Previous Article | Next Article 
Applied and Environmental Microbiology, April 2001, p. 1542-1550, Vol. 67, No. 4
Environmental Laboratory, U.S. Army Engineer
Research and Development Center, Vicksburg, Mississippi
391801; Department of Civil and
Environmental Engineering, Stanford University, Stanford, California
94305-40202; and Department of Geography
and Environmental Engineering, Johns Hopkins University, Baltimore,
Maryland 212183
Received 26 September 2000/Accepted 8 January 2001
Dredged harbor sediment contaminated with polycyclic aromatic
hydrocarbons (PAHs) was removed from the Milwaukee Confined Disposal
Facility and examined for in situ biodegradative capacity. Molecular
techniques were used to determine the successional characteristics of
the indigenous microbiota during a 4-month bioslurry evaluation. Ester-linked phospholipid fatty acids (PLFA), multiplex PCR of targeted
genes, and radiorespirometry techniques were used to define in situ
microbial phenotypic, genotypic, and metabolic responses, respectively.
Soxhlet extractions revealed a loss in total PAH concentrations of
52%. Individual PAHs showed reductions as great as 75% (i.e.,
acenapthene and fluorene). Rates of 14C-PAH mineralization
(percent/day) were greatest for phenanthrene, followed by pyrene and
then chrysene. There was no mineralization capacity for
benzo[a]pyrene. Ester-linked phospholipid fatty acid analysis
revealed a threefold increase in total microbial biomass and a dynamic
microbial community composition that showed a strong correlation with
observed changes in the PAH chemistry (canonical r2 of 0.999). Nucleic acid analyses showed
copies of genes encoding PAH-degrading enzymes (extradiol dioxygenases,
hydroxylases, and meta-cleavage enzymes) to increase by as much as 4 orders of magnitude. Shifts in gene copy numbers showed strong
correlations with shifts in specific subsets of the extant microbial
community. Specifically, declines in the concentrations of three-ring
PAH moieties (i.e., phenanthrene) correlated with PLFA indicative of
certain gram-negative bacteria (i.e., Rhodococcus spp.
and/or actinomycetes) and genes encoding for naphthalene-, biphenyl-,
and catechol-2,3-dioxygenase degradative enzymes. The results of this
study suggest that the intrinsic biodegradative potential of an
environmental site can be derived from the polyphasic characterization
of the in situ microbial community.
It is estimated that approximately
10% of all dredged materials (an estimated 14 to 28 million cubic
yards annually from U.S. waterways) are impacted with organic and/or
inorganic contaminants (22). Polycyclic aromatic
hydrocarbons (PAHs) are frequently encountered in the sediments of
navigation channels. Due to the fact that a single dredging operation
can involve the removal of thousands of cubic yards of sediment, the
physical handling of this material must be kept to a minimum for any
remediation strategy to be economically feasible. From this
perspective, bioremediation is an attractive treatment alternative.
For biotreatment efforts to be effective, however, it is essential that
indigenous microorganisms be present that are capable of degrading the
PAH mixtures under technically and economically sustainable
physicochemical conditions (i.e., within the confined disposal
facilities). Current treatment technologies do not allow for the
economical reuse of dredged materials as reclaimed soils (15). Bioremediation may fulfill this need, but in order
for bioremediation to work efficiently and successfully we need to learn more about and monitor the in situ interactions that occur between the extant microbiota and the contamination.
Microbiological processes can reduce hydrocarbon concentrations in
sediments to levels that no longer pose an unacceptable risk to the
environment or to human health (16). The microbial biodegradation of two- and three-ring PAHs has been extensively reviewed (2, 7, 8, 11) and, more recently, a variety of
microorganisms have been isolated and shown to metabolize PAHs with up
to four rings (18). Although individual species of
bacteria and bacterial consortia have been shown to metabolize PAHs in laboratory culture, identifying such a potential in a community of
microorganisms in situ is more difficult. Biodegrading organisms may or
may not be the predominant species, which directly affects our ability
to identify and quantify their presence. In addition, the
physicochemical properties of the immediate environment can have a
major influence on microbial physiology as well as contaminant bioavailability.
To fully identify the nature of a contaminant's impact on an extant
microbiota, a polyphasic approach that combines phenotypic and
genotypic measurements is necessary (14). The analysis of ester-linked phospholipid fatty acids (PLFA) provides an estimate of
the "viable" microbial biomass (assuming rapid degradation of
intact phospholipids upon cell death), as well as a `fingerprint' of
the in situ microbial community structure (20). However, shifts in microbial community composition can also be induced by
changes in other environmental factors such as temperature, pH,
moisture content, nutrient levels, etc. One way to minimize misinterpretation of in situ microbial community shifts (by PLFA) is to
tie these shifts to the abundance of genes related to the biodegradation of target contaminants. This can be accomplished by use
of a multiplex PCR approach designed to determine the presence and
abundance of several different biodegradative genes in a single sample.
