 mM) was threefold lower than that for CFT107
(4.76 mM). Thus, the specificity constant
(kcat/Km) of CFT150 was
about fourfold higher than that of CFT107. These results indicated that
the N-terminal 358-residue region of CFT150 played a role in increasing
the enzyme's binding affinity to the inulin substrate.
| |
TEXT |
Inulin is a polyfructan consisting
of a linear -(21)-linked polyfructose chain with a terminal
glucose residue, thus yielding a sucrose unit at the putative reducing
end, and serves as a carbohydrate reservoir in various plants, such as
chicory, dahlia, and Jerusalem artichoke. Several types of
inulin-decomposing enzymes have been reported, including
-D-fructan fructanohydrolase (EC 3.2.1.7; endoinulinase)
(2), -D-fructofuranosidase (EC 3.2.1.26; exoinulinase) (11), inulin fructotransferase
(depolymerizing) (EC 2.4.1.93) (13), and
cycloinulooligosaccharide fructanotransferase (4).
Cycloinulooligosaccharide fructanotransferase (CFTase) converts
inulin into cyclooligosaccharides consisting of six to eight -(21)-linked D-fructofuranoses (cycloinulohexaose
[CF6], cycloinuloheptaose [CF7], and cycloinulooctaose [CF8]).
Cyclofructans have a characteristic crown ether in the central part of
the molecule and can bind cationic molecules via charge-dipole
electrostatic interactions (15). Accordingly,
cyclofructans are considered to have potential capacities as a novel
host molecule in bioorganic chemistry, an ionophore, and an effective
protectant of liposome. To date, three CFTases have been isolated and
characterized, one each from Bacillus circulans OKUMZ31B
(5), B. circulans MCI-2554 (10),
and Bacillus macerans CFC1 (8). Only the CFTase
gene (cft) from B. circulans MCI-2554 has been
cloned and sequenced (GenBank/EMBL/DDBJ accession no. D87672)
(3). The CFTase of B. circulans MCI-2554 was
deduced to consist of 1,503 amino acids with a calculated molecular
mass of 167 kDa. Interestingly, the molecular mass of the purified CFTase from the culture supernatant of the Bacillus strain
was reported to be 110 kDa (10). However, there was no
report to explain why the calculated molecular mass of the cloned
CFTase is different from that of the purified CFTase.
Previously, we isolated a strain of B. macerans CFC1 from
soil which produced an extracellular CFTase (7), and
subsequently, the enzyme was purified and characterized
(8). The CFTase from B. macerans CFC1 had a
molecular mass of 110 kDa and was catalytically active as a monomer.
This enzyme was also found to catalyze coupling and disproportionation
reactions through an intermolecular transfructosylation. Therefore,
this enzyme could be used for synthesis of a variety of fructosyl sugar
derivatives whose physicochemical and functional properties are
different. Here, we describe the cloning, characterizing, and
processing of the CFTase from B. macerans CFC1.
Cloning of the cft gene from B. macerans
CFCl.
We determined the N-terminal amino acid sequence of the
previously purified CFTase of B. macerans CFC1 to be
FQASDRGTIFYLNL. Based on this N-terminal sequence and the
internal peptide sequence (YHLFYQMNPQG) of the CFTase from
B. circulans MCI-2554 (10), the following
primers were synthesized: C1 [5' GA(T/C) CGI GGI ACI ATI TT(T/C)
TA(T/C) CT 3'; I, inosine] and C5 [5' CAT (T/C)TG (A/G)TA
(A/G)AA IA(A/G) (A/G)TG (A/G)TA 3']. Using these
primers (20 pmol of each) and 100 ng of the genomic DNA as a template, a PCR was done for 30 cycles (94°C for 50 s, 46°C for 50 s, and 72°C for 50 s). An amplified 0.9-kb DNA fragment was
obtained and confirmed to be a part of the cft gene, based
on comparison with the cft gene of B. circulans
MCI-2554 (GenBank/EMBL/DDBJ accession no. D87672). To clone the entire
cft gene of B. macerans CFC1, the chromosomal DNA
was digested with SalI and KpnI and Southern
blotting was performed using the 0.6-kb BamHI fragment of
the PCR product as a probe. A genomic DNA fragment with a size of about
5.0 kb was detected as hybridizing with the probe DNA. Then, a genomic
library was constructed in Escherichia coli DH5
cells by
using the chromosomal DNA fragments which were obtained from the
SalI and KpnI digestion (from 4.3 to 6.5 kb) and
the pUC119 vector. White colonies on the Luria-Bertani (LB) agar
containing 50 µg of ampicillin/ml plus X-Gal
(5-bromo-4-chloro-3-indolyl--D-galactopyranoside) and isopropyl--D-thiogalactopyranoside (IPTG) were
selected and screened by colony hybridization. The recombinant plasmid
isolated from the positive clone was named pCFM (Table
1).
