This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fredslund, L.
Right arrow Articles by Johnsen, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fredslund, L.
Right arrow Articles by Johnsen, K.
Agricola
Right arrow Articles by Fredslund, L.
Right arrow Articles by Johnsen, K.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, April 2001, p. 1613-1618, Vol. 67, No. 4
0099-2240/01/$04.00+0   DOI: 10.1128/AEM.67.4.1613-1618.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Development and Application of a Most-Probable-Number-PCR Assay To Quantify Flagellate Populations in Soil Samples

Line Fredslund,1,2 Flemming Ekelund,2 Carsten Suhr Jacobsen,1,* and Kaare Johnsen1

Geological Survey of Denmark and Greenland, DK-2400 Copenhagen NV,1 and Department of Terrestrial Ecology, Zoological Institute, University of Copenhagen, DK-2100 Copenhagen Ø,2 Denmark

Received 29 August 2000/Accepted 8 January 2001


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

This paper reports on the first successful molecular detection and quantification of soil protozoa. Quantification of heterotrophic flagellates and naked amoebae in soil has traditionally relied on dilution culturing techniques, followed by most-probable-number (MPN) calculations. Such methods are biased by differences in the culturability of soil protozoa and are unable to quantify specific taxonomic groups, and the results are highly dependent on the choice of media and the skills of the microscopists. Successful detection of protozoa in soil by DNA techniques requires (i) the development and validation of DNA extraction and quantification protocols and (ii) the collection of sufficient sequence data to find specific protozoan 18S ribosomal DNA sequences. This paper describes the development of an MPN-PCR assay for detection of the common soil flagellate Heteromita globosa, using primers targeting a 700-bp sequence of the small-subunit rRNA gene. The method was tested by use of gnotobiotic laboratory microcosms with sterile tar-contaminated soil inoculated with the bacterium Pseudomonas putida OUS82 UCB55 as prey. There was satisfactory overall agreement between H. globosa population estimates obtained by the PCR assay and a conventional MPN assay in the three soils tested.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Soil protozoa are generally small and more or less amoeboid or flexible (14). These characteristics make direct counting by microscopy very difficult, as especially heterotrophic flagellates and naked amoebae adhere to and are masked by the soil particles. Therefore, quantification of flagellates and naked amoebae in soil has traditionally relied on dilution culturing techniques and subsequent most-probable-number (MPN) calculations (9, 10, 45). These laborious methods may yield misleading results, as the culturable fraction of total protozoan populations is unknown.

The application of MPN dilution culturing techniques makes it possible to identify the various culturable taxa by microscopy and to estimate total protozoan numbers in environmental samples. However, identification beyond the genus level by light microscopy is difficult, and the procedure is most likely to underestimate total numbers of protozoa (14). Some genera, such as Spumella, Bodo, and Heteromita, are easily cultivated, whereas others are clearly underrepresented by this method (14). Also, the frequency distribution of different culturable taxa in the wells may not reflect that of the original sample (19), and it is not possible specifically to quantify taxonomic groups. The results depend on the choice of media for culturing (45) and the skills of the microscopists. Thus, MPN dilution culturing techniques are not likely to provide reliable estimates of subpopulations and of the true diversity within a sample. Hence, new detection methods need to be developed for naked amoebae and flagellates in soil (16, 20).

MPN-PCR assays for prokaryote nucleic acid detection have successfully been applied in both laboratory and field soil and sediment experiments (11, 35, 37, 40). Moreover, molecular detection of human pathogenic protozoa has been successful in clinical research (24, 28). To our knowledge, however, enumeration of soil protozoa by a molecular technique has not been reported. A major reason is the scarcity of DNA sequences from soil protozoa. Without such data, it is impossible to construct specific primers for molecular detection. Biases relating to soil DNA extraction and PCR amplification further complicate the development and application of a successful molecular tool for the detection of soil protozoa (7, 18, 44).

The two taxonomically related genera Cercomonas and Heteromita are very common and abundant heterotrophic soil flagellates and are therefore considered of great ecological importance (5, 6,14, 46). Heterotrophic flagellates and naked amoebae have a major impact on soil functions because of their predation on bacteria (8, 14, 47). Protozoan predation and competition from indigenous soil bacteria seem to be major reasons why introduced bacteria usually have a low survival rate when introduced into soil in both laboratory and field experiments (1, 13, 21). Thus, for specific applications such as bioremediation of contaminated soils, protozoa may affect the survival and degradation activity of introduced bacteria.