In this work we hypothesized that the intrinsic biodegradative
potential of dredged sediment could be derived from a polyphasic characterization of the in situ microbial ecology. We used PLFA and DNA
analyses to track microbial community biomass and gene presence over
time from untreated and biotreated PAH-contaminated sediments.
Biotreatment of 16 EPA priority pollutant PAHs was measured via
bioslurry and microcosm tests. The reduction in PAH levels was
correlated with fluctuations in total microbial community biomass,
changes in the potential rates of 14C-PAH mineralization,
changes in PLFA-defined microbial taxa, and changes in the genetic
catabolic potential of the in situ microbiota.
Study material.
The sediment used in this study was obtained
from the Jones Island Confined Disposal Facility (CDF) (commonly known
as the Milwaukee CDF) operated by the Milwaukee Harbor Port Authority. The CDF is a 44-acre facility located in the South Milwaukee Harbor. The CDF was constructed in 1975 and has a maximum thickness of 10 meters. It serves as a disposal facility for maintenance-dredged materials unsuitable for open-lake disposal (6). These
sediments originated from the Milwaukee Harbor and Port Washington
Harbor, located 25 miles north of Milwaukee, Wis. In December 1998 sediment from the facility (56.5% sediment by weight and 43.5% water)
was mixed, later wet-sieved using a 2-mm sieve to promote homogeneity, stored in 55-gallon drums for 2 months at 4°C to allow for settling of fines, and then remixed before use in the bioslurry studies. Although disturbance and storage effects likely induced changes in the
indigenous microbiota, the focus of the study was on the bioslurry
manipulation of a contaminated material and not the characterization of
the extant biota within the CDF.
Bioslurry reactors.
The study consisted of five bioslurry
reactors operated over a 4-month period. Two reactors served as
controls (anaerobic and poisoned), and the remaining three served as
active (aerobic) reactors. Each bioreactor received 5.3 kg (wet weight)
of dredged material and 3.5 liters of modified Stanier's Basal Medium
(1) minus any carbon source. Reactors were continuously
stirred (by two impellers) at 350 rpm. Reactors contained three
diffuser stones that bubbled either argon (control reactors) or air
(aerobic reactors) supplied from compressed gas cylinders after passing
through double charcoal filters. All reactors were sealed to prevent
the ingress of atmospheric air.
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.4.1542-1550.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Succession of Phenotypic, Genotypic, and Metabolic
Community Characteristics during In Vitro Bioslurry Treatment of
Polycyclic Aromatic Hydrocarbon-Contaminated Sediments
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Contaminant chemistry. Initial PAH concentrations (Ti) were determined by analysis of four replicates from the sieved and mixed 55-gallon drum. Three samples from each bioslurry reactor were collected at T0.025, T1, T2, T3, and T4 months. These samples underwent Soxhlet extraction and gas chromatography-mass spectrometry (GC-MS) analyses for determination of PAH concentrations according to Environmental Protection Agency method 3540.
Radiorespirometry. A modified version of the method described by Fulthorpe et al. (9) was used to assess microbial activity potentials in the bioslurry reactors. Two grams (wet weight) of slurry material from each respective reactor was placed into 15-ml Teflon-lined screw-cap test tubes, to which was added 2.7 ml of a modified Stanier's Basal Media and a tracer amount of the 14C-labeled substrate. These secondary microcosms were run in triplicate and spiked with 20,000 dpm of either phenanthrene-9-14C (>95%) at a specific activity of 46.9 mCi/mmol (Sigma Chemical Co., St. Louis, Mo.), pyrene-4,5,9,10-14C (>95%) at a specific activity of 58.7 mCi/mmol (Sigma), chrysene-5,6,11,12-14C (98%) at a specific activity of 47.4 mCi/mmol (ChemSyn Laboratories, Lenexa, Kans.), benzo[a]pyrene-7-14C (>95%) at a specific activity of 16.2 mCi/mmol (Sigma), or acetic acid-1,2-14C (>95%) at a specific activity of 116 mCi/mmol (ICN Pharmaceuticals, Inc., Costa Mesa, Calif.). Glass fiber filters (Whatman, Maidstone, United Kingdom), 10 mm in diameter, saturated in 1 M barium hydroxide were used to trap evolved 14CO2. Test tubes and bioslurry reactors were incubated at room temperature (20°C). The test tubes were placed on tube rollers inclined at 45° and rotated at 10 rpm. Microcosms derived from the aerobic reactors were sparged daily with filtered compressed breathing air. The BaOH-saturated filters were collected daily over a 15-day period (5 days for the acetate treatment) and placed into 1.5 ml of scintillation cocktail (Ultima Gold; Packard Instruments Co., Downers Grove, Ill.) before counting them on a top count microplate scintillation counter (Packard Instruments). Filters were counted twice, and counts were corrected for background and counting efficiency using the external standard method described by the manufacturer.
Ester-linked PLFA analyses.