On the other hand, the
E. coli DH5
/pCFM cells grown in
the LB medium at 37°C overnight produced CFTase extracellularly as
well as intracellularly, and the ratio of the extracellular to
the
intracellular activity was about 7:3. The extracellular production
of
CFTase was confirmed by observing the clear zone formed around
the
colonies of the recombinant
E. coli strain on the LB agar
supplemented with ampicillin and inulin from dahlia (Fig.
1).
View larger version (75K):
[in this window]
[in a new window]
|
FIG. 1.
Clear-zone formation of recombinant E. coli
DH5 cells expressing cft gene. Cells were incubated at
37°C for 2 days in LB agar medium containing 50 µg of ampicillin/ml
and partially solubilized inulin. (A) E. coli DH5/pCFM;
(B) E. coli DH5/pUC119.
|
|
Characterization of the cft gene.
The complete
nucleotide sequence of the 5.0-kb SalI-KpnI
insert was determined (Fig. 2). The
deduced N-terminal amino acid sequence (FQASDRGTIFYLNL)
matched perfectly with the N-terminal sequence of the purified
CFTase from B. macerans CFC1 (corresponding to nucleotide
[nt] positions 1618 to 1659). An ATG codon (at position nt 1495) was
found at the position 41 amino acid residues upstream of the N terminus
of the purified enzyme. However, neither a potential signal peptide
between the ATG codon and the determined N-terminal sequence nor any
potential promoter sequence immediately upstream of the ATG codon could
be recognized. Instead, a long extended open reading frame from nt 451 to 4452 was identified, which could encode a 150-kDa protein of 1,333 amino acid residues containing a typical signal peptide at the N
terminus. This result raises an interesting question of whether the
long structural gene is actually expressed in the recombinant E. coli pCFM strain to produce the deduced 150-kDa protein with the
CFTase activity.
View larger version (65K):
[in this window]
[in a new window]
|
FIG. 2.
Nucleotide and deduced amino acid sequences of B. macerans CFC1 CFTase. Partial nucleotide and deduced amino acid
sequences of CFTase are presented. The complete sequence of the
cft gene in a 4,896-bp SalI-KpnI
fragment was assigned at the GenBank database under accession no.
AF222787. The sequences of peptide A (the intracellularly purified
CFTase from E. coli pCFMHis), peptide B (the extracellularly
purified CFTase from E. coli pCFMHis), and peptide C (the
extracellularly purified CFTase from B. macerans CFC1) were
determined by N-terminal sequencing. The vertical arrow indicates the
proteolytic cleavage site of the protein. An ATG codon at nt 1495 marked by a box.
|
|
To address this question, the following experiments were performed.
Firstly, sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) analysis of the cell extract of
E. coli pCFM was
performed,
and an apparent protein band was shown to be at 150 kDa,
with
no recognizable protein band at 110 kDa (data not shown).
Secondly,
we constructed two derivatives of pCFM (pCFP, deleted from nt
1 to 1037, and pCFQ, deleted from nt 408 to 1237) in which some
upstream regions of the N terminus of the purified CFTase had
been
deleted. The deleted plasmids were designed to contain a
sufficiently
large enough portion of the
cft gene for synthesis
of the
110-kDa protein (from Phe390 to Asn1333, named CFT107).
Nevertheless,
the CFTase activity was not detectable from both
the
E. coli
pCFP and
E. coli pCFQ cells. These results imply that
the
cft gene expressed in the
E. coli cells encodes
only the protein
of large size (150 kDa, named CFT150). Thus, to define
the precise
open reading frame for CFTase, we purified the CFTase
produced
by the recombinant
E. coli cells carrying the
plasmid pCFMHis,
which encodes the CFTase that is His tagged at its C
terminus,
and determined its N-terminal amino acid sequence. The
molecular
masses of the purified His-tagged CFTase from both the
intracellular
and extracellular fractions were estimated to be about
150 kDa
(data not shown). The N-terminal sequences of the intracellular
and extracellular CFTases were MRKVKRGK and SENRTVAGET,
respectively.