The purpose of this study was to develop a DNA-based method for the detection and quantification of specific flagellate species in soil. The resulting MPN-PCR assay was used for examining the growth and survival of the common soil flagellate Heteromita globosa in a gnotobiotic laboratory soil system including polycyclic aromatic compound (PAC)-degrading Pseudomonas putida as prey. We compared the method with three sterilized PAC-contaminated soils. To our knowledge, this is the first report of successful enumeration of soil protozoa by an MPN-PCR assay.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Soil microcosms. Three soils with different levels of PAC contamination were collected in September 1999 from a former asphalt and tar production plant at Ringe, Denmark. The site has been examined previously with regard to soil composition and amount of PACs (Table 1). Soil samples were taken 10 to 20 cm below the surface, air dried, and sieved through 4-mm mesh. The three soil samples were sterilized by electron irradiation (twice each at 20 kGy) at Risø National Laboratory, Roskilde, Denmark. During the irradiation procedure, the soil temperature never exceeded 55°C. The electron-irradiated samples were stored at 4°C for a maximum period of 4 weeks. Sterility was checked several times during the experiment by plate counting (bacteria and fungi) and dilution culturing in 96-well microtiter plates (protozoa), but no surviving organisms were found. Three microcosms were set up for each soil type (nine microcosms in total). Each microcosm (sterile 120-ml flasks) contained 20.0 g of soil. The microcosm soil was rewetted to 75% of water-holding capacity, except for 1.0 ml that was reserved for the bacterial inoculum. After 3 h of settling, each microcosm was inoculated with 1.0 ml of a bacterial suspension (108 CFU ml-1), and the soil was mixed carefully with a sterile spatula. The microcosms were incubated at 20°C in the dark.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Soil composition and content of PACs in the three soils used for this study

Sampling. We collected 1.0-g soil samples (dry weight) from each microcosm at days 7, 14, 30, 37, and 44 of the experiment. Each 1.0-g soil sample was suspended in 9.5 ml of 0.010 M phosphate buffer (pH 7.4). The resulting soil suspensions were used for dilution series for drop plating of the bacteria and as inocula for 96-well microtiter plate dilution culturing of the flagellates. Additional 0.50-g soil samples (dry weight) were collected from each microcosm at days 37 and 44 and stored at -20°C in 1.5-ml Eppendorf tubes for DNA extraction.

Bacteria. The bacterium used for inoculation of the sterile microcosms was P. putida OUS82 (29, 30). The strain had been chromosomally marked with the gene for green fluorescent protein (gfp), and mutant P. putida OUS82 UCB55 was tested and found to show the same metabolic pattern as the wild type (49). P. putida OUS82 UCB55 mineralizes naphthalene, phenanthrene, 1-hydroxy-2-naphthoic acid, and salicylic acid (30). The bacterial strain was kept at -80°C in 50% glycerol.

The culturing procedure was as follows. A small amount of the frozen culture was spread on Luria broth (LB) agar plates (34) supplemented with 1.0 g of glucose liter-1 and incubated for 24 h at 30°C. A single colony was transferred to 25 ml of LB in a 100-ml Erlenmeyer flask to grow for 18 h at 30°C on a rotary shaker (200 rpm). The culture was then washed three times in hydrocarbon minimal medium 2 (HCMM2) (42), resuspended in HCMM2, and incubated to starvation (24 h) at 30°C. A bacterial suspension of 105 CFU g of soil-1 was made in HCMM2, and 1.0 ml was inoculated into each soil microcosm. Numbers of CFU were determined on LB agar without antibiotics by a drop plating technique (23). All colonies expressed gfp when examined with an epifluorescence microscope (BX50; Olympus, Hamburg, Germany).

Flagellates. The Cercomonas sp. (similar to Cercomonas crassicauda) and H. globosa were originally isolated from a conventionally farmed agricultural soil in Foulum, Denmark (15). The cultures had been kept vivid at 10°C in 50-ml Nunc flasks by subsequent reinoculations with Neff Amoebae Saline (38) containing either 0.10 g of tryptic soy broth (Difco, Detroit, Mich.) liter-1 or a sterilized wheat grain as the feeding source for the bacteria that sustained the flagellate populations.

The number of contaminating bacteria introduced into the microcosms with the flagellate inocula was minimized by growing the flagellates for 2 weeks on heat-killed Escherichia coli K-12 (DSM 498) and subsequently on starved P. putida OUS82 UCB55 for 2 weeks before harvesting. The cultures were frequently inspected by microscopy to ensure vigorous flagellate activity and a small number of non-gfp-marked bacteria. No cysts (indicating declining activity) were observed in the cultures harvested for inoculation into the microcosms. At day 30 of the experiment, the soil microcosms were inoculated with 20 µl of each flagellate culture (Cercomonas sp. at 2 × 103 cells ml-1 and H. globosa at 2 × 104 cells ml-1), and the soil was again mixed with a sterile spatula.

The number of flagellates in the microcosms was estimated by an MPN method on microtiter plates as described by Darbyshire et al. (10) with modifications by Rønn et al. (45). The method is based on a threefold dilution series culturing technique performed with 96-well microtiter plates, with subsequent verification of growth in single wells by examination with an inverted microscope. We used 0.10 g of tryptic soy broth liter-1 as the culture medium as previously described (45). The microtiter plates were placed at 10°C in the dark and examined after 1 and 3 weeks of growth.