PLFA analysis has been detailed
elsewhere (19). Briefly, a 2-g (wet weight) aliquot from
5-g total (per reactor) of slurry material was extracted for 3 h
at room temperature in 6 ml of dichloromethane-methanol-water (1:2:0.8
[vol/vol/vol]). Amino-propyl solid-phase extraction columns (Supelco,
Bellefonte, Pa.) were used to separate the total lipid into neutral
lipid, glycolipid, and phospholipid fractions (17).
Phospholipid fatty acid methyl esters (from the polar lipid fraction)
were prepared for GC-MS by mild alkaline methanolic
transesterification. The resulting phospholipid fatty acid methyl
esters were dissolved in hexane containing methyl-nonadecanoate (50 pmol µl
1) as an internal standard and analyzed using a
gas chromatograph equipped with a DB-1 capillary column (50 m by 0.25 mm [inner diameter]; 0.1-µm film thickness; J&W Scientific, Folsom,
Calif.) and a flame ionization detector. Peak identities were confirmed using a gas chromatograph-mass selective detector (Hewlett-Packard GC6890-5973 MSD) with electron impact ionization at 70 eV. Areas under
the peaks were converted to concentrations, summed, and then normalized
to the gram weight extracted for biomass determinations. For community
comparisons, the percent contribution of each peak was calculated and
then normalized using an arcsine square-root transformation.
DNA isolation from bioslurry reactors.
Total DNA was
isolated from triplicate 500-mg slurry samples using a Mini Bead Beater
system essentially as described in Borneman et al. (5),
using a Fast DNA SPIN Kit (Bio 101, Vista, Calif.). Typically, 1 to 10 µg of DNA was recovered, although DNA was not quantitated due to the
small sample size and the coextraction of contaminants. Therefore, an
undiluted sample was taken to represent 50 mg of bioslurry per µl of
extract. Total DNA was suspended in 50 µl of Molecular Biology Grade
H2O (Five Prime-Three Prime, Boulder, Colo.) and stored at
20°C until further analysis. The emphasis of the study was on
determining the number of copies of genes per milligram of slurry
material and not per microgram of DNA recovered; therefore, the total
DNA quantity was not determined. The reproducibility of the extraction
efficiency was determined through the assay of triplicate independent extractions.
Primers and targets used in multiplex PCR. Details on the multiplex PCR assay and primers used will be published elsewhere (E. J. Perkins, unpublished data). Briefly, the primers target the following genes (written 5' to 3'): (i) toluene dioxygenase (todC1) from Pseudomonas putida F1 (23) (forward primer todC1F, GCGAGATAGAAGCGCTCTTG; reverse primer todC1R, GTATTGATACCTGGGAGGAAG; with an expected product size of 924 bp); (ii) toluene-4-monooxygenase (tmoA) from Pseudomonas mendocina KR1 (23) (forward primer tmoAF, GCTATGTTACCGAAGAGCAGC; reverse primer tmoAR, GGAATAGATCCCAGTACCAGG; with an expected product size of 900 bp); (iii) alkane hydroxylase (alkB) from Pseudomonas oleovorans TF4-1L (12) (forward primer alkB-f, TGGCCGGCTACTCCGATGATCGGAATCTGG; reverse primer alkB-r, CGCGTGGTGATCCGAGTGCCGCTGAAGGTG; with an expected product size of 869 bp); (iv) biphenyl dioxygenases designed from a multiple protein alignment of several extradiol dioxygenase enzyme large subunits (Perkins, unpublished) (forward primer bph-f, TGCAGCTACCACGGCTGGGCCTA; reverse primer bph-r2, GCNGCRAAYTTCCARTTRCANGG; with an expected product size of 295 bp); (v) catechol 2,3-oxygenase (xylE) from P. putida mt-2 pWW0 (Perkins, unpublished) (forward primer c2303f, CAAGGCCCACGACGTGGCNTT; reverse primer c2303r, CGGTTACCGGACGGGTCGAAGAAGT; with an expected product size of 202 bp); and (vi) naphthalene dioxygenase and 2-nitrotoluene dioxygenase (ntdAc) from Pseudomonas sp. strain JS42 (Perkins, unpublished) (forward primer 2NT-F, TTTGTGTGCGGYTACCACGGNTGGGG; reverse primer, 2NT-R, TCTCACCTACAAAGTTTTCCGCAAAARSCTTCCAGTT; with an expected product size of 321 bp).