The recombinant
E. coli cells carrying
the plasmid pCFM
CRE2 (deleted
from position nt 1 to 365) produced a
similar level of CFTase
activity to that of the plasmid pCFM,
indicating that the 86-bp
upstream sequence of the translation start
site is sufficient
for transcription of the
cft gene in the
E. coli cells. A putative
Shine-Dalgarno sequence
(AGGAGG) was located at 8 bp upstream
of the translation
initiation codon (ATG). The putative
35 (TTCGAA)
and
10
(TATAA) elements were identified within the 86-bp upstream
sequence.
Taken together, the
cft gene was confirmed to encode
a
polypeptide of 1,333 amino acids, including a signal peptide
of 31 amino acids at the N terminus (Fig.
2). The molecular mass
and pI value
of the CFTase were 149,563 Da and 4.9, respectively.
Notably, the
deduced molecular mass of the truncated 944-residue
enzyme (Phe390 to
Asn1333) was 106,979 Da. This molecular mass
agreed well with that of
the purified CFTase from
B. macerans CFC1 (110 kDa, as
determined by SDS-PAGE). The deduced amino acid
sequence of the CFTase
showed an 81.5% identity with that of the
B. circulans
MCI-2554 CFTase (data not
shown).
CFT107 produced by E. coli reveals a CFTase
activity.
To confirm whether CFT107 (residues 390 to 1333)
produced by the recombinant E. coli actually has CFTase
activity, the plasmid pECFTN was constructed by using a pET23a
expression vector and the PCR cloning technique. The cft
gene on the recombinant plasmid was designed to encode the same protein
as the purified CFTase from B. macerans CFC1, except that it
had an ATG start codon and six His codons at the C terminus. When
E. coli BL(DE3) carrying pECFTN was induced with 0.5 mM IPTG
at 37°C in the LB medium, most of the His-tagged CFT107 protein was
detected in the intracellular insoluble fraction. Induction at 20°C
for 8 h with 0.5 mM IPTG resulted in an increased level of the
intracellular soluble fraction of the His-tagged CFT107. The CFTase
activity of the crude intracellular soluble fraction was 0.11 U/mg of
protein. However, no CFTase activity was detected in the extracellular
fraction, indicating that His-tagged CFT107 lacking a signal peptide
had failed to excrete into the culture media. His-tagged CFT107 was
purified from the crude intracellular soluble fraction by using
Ni-nitrilotriacetic acid affinity chromatography (Qiagen), showing a
specific activity of 2.16 U/mg.
CFTase is processed in B. macerans CFC1 but not in
E. coli.
Previously, the molecular mass of the
purified extracellular CFTase of B. macerans CFC1 was
determined to be 110 kDa. However, the CFTase produced by the
recombinant E. coli strain had a molecular mass of 150 kDa
as described above. Genomic Southern analysis showed that there is only
one copy of the cft gene in the genome of B. macerans CFC1 (data not shown). Hence, to examine whether B. macerans CFC1 produces the long transcript of the cft
gene encoding the 150-kDa protein (CFT150), reverse transcription-PCR was performed using the following primers: the sense-strand primer corresponding to nt 556 to 575 of the cloned 4,896-bp
SalI-KpnI fragment (RT1,
5'ACTGTTGCTGGAGAAACGCT3') and the antisense primer corresponding to nt 1637 to 1618 (RT3; 5'CCCCTATCACTTGCTTGGAA3'). A 1,082-bp DNA fragment was yielded from the total RNAs of
B. macerans CFC1, implying that B. macerans CFC1
cells synthesize the transcript encoding CFT150. As described above,
CFT107 produced by E. coli pECFTN showed a high level of
CFTase activity. Together, these results indicate that CFT150 is
processed into CFT107 in B. macerans CFC1 cells.
Next, to explore the processing of CFTase in
B. macerans CFC1 in more detail, we analyzed the protein synthesized
by the
E. coli cells carrying the
cft gene and
B. macerans CFC1 by using
Western blotting and zymography
techniques, using both denatured
and native gels. Only the CFT150
protein band was visualized from
both the intracellular and
extracellular fractions of the
E. coli pCFMHis cells when
detected with the probe of monoclonal anti-His
antibody (data not
shown). The equivalent result was observed
with the polyclonal
anti-CFT150 antibody that had been used to
recognize CFT107 (data not
shown). These data demonstrated that
the
E. coli cells
carrying the
cft gene did not synthesize CFT107
but produced
only the CFT150. To further understand the processing
event of CFTase
in the
B. macerans CFC1 cells, we analyzed the
kinetics of
CFTase production during the culturing of the
Bacillus strain. The CFTase activity was detected from the early stationary
phase (after 12 h in culture) and increased along with the culture
time (Fig.