Construction of specific flagellate primers. The 18S ribosomal (rDNA) genes of the H. globosa and Cercomonas sp. clonal cultures were sequenced (L. Fredslund, F. Ekelund, and N. Daugbjerg, unpublished data). Two 700-bp 18S rDNA fragments were targeted for the MPN-PCR assay. Primer specificity was assessed by BlastN analysis (2) and by PCR results, which proved negative for DNA extracted from cultures of five related organisms (of the genera Heteromita, Thaumatomonas, and Cercomonas). These two tests indicated the specificity of the two sets of primers. However, when applied to DNA extracted from soil (see below), the Cercomonas primers produced a range of nonspecific banding patterns. These patterns were also present when the primers were used to amplify DNA from soils that had been inoculated only with H. globosa (data not shown). We therefore proceeded only with MPN-PCR detection of H. globosa. For H. globosa, the specific primer sequences were positioned in variable regions V4 and V7 of the 18S rRNA molecule (Heteromita-Forward: 5' TTGTCGGCCCACGGTTTCGT 3'; Heteromita-Reverse: 5' GAATCCTTTGTCGAACTATTTAGC 3').

DNA extraction from soil samples and PCR amplification. DNA was extracted from 0.5 g of soil (dry weight) with a FastDNA SPIN Kit for Soil (Bio 101, Vista, Calif.) by following the manufacturer's instructions. For the bead beating step, we used a FastPrep FP120 machine (Bio 101) (3).

PCR conditions for the specific primers were optimized with DNA extracted from the clonal cultures of the two flagellates. Optimization was achieved by varying the annealing temperature (58 to 62°C, in 1°C steps) and the number of amplification cycles (10 to 50, with steps of 10 cycles). Tenfold dilution series of DNA were used to examine the DNA detection limits with the various amplification conditions.

MPN-PCR conditions. Primers Heteromita-Forward and Heteromita-Reverse were used to perform quantitative detection of the 18S rDNA molecules of the H. globosa population in the microcosms by the MPN-PCR assay. Tenfold dilution series of each soil DNA extract were made with RNA- and DNase-free H2O, and 1 µl of each dilution was used as a template in a 25-µl PCR (26) with Ampli Taq Gold polymerase (Applied Biosystems, Foster City, Calif.). The second highest 10-fold dilution (10 µl into 90 µl) to produce the target 700-bp amplification product was selected as the starting point for triplicate threefold dilution series (10 µl into 20 µl) of each DNA sample to constitute the complete MPN-PCR matrix (18 tubes). The PCR program for the MPN-PCR assay was as follows: 10 min at 95°C; 50 cycles of 30 s at 95°C, 30 s at 58°C, and 1 min at 72°C; 6 min at 72°C; and final hold at 4°C. PCR was performed on a Techne (Genius) thermal cycler. Products were run in a 1.5% agarose gel and were ethidium bromide stained before detection with digital gel documentation equipment (Gel Doc 2000; Bio-Rad Laboratories, Hercules, Calif.). The numbers of positive and negative tubes that produced amplification products were scored for each sample.

Data analysis. MPN calculations were made with the computer-assisted method developed by Briones and Reichardt (4). Values were log transformed prior to two-way repeated-measures analyses of variance of CFU counts, MPN estimates made by the dilution culturing technique, and rDNA copy number estimates made by the MPN-PCR assay.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Bacteria. The growth and survival of P. putida did not differ significantly among the three soils (Fig. 1). The numbers of CFU increased by the same rate (~0.65 day-1) until a population level of ~109 CFU g of soil-1 was reached at day 14. Inoculation of flagellates into the microcosms on day 30 caused small and insignificant fluctuations in bacterial CFU.


View larger version (20K):
[in this window]
[in a new window]
 
FIG. 1.   Numbers of CFU of P. putida OUS82 UCB55 in three sterilized soils with low, intermediate, and high levels of PAC content, as measured by drop plating. The values given are log means for three replicate microcosms; error bars represent one standard error of the mean. No significant differences were seen between growth of the inocula and final populations in the three soils. An arrow indicates inoculation with two flagellate species on day 30 of the experiment.

MPN dilution culturing technique. After inoculation, both flagellate species multiplied vigorously in all soils. The numbers of Cercomonas cells increased to 1.1 × 103 g of soil-1 and 3.5 × 103 g of soil-1 for the low-PAC soil at days 37 and 44, respectively. The corresponding Cercomonas numbers in the intermediate-PAC soil were 1.7 × 103 g of soil-1 and 5.0 × 103 g of soil-1, and those in the high-PAC soil were 5.8 × 102 g of soil-1and 1.6 × 103 g of soil-1. There were significantly fewer cells of both H. globosa (Fig. 2A) and Cercomonas sp. in the most highly contaminated soil on day 37 (P < 0.01, as determined by the Tukey multiple-comparison test). On day 44, there were still significantly fewer Cercomonas sp. cells (P < 0.05) in the heavily contaminated microcosms, whereas H. globosa numbers were comparable in all three soils at day 44. 