Each subsample was analyzed by multiplex PCR in four dilutions (1/1, 1/10, 1/100, and 1/1,000). Quite often, PCR inhibitory compounds were present at too high a level to permit DNA detection in undiluted samples. Tenfold dilution was generally sufficient to permit successful PCR analysis. A 5-µl portion of each dilution was then added to each PCR reaction, so that the initial sample represents DNA from 5 mg of sediment. PCR reactions were composed of 50 mM KC1, 10 mM Tris-HCl (pH 8.3), 2.5 mM MgCl2, 5% dimethyl sulfoxide, 250 µg of bovine serum albumin per ml, 200 µM concentrations of each deoxynucleoside triphosphate, 8 pmol of each primer, 0.8 U of AmpliTaq Gold DNA polymerase (Applied Biosystems, Foster City, Calif.), and 5 µl of bioslurry DNA extract for a final reaction volume of 20 µl. PCR reactions were amplified in 200-µl thin-walled tubes using a PTC-200 thermal cycler (MJ Research, Watertown, Mass.). The thermal profile for amplification was 15 min of denaturation at 95°C followed by 35 cycles of 20 s of denaturation at 94°C, 1 min of annealing at 60°C, and 4 min of extension at 72°C. PCRs were finished by 10 min of extension at 72°C. Next, 20-µl PCR reaction mixtures were precipitated with 5 µl of 10 M ammonium acetate and 75 µl of ethanol. DNA was recovered by centrifugation at 14,000 × g in a microcentrifuge. DNA pellets were washed with 70% ethanol to remove residual salts. Pellets were then resuspended into 2 µl of SYBR Green I loading dye containing 17 mg of Blue Dextran (Sigma) per ml, 8 mM EDTA, and a 1/1,000 dilution of SYBR Green I (Molecular Probes, Beaverton, Oreg.). Molecular weights of the PCR products were estimated by comparison to the Genescan 2500 ROX size standard (Applied Biosystems), which was stained with SYBR Green I loading dye. DNA was analyzed on a 5% Long Ranger Hydrolink nondenaturing gel (FMC BioProducts, Rockland, Maine) using an ABI 377 automated DNA sequencer (Applied Biosystems). The gels (12 cm long and 0.4 mm thick) and running conditions were as described in the standard ABI protocols (Applied Biosystems).Determination of minimum detectable gene copy number. A band was scored as either present or absent at each size (base pair length) and dilution (1/1 to 1/10,000). For each band, the point of dilution to extinction was then determined, and an estimation of the total number of gene copies present was calculated. If we assume that the slurry samples have similar effects upon gene detection limits, the minimum detectable gene copy number would thus be equal to the maximum dilution factor at which the gene was detected in two or more replicates per microliter of sample DNA extract multiplied by the total volume (in microliters) of slurry DNA extract per gram of sample slurry.
Statistical analyses. Differences between treatments were assessed with a least-squared significant difference test. Correlations between contaminant and PLFA percentages and gene copy numbers were evaluated using Spearman rank order and canonical correlation analyses. Relationships among variables within a data set were examined by hierarchical cluster analysis (Wards method). All examinations were performed with the Statistica software package, version 5.0 (Statsoft, Inc., Tulsa, Okla.).
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Extractable PAH.
The active reactors showed a net loss in
total extractable PAH of approximately 52% (Table
1). Total PAH concentrations decreased from the Ti average of 115 ± 5.7 mg
kg1 to 56 ± 3.8 mg kg1 at
T = 4 months. The decline in total PAH was
statistically significant at an alpha value of 0.05. The greatest loss,
at 67%, occurred in the molecular weight (MW) 154 to 178 compounds
(acenaphthene, fluorene, phenanthrene, and anthracene), followed by a
52% loss in the MW 202 to 228 compounds (fluoranthene, pyrene,
chrysene, and benzo [a]anthracene), a 48% loss in the MW
252 compounds (benzo[b]fluoranthene, benzo[k]fluoranthene, and benzo[a]pyrene),
and a 26% loss in the MW 276 to 278 compounds
(benzo[g,h,i]perylene,
indeno[1,2,3-c,d]pyrene, and
dibenzo[a,h]anthracene).
|
1 to 95 ± 3.8 mg
kg1 at T4. The greatest reductions
occurred in PAHs of MW 128 to 143 (55%), MW 252 (27%), and MW 276 to
278 (28%). The loss observed in the MW 128 to 143 moieties was equal
to that observed in the active reactors. Reductions also occurred in
PAHs of MW 154 to 178 and MW 202 to 228, but to a lesser degree. The
difficulties encountered in killing the microorganisms in the control
reactors and the presence of a viable microbial population, may have
accounted for the 17% reduction in total PAHs observed over the
4-month period.
Microbial biomass and community composition (PLFA).
The
microbial biomass in the control reactors was always less than that in
the active reactors. Active reactor biomass was significantly greater
(least significant difference [LSD] test at 
= 0.10)
than that measured in the control reactors at 1 month (20,883 ± 5,810 versus 3,832 ± 1,367), 2 months (46,323 ± 9,488 versus 8,694 ± 1,129), and 3 months (13,773 ± 2,879 versus
4,798 ± 1,018) of the incubation period. Microbial biomass in the
active reactors also indicated a dynamic community, showing changes as a result of the nutrient addition. Although poisoning was initially effective in suppressing the microbiota in the control reactors, by the
end of the study the viable biomass in these reactors reached a level
comparable to that of the active reactors. However, none of this
biomass was culturable on nutrient agar.
|
|
Mineralization potentials (radiorespirometry).