3A). Western blot analyses
showed that CFT150 was also
detected from the intracellular fraction
after 12 h in culture,
and maximum production was observed after
24 h in culture (Fig.
3B). While CFT107 was detected not only from
the extracellular
samples but also from the intracellular samples,
CFT150 was not
detected from all the samples of the extracellular
fraction (Fig.
3C and D). Instead, two unknown proteins from the
extracellular
fraction at positions of about 216 kDa (Fig.
3C, lane 1)
and 170
kDa (lanes to 4) were observed, and both of the proteins
yielded
a clear zone on the zymogram (Fig.
3D). Since neither the
extracellular
CFTase band nor the intracellular CFTase protein band was
detected
from the 6-h culture, it seems likely that these 216- and
170-kDa
proteins may be other types of inulin-degrading enzymes, such
as endoinulinase or exoinulinase. The extracellular production
of
CFT107 was increased along with the culture time, and this
is well in
accordance with the extracellular CFTase activity profile
against the
culture time. Taken together, these results demonstrated
that CFT150
initially synthesized in
B. macerans CFC1 was processed
into
CFT107, possibly by a proteolytic enzyme. Based on the analysis
of the
determined N-terminal sequence of CFT107 (FQASDRGTIFYLNL)
and the deduced CFTase amino acid sequence, the cleavage site
was
determined to be between Ser389 and Phe390. Since both CFT150
and its
presumed N-terminal cleavage product with a mass of about
40 kDa were
not detected from all the extracellular samples, it
is possible that
the processing event might have occurred during
translocation of the
protein across the cell membrane. It is also
notable that the
processing occurred in a host-specific manner,
since CFT150 was
observed to be processed in the
Bacillus cells
but not in
the
E. coli cells. As of this time, the precise mechanism
by
which CFTase was processed is unclear. However, it is tempting
to
speculate that CFTase may be processed during translocation
across the
cell membrane by a specific protease residing in the
cytoplasmic
membrane of
B. macerans CFC1.
View larger version (40K):
[in this window]
[in a new window]
|
FIG. 3.
Expression pattern of the cft gene of
B. macerans CFC1. (A) Cell growth ( ) and extracellular
CFTase activity ( ). Cells were grown in the optimal production
medium containing 2% inulin at 37°C. (B and C) Western blot analyses
of intracellular (B) and extracellular (C) CFTase. Intracellular
samples were prepared as follows. The harvested cells taken at the
culture time were adjusted to an equal cell concentration by
resuspending with 50 mM phosphate buffer (pH 7.5) and lysing by
sonication. Equal amounts of proteins were subjected to SDS-8% PAGE.
The extracellular samples were 10-fold concentrated by Microcon-10
(cutoff, 10,000; Amersham). Equal volumes of samples were subjected to
SDS-8% PAGE and transferred to nitrocellulose membranes. The
transferred proteins were probed with the polyclonal rabbit anti-CFT150
antibody and detected using enhanced chemiluminescence (Amersham). (D)
Zymogram of the extracellular fraction. Samples were electrophoresed on
an 8% native-polyacrylamide gel containing incompletely solubilized
2% (wt/vol) inulin. The electrophoresed gel was washed two times for
15 min with 50 mM phosphate buffer (pH 7.5). The washed gels were then
incubated in the same buffer at 37°C. The activity bands appeared as
transparent bands on the gel. The zymogram was redrawn. Lane 1, 6 h sample; lane 2, 12 h; lane 3, 24 h; lane 4, 48 h; lane
5, purified His-tagged CFT150; lane 6, purified His-tagged CFT107.
|
|
Biochemical properties of CFT150 and CFT107.