View larger version (28K):
[in this window]
[in a new window]
 
FIG. 2.   (A) MPN dilution culturing technique estimates of numbers of H. globosa. Values are given as log means for three replicates; error bars represent one standard error of the mean (low: white columns; intermediate: light gray columns; high: dark gray columns). On day 37, the mean estimated numbers in the soil contaminated with the highest PAC levels were significantly lower than those in the soils contaminated with the medium and low levels. This difference was no longer present at day 44 (P < 0.01). The broken line indicates the level of inoculation. (B) MPN-PCR estimates of H. globosa rDNA copy numbers. Values are given as log means for three replicates; error bars represent one standard error of the mean. Columns are as defined for panel A. On day 37, the mean estimated numbers in the soil contaminated with the highest PAC levels were significantly lower than those in the soils contaminated with the medium and low levels. This difference was no longer present at day 44 (P < 0.05). The broken line indicates the level of inoculation.

MPN-PCR. On day 37, the MPN-PCR estimate of the H. globosa 18S rDNA copies in the most highly contaminated soil was significantly lower (P < 0.05) than the estimates obtained for the soils contaminated at low and medium levels (Fig. 2B). There was no significant difference among the rDNA copy numbers in the three soils at day 44. MPN-PCR was also performed on DNA extracted directly from samples of uninoculated sterile soils with the H. globosa-specific primers (data not shown). The presence of PCR products showed that all three irradiated soils contained a low background of intact indigenous H. globosa rDNA. As the copy numbers estimated by MPN-PCR did not rise above 103 g of soil-1 and as the dead cells and the free nucleic acids presumably had been degraded by the inoculated bacteria before flagellate inoculation on day 30, this background was disregarded in the calculations.

The two methods provided population estimates that agreed with respect to relative differences among the samples (Fig. 3). Regression analysis revealed a significant (P < 0.01) linear relationship between mean dilution culturing technique values (x) and rDNA copy estimates (y): y = 43x.


View larger version (14K):
[in this window]
[in a new window]
 
FIG. 3.   Estimates obtained by use of the MPN dilution culturing technique and the MPN-PCR assay developed for this study. Linear regression analysis between mean log population and rDNA copy number estimates revealed a significant (P < 0.01) linear relationship between the two, where y = 43x.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Population dynamics of the introduced organisms. P. putida OUS82 UCB55 faced no competition from other bacteria or predators at the time of introduction to the microcosms. Dead cells and other organic matter present from the sterilization procedure provided excellent growth conditions for the inocula and allowed them to persist at high densities in the soils. High levels of PACs did not affect the numbers of P. putida CFU.

The two introduced flagellates were able to survive and grow on P. putida in all of the three soils examined. For the most highly contaminated soil, the growth of H. globosa at days 30 to 37 was significantly reduced (Fig. 2A and B), probably because only a small fraction of the flagellate inoculum was able to adapt to the high levels of toxic compounds. These organisms, on the other hand, were able to establish a large population in the most highly contaminated soil from days 37 to 44.

The structure and moisture of the soil determine whether the flagellates gain access to the prey microhabitats in soil pores and aggregates (14, 17, 22, 41). In this study, attempts were made to provide optimal moisture conditions for the flagellate populations, but the high content of fine soil particles and the destruction of soil structure by mixing may have limited flagellate prey exploitation.

Motile P. putida OUS82 UCB55 was able to sustain high population densities in the presence of predatory flagellates under these very controlled conditions. We attribute this result to cryptic growth and successful bacterial colonization of the smallest micropores in the soil, where the bacteria were protected from flagellate predation (14, 31). Furthermore, single-species experiments have demonstrated that flagellate populations often form resting cysts before the prey has been fully exploited (15).

Enumeration of H. globosa by the MPN dilution culturing technique and the MPN-PCR assay. A comparison of Fig. 2A and B shows that the MPN-PCR estimates agreed very well with the estimates obtained with the traditional MPN dilution culturing technique. Figure 3 reveals a linear correlation between the two kinds of estimates, enhancing the reliability of the molecular detection results. The linear regression analysis suggested that the number of rDNA copies for H. globosa was about 40 to 50 per individual genome.

MPN estimates obtained by the dilution culturing technique and PCR were comparable because the experimental setup provided good growth conditions for the flagellates. The growth of H. globosa was vigorous during the experiment, and as active H. globosa is easily cultivated, it is reasonable to assume a high degree of flagellate survival and proliferation in the microtiter plates used for the culturing technique. Hence, we believe that our MPN dilution culturing technique provides good estimates of actual population sizes.