Potential rates
of 14C-PAH mineralization in the active slurries generally
increased in the order of benzo[a]pyrene < chrysene < pyrene < phenanthrene (Table 2). For acetate and
phenanthrene, the potential activities or mineralization extents in the
active slurries were significantly greater than those measured in the control slurries at all time points sampled, other than the initial sampling (T0.025). Mineralization extents for
each of the PAHs examined were greatest at times
T1 months and T2 months
(Table 2), corresponding to the greatest
biomass levels and the initial introduction of nutrients.
Benzo[a]pyrene mineralization extents never exceeded the
impurity level of the radiolabel (5%).
|
Genetic catabolic potential.
Genes encoding enzymes associated
with aromatic degradation
naphthalene dioxygenase, biphenyl
dioxygenase, catechol 2,3-dioxygenase, toluene monooxygenase, and
alkane hydroxylasewere present in the original soil in copy numbers
below the detection limit of the assay (<106 copies per g
of soil). Copy numbers for each of the genes assayed increased to the
maximum detectable number (10,000 copies over the detection limit)
within the first and second months of incubation. To identify trends in
the data, the log was taken of the total number of gene copies detected
in each of the three active slurry reactors and plotted against the
time sampled (Fig. 3). Data below the
detection limit were plotted at 0.01. The copy number of three of the
catabolic genes assayednaphthalene dioxygenase, biphenyl dioxygenase,
and catechol 2,3-dioxygenaseincreased to and remained at elevated
levels from T2 on through the duration of the
study. The increase in copies of these genes corresponds with the
increase in microbial biomass and phenanthrene, fluorene, and chrysene mineralization rates. In contrast, toluene monooxygenase and alkane hydroxylase decreased in gene copy numbers to below detectable limits
after 3 and 4 months of incubation, respectively. Since the reactors
were operated in batch mode, the reduction in gene copy numbers could
not have been a result of washout but rather was a result of biological
mechanisms.
|
Correlations among microbial parameters.
Spearman's rank
order coefficients were used to correlate PLFA k-means defined
microbial communities (type 1 to type 3 as a relative percentage) to
the log of the total number of gene copies detected in the three active
reactors at each sampling period (Table
3). Toluene monooxygenase was positively
correlated to community 1 (a mixed community of gram-positive and
gram-negative bacteria). Naphthalene dioxygenase, biphenyl dioxygenase,
catechol 2,3-dioxygenase, and alkane hydroxylase were positively
correlated with community 3 (a mixed community including actinomycete
PLFA biomarkers). Community 2 (which comprised only of 16:0 and
16:1w7c) did not positively correlate with any of the catabolic genes
measured, whereas the trace components showed a positive correlation
with catechol 2,3-dioxygenase gene copies.
|
Correlations between microbial parameters and PAH profiles.
Correlation analyses were used to determine significant relationships
between microbial biochemical characteristics and PAH chemical
characteristics. PLFA and PAH concentrations were expressed as relative
percentages (of the respective total identified) and compared by
canonical (r2) and Spearman rank order
correlation (R) analyses. A high (r2
of 0.999) canonical correlation coefficient indicated that individual PAH and PLFA concentrations covaried throughout the bioslurry time
course. Spearman rank order analysis indicated a number of significant
relationships between individual PAH and PLFA percentages (Table
4). Only those PLFA and PAH that showed a
significant correlation (P < 0.05) are listed, and
only negative correlations (i.e., as PLFA percentage increases the PAH
percentage decreases) are highlighted. The PLFA showing a significant
negative correlation with the three ring PAHs (MW 152 to 178) include
17:0, 18:0, i17:0, 16:1w9c, 16:1w5c, br17:1, 10me16:0, 10me18:0, and
12me18:0, the same fatty acids (except for 18:0) that defined community
3 illustrated in Fig. 1b. Those PLFA used to define community 2 (16:0
and 16:1w7c) showed significant negative correlations with only the
five- and six-ring (MW 252 to 278) PAH moieties. Community 1 PLFA
(cy17:0, a15:0, and i15:0) showed significant negative correlations
with both three- and four-ring PAH moieties.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
A net reduction in extractable levels of PAH, primarily in the MW class from 128 to 278, was realized after 4 months of incubation. Although the active reactors were supplemented with N and P, no carbon or energy source was added. The resident microbiota were able to use the carbon and energy sources liberated from the slurried sediment to increase their biomass fivefold during the first 2 months of incubation. The subsequent decrease in biomass after T2 months likely resulted from a natural progression of biological mechanisms (i.e., parasitism and predation). The active reactors also showed a dynamic microbial taxon, one clearly evolving over the duration of the study. Thus, the observed fluctuations in viable biomass and community composition appear to have been driven by carbon and energy sources liberated from the slurried sediment.