As a first step
to explore the role(s) of the N-terminal 358-residue region of CFT150,
biochemical properties of purified His-tagged CFT150 and CFT107 were
compared. As shown in Table 2, all the
parameters tested, such as the product ratio of the enzymic reaction
(CF6:CF7), the optimal pH and temperature, and effects of metal ions on
the enzyme activity, were similar for the two enzymes. Furthermore,
both CFT150 and CFT107 were found to catalyze the disproportionation
and coupling reactions through intermolecular transfructosylation as
well as the cyclization reaction through intramolecular
transfructosylation. However, the thermostabilities of the two enzymes
were slightly different: CFT107 was about 10 to 30% more stable than
CFT150 at the range of 37 to 45°C, suggesting that the presumably
more compact structure of CFT107 might be responsible for its higher
thermostability. Interestingly, a striking difference between the two
enzymes was observed in their Km values; the
value for CFT150 (1.56 mM) was threefold lower than that for CFT107
(4.76 mM). The specificity constant
(kcat/Km) of CFT150 was
about fourfold higher than that of CFT107, indicating that CFT150 had a
higher affinity for the inulin substrate than CFT107. Also, the
specific activity of CFT150 was higher (3.58 U/mg) than that of CFT107
(2.16 U/mg). Together, these results illustrate that the N-terminal
358-residue domain of CFT150 might play a role in the substrate binding
of the enzyme.
As mentioned, it was confirmed that
B. macerans CFC1 CFTase
catalyzes not only the cyclization reaction but also the
disproportionation
and coupling reactions. In this study, we examined
whether the
two CFTases (CFT150 and CFT107) have the ability to
hydrolyze
cycloinulooligosaccharides (cyclization products).
Interestingly,
new inulooligosaccharides (di-, tri-, and
tetrasaccharides) were
detected with reduction of CF6 after a 6-h
incubation at 37°C
in both reaction mixtures catalyzed by CFT150 and
CFT107. Moreover,
even at 45°C, the optimal temperature for CFTase
activity, both
of the CFTases were found to also hydrolyze CF6, even
though the
reaction rate was very low. This finding demonstrates a new
property
of the CFTase of
B. macerans CFC1: an ability to
catalyze the
hydrolysis of
cycloinulooligosaccharides.
The current experimental results suggest that the overall
structure of CFTase (1,333 residues) consists of three distinguishable
domains: an N-terminal signal peptide (residues 1 to 31), an N-terminal
cleavable region (residues 32 to 389) as a substrate-binding domain,
and a core catalytic domain (residues 390 to 1333). The CFT150
synthesized in the
B. macerans CFC1 cells was processed into
CFT107,
which was secreted into the culture media. This implies that
the
cleaved N-terminal part of CFT150 may have some other role(s)
besides the substrate binding function described above. Many proteases,
growth factors, and hormones are known to have pro-sequences,
mainly at
their N-terminal position. Most pro-sequences play roles
in the folding
of the proteins as an intramolecular chaperon (
1,
12,
14),
transport of the proteins (
6), provision of signals
for
targeting proteins to subcellular location (
9), and
maintenance
of proteins in an inactive state under unsuitable
conditions (
6).
We are in the process of elucidating the
precise role(s) of the
cleaved N-terminal domain of
CFTase.
Nucleotide sequence accession number.
The nucleotide sequence
of the cft gene reported in this paper has been deposited in
the GenBank database and was assigned accession no. AF222787.
| |
ACKNOWLEDGMENTS |
We are grateful to In-Sung Choi, Korea Research Institute
of Bioscience and Biotechnology, for preparing the polyclonal
anti-CFT150 antibody.
This work was supported by a grant (971-0509-049-2) from the Korea
Science and Engineering Foundation.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Graduate School
of Biotechnology, Korea University, Seoul 136-701, Korea. Phone:
82-2-3290-3417. Fax: 82-2-923-9923. E-mail:
choiyj{at}mail.korea.ac.kr.
| |
REFERENCES |
| 1.
|
Eder, J., and A. R. Fersht.
1995.
Pro-sequence-assisted protein folding.
Mol. Microbiol.
16:609-614[CrossRef][Medline].
|
| 2.
|
Eom, S.-J.,
Y.-M. Kwon, and Y.-J. Choi.
1995.
Molecular cloning of Pseudomonas sp. inulinase gene and its expression in E. coli.
Korean J. Appl. Microbiol. Biotechnol.
23:550-555.
|
| 3.
|
Kanai, T.,
N. Ueki,
T. Kawaguchi,
Y. Teranishi,
H. Atomi,
C. Tomorbaatar,
M. Ueda, and A. Tanaka.
1997.
Recombinant thermostable cycloinulo-oligosaccharide fructanotransferase produced by Saccharomyces cerevisiae.