The suitability of PCR procedures for exact quantitative purposes has been questioned by Ferre (18) and Rongsen and Liren (44), who argued that MPN-PCR estimates are only semiquantitative. It is true that all MPN procedures provide estimates and not absolute quantification. The MPN-PCR quantification gives a conservative estimate bounded by the loss of target DNA during extraction and sample dilution and by the extent of PCR inhibition during amplification. Compared to quantitative competitive PCR assays, MPN-PCR assays are generally less influenced by violations of the underlying PCR assay assumptions. In competitive PCR assays, equal amplifications of template and standard nucleic acids can be difficult to ensure (33, 51). Furthermore, it is essential to run the PCR within the exponential phase of the amplification, when none of the PCR ingredients is yet depleted (12, 54). In MPN-PCR assays, the end point of DNA amplification is the terminal plateau phase of PCR, and the procedure is thus relatively robust and able to accommodate wide differences in amplification efficiency without affecting the estimation of DNA target copy numbers (7).

After the development and validation of new primers, an MPN-PCR assay can provide detailed knowledge of the dynamics of protozoan subpopulations in soil, because these primers can be designed to target various taxonomic groups. However, estimation by an MPN-PCR assay of total numbers of protozoa in an environmental sample is not possible, since soil protozoa belong to multiple and widely different taxonomic lineages, many of which have not yet been subject to sequencing studies (32, 39, 50).

The numbers of rDNA copies in protist genomes vary among different taxa. Rocio et al. (43) found that 69 isolates of the trypanosome flagellate Leishmania subgenus Viannia had between 20 and 40 rDNA copies per cell. The parasitic apicomplexan Theileria parva possesses only 2 copies (27), whereas the macronucleus of the free-living ciliate Tetrahymena thermophila contains 18,000 rDNA copies (52). These characteristics create the problem of converting estimates of rDNA copy numbers into numbers of organisms.

An MPN-PCR assay can be biased by suboptimal DNA extraction and PCR protocols. Care should therefore be taken to optimize every step of the procedure. With an MPN-PCR assay, it should be possible to detect few gene copies if they are present in a PCR tube. For multicopy genes, such as rDNA, the sensitivity of a PCR assay should therefore be improved, compared to that of a culturing assay, by a lowered detection limit. Any environmental contaminant present in a sample will be minimized as a consequence of dilution (7, 53). Hence, at medium and high template concentrations, the MPN-PCR assay is a strong tool. Environmental contaminants may significantly affect detection when only a low copy number of target DNA is present in a sample (25, 36).

Experience from the extraction of bacterial DNA suggests that no single method allows total recovery in all situations. We did not try to compare the extraction efficiencies of different ways of extracting protozoan DNA from soil. However, the FastDNA SPIN Kit for Soil has previously proven highly efficient and reproducible (3, 26) for the extraction of bacterial DNA from soil, as shown with spores from the gram-positive Actinomycetes, normally regarded as difficult to lyse (48). We therefore selected the FastDNA SPIN Kit for Soil for our extraction and purification of protozoan DNA from soil.

The application of MPN-PCR assays for soil protozoa is currently limited by the scarcity of molecular data, a factor which prevents the development of specific primers for the major soil protozoan lineages. Future construction of specific primers targeting various protozoan taxa can provide detailed knowledge about population dynamics that cannot be obtained by culturing methods or direct counting. When combined with sequencing of products from environmental samples, molecular detection also provides a method for identifying many previously unknown protozoan taxa. The present results should encourage further experimental work within the field of molecular detection of soil protozoa.


    ACKNOWLEDGMENTS

P. putida OUS82 UCB55 was kindly provided by Ulla Catrine Brinch. We are grateful to Peter Holter for revising the manuscript.

This work was funded by the Centre for Biological Processes in Contaminated Soil and Sediment (www.biopro.dk) under the Danish Environmental Research Program.