By synthesizing results obtained by independent analytical methods, we were able to show significant relationships among changes in contaminant chemistry, microbial community structure, and microbial function. Throughout the study, rates of phenanthrene mineralization exceeded mineralization rates for pyrene and chrysene (both four-ring PAH moieties). We also observed a substantial number of significant negative correlations between the three-ring PAH moieties (MWs 154 to 178) and specific PLFA (Table 4). PLFA that correlated with the loss in the three-ring PAHs also covaried and defined a unique community type, identified as community 3 (see Fig. 1b). This community increased in relative abundance throughout the 4-month period (Fig. 2). The increase in relative abundance of this community correlated significantly with an increase in gene copy numbers for naphthalene dioxygenase, biphenyl dioxygenase, and catechol 2,3-dioxygenase (Table 3). Thus, the biodegradation of three-ring PAH moieties (the potential for which was confirmed by radiorespirometry) was identified in terms of an affect on in situ microbial community structure, which in turn was directly related to the in situ occurrence of genes coding for catabolic enzymes.
The relationships between PAH and PLFA can be further interpreted. For example, i17:0, a PLFA that correlated significantly with the loss of fluorene, phenanthrene, and anthracene, is common to species of Arthrobacter, Streptomyces, and Rhodococcus. Species of Rhodococcus are also known to synthesize 10me16:0 and 10me18:0, PLFA biomarkers that are most often associated with the actinomycetes (13). Species of Alcaligenes and Pseudomonas are known to be capable of mineralizing fluoranthene, and both genera show an abundance of cyclopropyl fatty acids in the phospholipid bilayer (18, 20). However, since most PLFA are distributed across multiple genera, overinterpretations can easily lead to ambiguous results. Therefore, based on the PLFA analysis alone, it can only be inferred that a taxon of bacteria known to synthesize a particular PLFA is present in the sample. But when taken in context with the detection of catabolic enzymes and the correlations that exist between PLFA biomarkers and individual PAH moieties, it can be inferred from Table 1 that the three-ring PAHs were being degraded by Rhodococcus species and the four-ring PAHs were being degraded by Alcaligenes and/or Pseudomonas species.
Although it is unlikely that the PAHs served as the sole source of
carbon and energy for the extant biota in the slurry reactors, the
above discussion indicates that the availability of these compounds had
a marked affect on the microbiology of the system. Values related to
PAH mineralization, PAH loss, and microbial growth furthers the
argument. For example, phenanthrene loss at between
T0.025 and T1 was
approximately 4 mg/kg. This loss occurred over a 30-day period. At
T0.025, phenanthrene mineralization was occurring at a rate of 2% day1, whereas at
T1 the mineralization rate had increased to 5%
day1. Taking an average mineralization rate of 3.5%
day1 and multiplying this value by the total amount of
PAH lost over the 30-day incubation period yields a value of 4.2 mg of
phenanthrene per kg. Thus, an estimated amount of phenanthrene that the
extant microbiota was capable of mineralizing over the 30-day period corresponds with the realized amount of phenanthrene lost in the same
time period.
The microbial biomass also increased between
T0.025 and T1. An
increase of 2,782 pmol of PLFA g1 corresponds to
approximately 5.6 × 106 cells/g (assuming 1 pmol of
PLFA is equivalent to 2 × 104 bacterial cells)
(3). Boonchan et al. (4) showed a bacterial consortia isolated from a creosote-contaminated soil to increase (using
a most-probable-number enumeration) by 104 cells over a
20-day period in which pyrene, at 0.25 mg/ml, was supplied as the sole
source of carbon in a basal salts medium. Although the magnitude of the
cell number increase was 2 orders of magnitude greater in our bioslurry
reactors, it must be noted that the organisms in the bioslurries were
exposed to PAH mixtures and not to a single moiety. In their study,
Boonchan et al. (4) found only a 102 increase
in bacterial biomass as a result of benzo[a]pyrene
exposure, which is 2 orders of magnitude less than that observed with
pyrene. It is very likely that carbon sources other than the PAH
contamination contributed to microbial growth and metabolism in our
active bioslurry reactors. However, the measured affect on microbial
community composition and activity suggest a strong biodegradation
component within the system.
The work previously described by Langworthy et al. (14) involved a riverine system, a natural environment quite distinct from the forced environment examined in this study. This difference provides one explanation for the contrast in microeukaryotic input observed between the two studies. The abrasive action of the slurry treatment likely limited the growth of many higher organisms, such as fungi, algae, and protozoa, which were identified as significant members of the microbiota in the riverine system. Also, in contrast to the survey of catabolic genes presented in this study, Langworthy et al. looked for gene abundance via direct probing of environmental DNA. Nevertheless, both systems showed the presence of nahA (naphthalene dioxygenase), nahH (catechol 2,3-dioxygenase), and alkB (alkane hydroxylase). Wikstrom et al. (21) also demonstrated the occurrence of catechol 2,3-dioxygenase in various soil types and that a relationship exists between gene abundance and PAH concentration. The results from all three of these studies further the argument presented by Ghiorse et al. (10) that PAH contamination can, in fact, be a basis for a unique food web. Bacteria enriched by the presence of the contamination can, in turn, enrich protozoa and other higher organisms.