Appl. Environ. Microbiol.
63:4956-4960[Abstract].
|
| 4.
|
Kawamura, M., and T. Uchiyama.
1989.
Formation of a cycloinulo-oligosaccharide from inulin by an extracellular enzyme of Bacillus circulans OKUMZ 31B.
Carbohydr. Res.
192:83-90[Medline].
|
| 5.
|
Kawamura, M., and T. Uchiyama.
1994.
Purification and some properties of cycloinulo-oligosaccharide fructanotransferase from Bacillus circulans OKUMZ 31B.
Carbohydr. Res.
260:297-304[CrossRef].
|
| 6.
|
Kim, D.-W.,
S.-J. Lin,
S. Morita,
I. Terada, and H. Matsuzawa.
1997.
A carboxy-terminal pro-sequence of aqualysin I prevents proper folding of the protease domain on its secretion by Saccharomyces cerevisiae.
Biochem. Biophys. Res. Commun.
231:535-539[Medline].
|
| 7.
|
Kim, H.-Y.,
J.-B. Park,
Y.-M. Kwon, and Y.-J. Choi.
1996.
Production of cycloinulooligosaccharide fructanotransferase (CFTase) from Bacillus sp. CFC1.
J. Microbiol. Biotechnol.
6:397-401.
|
| 8.
|
Kim, H.-Y., and Y.-J. Choi.
1998.
Purification and characterization of cycloinulooligosaccharide fructanotransferase from Bacillus macerans CFC1.
J. Microbiol. Biotechnol.
8:251-257.
|
| 9.
|
Koelsch, G.,
M. Mares,
P. Metcalf, and M. Fusek.
1994.
Multiple functions of pro-parts of aspartic proteinase zymogens.
FEBS Lett.
343:6-10[CrossRef][Medline].
|
| 10.
|
Kushibe, S.,
K. Mitsui,
M. Yamagishi,
K. Yamada, and Y. Morimoto.
1995.
Purification and characterization of cycloinulooligosaccharide fructanotransferase (CFTase) from Bacillus circulans MCI-2554.
Biosci. Biotechnol. Biochem.
59:31-34[Medline].
|
| 11.
|
Kwon, Y.-M.,
H.-Y. Kim, and Y.-J. Choi.
2000.
Cloning and characterization of Pseudomonas mucidolens exoinulinase.
J. Microbiol. Biotechnol.
10:238-243.
|
| 12.
|
Marie-Claire, C.,
E. Ruffet,
A. Beaumont, and B. P. Roques.
1999.
The prosequence of thermolysin acts as an intramolecular chaperone when expressed in trans with the mature sequence in Escherichia coli.
J. Mol. Biol.
285:1911-1915[CrossRef][Medline].
|
| 13.
|
Park, J.-B., and Y.-J. Choi.
1996.
Purification and characterization of inulin fructotransferase (depolymerizing) from Arthrobacter sp. A-6.
J. Microbiol. Biotechnol.
6:402-406.
|
| 14.
|
Shinde, U. P.,
J. J. Liu, and M. Inouye.
1997.
Protein memory through altered folding mediated by intramolecular chaperones.
Nature
389:520-522[CrossRef][Medline].
|
| 15.
|
Takai, Y.,
Y. Okumura,
T. Tanaka,
M. Sawada,
S. Takahashi,
M. Shiro,
M. Kawamura, and T. Uchiyama.
1994.
Binding characteristics of a new host family of cyclic oligosaccharides from inulin: permethylated cycloinulohexaose and cycloinuloheptaose.
J. Org. Chem.
59:2967-2975.
|
Applied and Environmental Microbiology, February 2001, p. 995-1000, Vol. 67, No. 2
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.2.995-1000.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Yuan, X.-L., Goosen, C., Kools, H., van der Maarel, M. J. E. C., van den Hondel, C. A. M. J. J, Dijkhuizen, L., Ram, A. F. J.
(2006). Database mining and transcriptional analysis of genes encoding inulin-modifying enzymes of Aspergillus niger.. Microbiology
152: 3061-3073
[Abstract]
[Full Text]
-
Kim, K.-Y., Rhee, S., Kim, S.-I.
(2005). Role of the N-Terminal Domain of Endoinulinase from Arthrobacter sp. S37 in Regulation of Enzyme Catalysis. J Biochem
138: 27-33
[Abstract]
[Full Text]
Top
Abstract
Text