    FOOTNOTES

* Corresponding author. Mailing address: Geological Survey of Denmark and Greenland, Department of Geochemistry, Thoravej 8, DK-2400 Copenhagen NV, Denmark. Phone: 45 38 14 20 00. Fax: 45 38 14 20 50. E-mail: csj{at}geus.dk.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Acea, J. M., C. R. Moore, and M. Alexander. 1988. Survival and growth of bacteria introduced into soil. Soil Biol. Biochem. 20:509-516[CrossRef].
2. Altschul, S. F., T. L. Madden, A. A. Schaeffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402[Abstract/Free Full Text].
3. Borneman, J., P. W. Skroch, K. M. O'Sullivan, J. A. Palus, N. G. Rumjanek, J. L. Jansen, J. Nienhuis, and E. W. Triplett. 1996. Molecular microbial diversity of an agricultural soil in Wisconsin. Appl. Environ. Microbiol. 62:1935-1943[Abstract].
4. Briones, A. M., Jr., and W. Reichardt. 1999. Estimating microbial population counts by `most probable number' using Microsoft Excel. J. Microbiol. Methods 35:157-161[CrossRef][Medline].
5. Cavalier-Smith, T., and E. E. Chao. 1996. -1997. Sarcomonad ribosomal RNA sequences, rhizopod phylogeny, and the origin of euglyphid amoebae. Arch. Protistenkd. 147:227-236.
6. Cavalier-Smith, T. 1998. A revised six-kingdom system of life. Biol. Rev. 73:203-266[Medline].
7. Chandler, D. P. 1998. Redefining relativity: quantitative PCR at low template concentrations for industrial and environmental microbiology. J. Ind. Microbiol. Biotechnol. 21:128-140[CrossRef].
8. Clarholm, M. 1985. Interactions of bacteria, protozoa and plants leading to mineralization of soil nitrogen. Soil Biol. Biochem. 17:181-188[CrossRef].
9. Cutler, D. W. 1920. A method for estimating the number of active protozoa in the soil. J. Agric. Sci. 10:135-143.
10. Darbyshire, J. F., R. E. Whitley, M. P. Greaves, and R. H. E. Inkson. 1974. A rapid micromethod for estimating bacterial and protozoan populations in soil. Rev. Ecol. Biol. Sol 11:465-475.
11. Degrange, V., and R. Bardin. 1995. Detection and counting of Nitrobacter populations in soil by PCR. Appl. Environ. Microbiol. 61:2093-2098[Abstract].
12. Diaco, R. 1995. Practical considerations for the design of quantitative PCR assays, p. 84-108. In M. A. Innis, D. H. Gelfand, and J. J. Sninsky (ed.), PCR strategies. Academic Press, Inc., San Diego, Calif.
13. Eberl, L., R. Schulze, A. Ammendola, O. Geisenberger, R. Erhart, C. Sternberg, S. Molin, and R. Amann. 1997. Use of fluorescent protein as a marker for ecological studies of activated sludge communities. FEMS Microbiol. Lett. 149:77-83[CrossRef].
14. Ekelund, F., and R. Rønn. 1994. Notes on protozoa in agricultural soil with emphasis on heterotrophic flagellates and naked amoebae and their ecology. FEMS Microbiol. Rev. 15:321-353[CrossRef][Medline].
15. Ekelund, F. 1996. Growth kinetics of five common heterotrophic soil flagellates. Eur. J. Soil Biol. 32:15-24.
16. Ekelund, F., S. Christensen, R. Rønn, E. Buhl, and C. S. Jacobsen. 1999. An automated technique for most-probable-number (MPN) analysis of densities of phagotrophic protists with lux AB labelled bacteria as growth medium. J. Microbiol. Methods 38:177-182[CrossRef][Medline].
17. England, L. S., H. Lee, and J. T. Trevors. 1993. Bacterial survival in soil: effect of clays and protozoa. Soil Biol. Biochem. 5:525-531.
18. Ferre, F. 1992. Quantitative or semi-quantitative PCR: reality versus myth. PCR Methods Appl. 2:1-9[Medline].
19. Foissner, W. 1987. Soil protozoa: fundamental problems, ecological significance, adaptations in ciliates and testaceans, bioindicators, and guide to the literature, p. 69-212. In J. O. Corliss, and D. J. Patterson (ed.), Progress in protistology, vol. 2. Biopress, Ltd., Bristol, United Kingdom.
20. Foissner, W. 1999. Soil protozoa as bioindicators: pros and cons, methods, diversity, representative examples. Agric. Ecosyst. Environ. 74:95-112[CrossRef].
21. Habte, M., and M. Alexander. 1977. Further evidence for the regulation of bacterial populations in soil by protozoa. Arch. Microbiol. 113:181-183[CrossRef][Medline].
22. Heijnen, C. E., J. D. van Elsas, P. J. Kuikman, and J. A. van Veen. 1988. Dynamics of Rhizobium leguminosarum biovar trifolii introduced into soil: the effect of bentonite clay on predation by protozoa. Soil Biol. Biochem. 20:483-488[CrossRef].
23. Hoben, H. J., and P. Somasegaran. 1982. Comparison of the pour, spread, and drop plate methods for enumeration of Rhizobium spp. in inoculants made from presterilized peat. Appl. Environ. Microbiol. 44:1246-1247[Abstract/Free Full Text].
24. Homan, W. L., M. Vercammen, J. De Braekeleer, and H. Verschueren. 2000. Identification of a 200- to 300-fold repetitive 529 bp DNA fragment in Toxoplasma gondii, and its use for diagnostic and quantitative PCR. Int. J. Parasitol. 30:69-75[CrossRef][Medline].
25. Jacobsen, C. S. 1995. Microscale detection of specific bacterial DNA in soil with a magnetic capture-hybridization and PCR amplification assay. Appl. Environ. Microbiol. 61:3347-3352[Abstract].
26. Johnsen, K., Ø. Enger, C. S. Jacobsen, L. Thirup, and V. Torsvik. 1999. Quantitative selective PCR of 16S ribosomal DNA correlates well with selective agar plating in describing population dynamics of indigenous Pseudomonas spp. in soil hot spots. Appl. Environ. Microbiol. 65:1786-1789[Abstract/Free Full Text].
27. Kibe, K. M., M. O. K. Ole, V. Nene, B. Khan, B. A. Allsopp, N. E. Collins, S. P. Morzaria, E. I. Gobright, and R. P. Bishop. 1994. Evidence for two single copy units in Theileria parva ribosomal RNA genes. Mol. Biochem. Parasitol. 66:249-259[CrossRef][Medline].