The biodegradation potential of the Milwaukee CDF sediment was determined by correlating the microbial community structure (through PLFA analyses) to gene presence (using DNA analyses) to PAH loss (by chemical analyses). This is the first time the application of in situ biomarkers has been used to define the capability of PAH degraders in real sediment systems. This approach provides direct nonbiased measurements to define in situ biodegradation potential, which can be related to kinetic rates. Currently, laboratory studies are routinely performed to provide this information. The combination of microbial techniques reported here could minimize the future need for extensive laboratory treatability studies, resulting in more timely and more cost-effective treatment assessment. However, additional work is needed on other sediments and soils before the phenotype and genetic potentials of the extant microbiota can be used as biomarkers to assess the absolute intrinsic biodegradative potential. A more comprehensive assay of biodegradative genes is needed so as not to bias results toward any particular group of microorganisms. Continued research is also needed to expand beyond the assessment of an activity potential (DNA analyses) to a direct measurement of the expressed capability (RNA analyses). Overall, this work provides the framework for developing a new and useful approach with which to assess the potential bioavailability and treatability of PAHs in dredged sediments.
| |
ACKNOWLEDGMENTS |
|---|
This study was funded by the Strategic Environmental Research and Development Program (SERDP) and the U.S. Army Engineer Research and Development Center (ERDC).
We especially thank Margaret Richmond and Deborah Felt of the Environmental Laboratory (ERDC) for providing support and technical collaboration, which made this research possible. Additionally, we acknowledge Steven L. Larson and the Environmental Chemistry Branch (ECB), also at the Environmental Laboratory, ERDC, for their analytical and technical support.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: U.S. Army Environmental Research and Development Center, 3909 Halls Ferry Rd., Vicksburg, MS 39180-6199. Phone: (601) 634-2856. Fax: (601) 634-4844. E-mail: talleyj{at}wes.army.mil.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Atlas, R. M. 1995. Stainer's basal medium with trichlorophenoxyacetate, p. 444. In Handbook of media for environmental microbiology. CRC Press, Boca Raton, Fla. |
| 2. |
Atlas, R. M.
1981.
Microbial degradation of petroleum hydrocarbons: an environmental perspective.
Microbiol. Rev.
45:180-209 |
| 3. | Balkwill, D. L., F. R. Leach, J. T. Wilson, J. F. McNabb, and D. C. White. 1988. Equivalence of microbial biomass measures based on membrane lipid and cell wall components, adenosine triphosphate, and direct counts in subsurface sediments. Microb. Ecol. 16:73-84. |
| 4. |
Boonchan, S.,
M. L. Britz, and G. A. Stanley.
2000.
Degradation and mineralization of high-molecular-weight polycyclic aromatic hydrocarbons by defined fungal-bacterial cocultures.
Appl. Environ. Microbiol.
66:1007-1019 |
| 5. | Borneman, J., P. W. Skroch, K. M. O'Sullivan, J. A. Palus, N. G. Rumjanek, J. L. Jansen, J. Nienhuis, and E. W. Triplett. 1996. Molecular diversity of an agricultural soil in Wisconsin. Appl. Environ. Microbiol. 62:1935-1943[Abstract]. |
| 6. | Bowman, D. W., J. M. Brannon, and S. A. Batterman. 1996. Evaluation of polychlorinated biphenyl and polycyclic aromatic hydrocarbon concentrations in two great lakes dredged material disposal facilities. In Proceedings of the 11th Water Quality Symposium, Seattle, Wash. |
| 7. | Cerniglia, C. E. 1984. Microbial metabolism of polycyclic aromatic hydrocarbons. Adv. Appl. Microbiol. 30:31-71[Medline]. |
| 8. | Cerniglia, C. E. 1992. Biodegradation of polycyclic aromatic hydrocarbons. Biodegradation 3:351-368[CrossRef]. |
| 9. | Fulthorpe, R. S., A. N. Rhodes, and J. M. Tiedje. 1996. Pristine soils mineralize 3-chlorobenzoate and 2,4-dichlorophenyoacetate via different microbial populations. Appl. Environ. Microbiol. 62:1159-1166[Abstract]. |
| 10. | Ghiorse, W. C., J. B. Herrick, R. L. Sandoli, and E. L. Madsen. 1995. Natural selection of PAH-degrading bacterial guilds at coal-tar disposal sites. Environ. Health Perspect. 103(Suppl. 5):107-111. |
| 11. |
Gibson, D. I., and V. Subrahamanian.
1984.
Microbial degradation of aromatic hydrocarbons, p. 181-252.
In
D. T. Gibson (ed.), Microbial degradation of organic compounds1984. Mercel Dekker, Inc., New York, N.Y.
|
| 12. |
Kock, M.,
R. Oldenhuis,
M. Van der Linden,
P. Raatjes,
P. Vanlelyveld,
J. Kingma, and B. Witholt.
1989.
The Pseudomonas oleovorans alkane hydroxylase gene. Sequence and expression.
J. Biol. Chem.
264:5435-5441 |
| 13. |
Kroppenstadt, R. M.
1985.
Fatty acids and menaquinone analysis of actinomycetes and related organisms, p. 174-199.
In
M. Goodfellow, and D. E. Minnikin (ed.), Chemical methods in bacterial systematics1985. Academic Press, Ltd., London, England.
|
| 14. |
Langworthy, D. E.,
R. D. Stapleton,
G. S. Sayler, and R. H. Findlay.
1998.
Genotypic and phenotypic responses of a riverine microbial community to polycyclic aromatic hydrocarbon contamination.
Appl. Environ. Microbiol.
64:3422-3428 |
| 15. | Myers, T. E., and D. W. Bowman. 1999. Bioremediation of PAH-contaminated dredged material at the Jones Island CDF: materials, equipment, and initial operations. DOER Technical Notes Collection (TN DOER-C5). U.S. Army Research Engineer Development Center, Vicksburg, Miss. |
| 16. | Nalkes, D. V., and D. G. Linz. 1997. Environmentally acceptable endpoints in soil. American Academy of Environmental Engineers, Annapolis, Md. |
| 17. | Pinkart, H. C., R. Devereux, and P. J. Chapman. 1998. Rapid separation of microbial lipids using solid phase extraction columns. J. Microbiol. Methods 34:9-15[CrossRef]. |
| 18. |
Sutherland, J. B.,
F. Rafii,
A. A. Khan, and C. E. Cerniglia.
1995.
Mechanisms of polycyclic aromatic hydrocarbon degradation, p. 269-306.
In
L. Y. Young, and C. E. Cerniglia (ed.), Microbial transformation and degradation of toxic organic chemicals1995. Wiley-Liss, Inc., New York, N.Y.
|
| 19. |
White, D. C., and D. B. Ringelberg.
1998.
Signature lipid biomarker analysis, p. 255-272.
In
R. S. Burlage, R. Atlas, D. Stahl, G. Geesey, and G. Sayler (ed.), Techniques in microbial ecology1998. Oxford University Press, Inc., New York, N.Y.
|
| 20. | White, D. C., H. C. Pinkart, and D. B. Ringelberg. 1996. Biomass measurments: biochemical approaches, p. 99-101. In C. H. Hurst, G. Knudsen, M. McInerney, L. D. Stezenbach, and M. Walter (ed.), Manual of environmental microbiology. ASM Press, Washington, D.C. |
| 21. | Wikstrom, P., A. Wiklund, A. C. Andersson, and M. Forsman. 1996. DNA recovery and PCR quantification of catechol 2,3-dioxygenase genes from different soil types. Biotechnology 52:107-120. |
| 22. | Winfield, L. E., and C. R. Lee. 1999. Dredged material characterization tests for beneficial use suitability. DOER Technical Notes Collection (TN DOER-C2). U.S. Army Engineer Research Development Center, Vicksburg, Miss. |
| 23. | Zylstra, G., L. Wackett, and D. Gibson. 1989. Trichloroethylene degradation by Escherichia coli containing Pseudomonas putida F1 toluene oxygenase genes. Appl. Environ. Microbiol. 62:316-322[Abstract]. |
Applied and Environmental Microbiology, April 2001, p. 1542-1550, Vol. 67, No. 4
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.4.1542-1550.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Vinas, M., Sabate, J., Espuny, M. J., Solanas, A. M.
(2005). Bacterial Community Dynamics and Polycyclic Aromatic Hydrocarbon Degradation during Bioremediation of Heavily Creosote-Contaminated Soil. Appl. Environ. Microbiol.
71: 7008-7018
[Abstract] [Full Text] -
Dionisi, H. M., Chewning, C. S., Morgan, K. H., Menn, F.-M., Easter, J. P., Sayler, G. S.
(2004). Abundance of Dioxygenase Genes Similar to Ralstonia sp. Strain U2 nagAc Is Correlated with Naphthalene Concentrations in Coal Tar-Contaminated Freshwater Sediments. Appl. Environ. Microbiol.
70: 3988-3995
[Abstract] [Full Text] -
Corgie, S. C., Beguiristain, T., Leyval, C.
(2004). Spatial Distribution of Bacterial Communities and Phenanthrene Degradation in the Rhizosphere of Lolium perenne L.. Appl. Environ. Microbiol.
70: 3552-3557
[Abstract] [Full Text] -
Van Hamme, J. D., Singh, A., Ward, O. P.
(2003). Recent Advances in Petroleum Microbiology. Microbiol. Mol. Biol. Rev.
67: 503-549
[Abstract] [Full Text] -
Baldwin, B. R., Nakatsu, C. H., Nies, L.
(2003). Detection and Enumeration of Aromatic Oxygenase Genes by Multiplex and Real-Time PCR. Appl. Environ. Microbiol.
69: 3350-3358
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»