28. Kikuta, N., A. Yamamoto, and N. Goto. 1996. Detection and identification of Entamoeba gingivalis by specific amplification of rRNA gene. Can. J. Microbiol. 42:1248-1251[Medline].
29. Kiyohara, H., N. Takizawa, and K. Nagao. 1992. Natural distribution of bacteria metabolizing many kinds of polycyclic aromatic hydrocarbons. J. Ferment. Bioeng. 74:49-51[CrossRef].
30. Kiyohara, H., S. Torigoe, N. Kaida, T. Asaki, T. Iida, H. Hayashi, and N. Takizawa. 1994. Cloning and characterization of a chromosomal gene cluster, pah, that encodes the upper pathway for phenanthrene and naphthalene utilization by Pseudomonas putida OUS82. J. Bacteriol. 176:2439-2443[Abstract/Free Full Text].
31. Kuikman, P. J., J. D. van Elsas, A. G. Jansen, S. L. G. E. Burgers, and J. A. van Veen. 1990. Population dynamics and activity of bacteria and protozoa in relation to their spatial distribution in soil. Soil Biol. Biochem. 22:1063-1074[CrossRef].
32. Kumar, S., and A. Rzhetsky. 1996. Evolutionary relationships of eukaryotic kingdoms. J. Mol. Evol. 42:183-193[CrossRef][Medline].
33. Lee, S. Y., J. Bollinger, D. Bezdicek, and A. Ogram. 1996. Estimation of the abundance of an uncultured soil bacterial strain by a competitive quantitative PCR method. Appl. Environ. Microbiol. 62:3787-3793[Abstract].
34. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning---a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
35. Michotey, V., V. Méjean, and P. Bonin. 2000. Comparison of methods for quantification of cytochrome cd1-denitrifying bacteria in environmental marine samples. Appl. Environ. Microbiol. 66:1564-1571[Abstract/Free Full Text].
36. Miller, D. N., J. E. Bryant, E. L. Madsen, and W. C. Ghiorse. 1999. Evaluation and optimization of DNA extraction and purification procedures for soil and sediment samples. Appl. Environ. Microbiol. 65:4715-4724[Abstract/Free Full Text].
37. Murakami, K., K. Kanzaki, K. Okada, S. Matsumoto, and H. Oyaizu. 1997. Biological control of Rhizoctonia solani AG2-2 IIIB on creeping bentgrass using an antifungal Pseudomonas fluorescens HP72 and its monitoring in fields. Ann. Phytopathol. Soc. Jpn. 63:437-444.
38. Page, F. C. 1988. A new key to freshwater and soil gymnoamoebae. Culture Collection of Algae and Protozoa Freshwater Biological Association, Ambleside, United Kingdom.
39. Patterson, D. J. 1999. The diversity of eukaryotes. Am. Nat. 154:S96-S124[CrossRef][Medline].
40. Picard, C., C. Ponsonnet, E. Paget, X. Nesme, and P. Simonet. 1992. Detection and enumeration of bacteria in soil by direct DNA extraction and polymerase chain reaction. Appl. Environ. Microbiol. 58:2717-2722[Abstract/Free Full Text].
41. Postma, J., C. H. Hok-A-Hin, and J. H. O. Voshaar. 1990. Influence of the inoculum density on the growth and survival of Rhizobium leguminosarum biovar trifolii introduced into sterile and non-sterile loamy sand and silt loam. FEMS Microbiol. Ecol. 73:49-58[CrossRef].
42. Ridgway, H. F., J. Safarik, D. Phipps, P. Carl, and D. Clark. 1990. Identification and catabolic activity of well-derived gasoline-degrading bacteria from a contaminated aquifer. Appl. Environ. Microbiol. 56:3565-3575[Abstract/Free Full Text].
43. Rocio, I., S. De Doncker, J. Gomez, M. Lopez, R. Garcia, D. Le Ray, J. Arevalo, and J. C. Dujardin. 1998. Relation between variation in copy number of ribosomal RNA encoding genes and size of harbouring chromosomes in Leishmania of subgenus Viannia. Mol. Biochem. Parasitol. 92:219-228[CrossRef][Medline].
44. Rongsen, S., and M. Liren. 1997. Review on quantitative PCR assay. J. Radioanal. Nuclear Chem. 221:137-142[CrossRef].
45. Rønn, R., F. Ekelund, and S. Christensen. 1995. Optimizing soil extract and broth media for MPN-enumeration of naked amoebae and heterotrophic flagellates in soil. Pedobiologia 39:10-19.
46. Sandon, H. 1927. The composition and distribution of the protozoan fauna of the soil. Oliver and Boyd, London, United Kingdom.
47. Thirup, L., F. Ekelund, K. Johnsen, and C. S. Jacobsen. 2000. Population dynamics of the fast-growing sub-populations of Pseudomonas and total bacteria, and their protozoan grazers, revealed by fenpropimorph treatment. Soil Biol. Biochem. 32:1615-1623[CrossRef].
48. Thirup, L., K. Johnsen, and A. Winding. 2000. Succession of Pseudomonas strains and actinomycetes on barley roots affected by the antagonistic Pseudomonas fluorescens strain DR54 and the fungicide imazalil. Appl. Environ. Microbiol. 67:1147-1153[Abstract/Free Full Text].
49. Tolker-Nielsen, T., U. C. Brinch, P. C. Ragas, J. B. Andersen, C. S. Jacobsen, and S. Molin. 2000. Development and dynamics of Pseudomonas sp. biofilms. J. Bacteriol. 182:6482-6489[Abstract/Free Full Text].
50. Vickerman, K. 1998. Revolution among the protozoa, p. 1-24. In G. H. Coombs, K. Vickerman, M. A. Sleigh, and A. Warren (ed.), Evolutionary relationships among protozoa. Kluwer Academic Publishers, Dordrecht, The Netherlands.
51. von Wintzingerode, F., U. B. Göbel, and E. Stackebrandt. 1997. Determination of microbial diversity in environmental samples: pitfalls of PCR-based rRNA analysis. FEMS Microbiol. Rev. 21:213-229[CrossRef][Medline].
52. Ward, J. G., P. Blomberg, N. Hoffman, and M. C. Yao. 1997. The intranuclear organization of normal, hemizygous and excision-deficient rRNA genes during developmental amplification in Tetrahymena thermophila. Chromosoma (Berlin) 106:233-242[CrossRef][Medline].
53. Wilson, I. G. 1997. Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 63:3741-3751[Medline].
54. Zachar, V., R. A. Thomas, and A. S. Goustin. 1993. Absolute quantification of target DNA: a simple competitive PCR for efficient analysis of multiple samples. Nucleic Acids Res. 21:2017-2018[Free Full Text].


Applied and Environmental Microbiology, April 2001, p. 1613-1618, Vol. 67, No. 4
0099-2240/01/$04.00+0   DOI: 10.1128/AEM.67.4.1613-1618.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Brad, T., Braster, M., van Breukelen, B. M., van Straalen, N. M., Roling, W. F. M. (2008). Eukaryotic Diversity in an Anaerobic Aquifer Polluted with Landfill Leachate. Appl. Environ. Microbiol. 74: 3959-3968 [Abstract] [Full Text]  
  • Pumphrey, G. M., Madsen, E. L. (2008). Field-Based Stable Isotope Probing Reveals the Identities of Benzoic Acid-Metabolizing Microorganisms and Their In Situ Growth in Agricultural Soil. Appl. Environ. Microbiol. 74: 4111-4118 [Abstract] [Full Text]  
  • Murase, J., Noll, M., Frenzel, P. (2006). Impact of Protists on the Activity and Structure of the Bacterial Community in a Rice Field Soil. Appl. Environ. Microbiol. 72: 5436-5444 [Abstract] [Full Text]  
  • Frias-Lopez, J., Klaus, J. S., Bonheyo, G. T., Fouke, B. W. (2004). Bacterial Community Associated with Black Band Disease in Corals. Appl. Environ. Microbiol. 70: 5955-5962 [Abstract] [Full Text]  
  • North, N. N., Dollhopf, S. L., Petrie, L., Istok, J. D., Balkwill, D. L., Kostka, J. E. (2004). Change in Bacterial Community Structure during In Situ Biostimulation of Subsurface Sediment Cocontaminated with Uranium and Nitrate. Appl. Environ. Microbiol. 70: 4911-4920 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fredslund, L.
Right arrow Articles by Johnsen, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fredslund, L.
Right arrow Articles by Johnsen, K.
Agricola
Right arrow Articles by Fredslund, L.
Right arrow Articles by Johnsen, K.