Next Article 
Applied and Environmental Microbiology, June 2001, p. 2395-2403, Vol. 67, No. 6
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.6.2395-2403.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Changes in Activity and Community Structure of
Methane-Oxidizing Bacteria over the Growth Period of Rice
Gundula
Eller and
Peter
Frenzel*
Max Planck Institute for Terrestrial
Microbiology, D-35043 Marburg, Germany
Received 31 October 2000/Accepted 9 March 2001
 |
ABSTRACT |
The activity and community structure of methanotrophs in
compartmented microcosms were investigated over the growth period of
rice plants. In situ methane oxidation was important only during the
vegetative growth phase of the plants and later became negligible. The
in situ activity was not directly correlated with methanotrophic cell
counts, which increased even after the decrease in in situ activity,
possibly due to the presence of both vegetative cells and resting
stages. By dividing the microcosms into two soil and two root
compartments it was possible to locate methanotrophic growth and
activity, which was greatest in the rhizoplane of the rice plants.
Molecular analysis by denaturing gradient gel electrophoresis and
fluorescent in situ hybridization (FISH) with family-specific probes
revealed the presence of both families of methanotrophs in soil and
root compartments over the whole season. Changes in community structure
were detected only for members of the Methylococcaceae and
could be associated only with changes in the genus
Methylobacter and not with changes in the dominance of
different genera in the family Methylococcaceae. For the
family Methylocystaceae stable communities in all
compartments for the whole season were observed. FISH analysis revealed
evidence of in situ dominance of the Methylocystaceae in
all compartments. The numbers of Methylococcaceae cells
were relatively high only in the rhizoplane, demonstrating the
importance of rice roots for growth and maintenance of methanotrophic
diversity in the soil.
 |
INTRODUCTION |
Wetland rice fields are an important
source of the greenhouse gas CH4. They contribute up to
20% (20 to 50 Tg year
1) of the global CH4
emissions (28, 34). It is thought that due to the demands
of the growing human population, cultivation of wetland rice will
increase during the next 3 decades by 60% (14).
Therefore, a reduction in CH4 emission from this source due
to microbial CH4 oxidation could play an increasingly
important role in the global CH4 budget.
Methane-oxidizing bacteria (methanotrophs) oxidize CH4 with
molecular O2 and use it as a carbon and energy source
(11, 23). Methane is produced as an end product of
anaerobic degradation of organic matter, whereas O2 in
flooded rice fields occurs only at the soil-floodwater interface and,
due to O2 leakage from the rice roots, in a thin soil layer
around the roots (3). Methanotrophs have been detected in
rice field soil and on rice roots (7, 9, 19, 43), but
until now not much has been known about the population structure and
dynamics of these microorganisms over the growth period of rice.
The Methanotrophs have been divided into two families: the
Methylococcaceae, belonging to the
subclass of the class
Proteobacteria, and the Methylocystaceae,
belonging to the
subclass of the Proteobacteria. The
family Methylococcaceae includes the genera
Methylobacter, Methylomonas, Methylomicrobium, Methylococcus,
Methylocaldum, and Methylosphaera, and the family
Methylocystaceae includes the genera Methylosinus
and Methylocystis (11). Physiological
differences between the two families are correlated with different
ecological preferences. Graham et al. (21), for example,
have shown that Methylosinus trichosporium outcompetes
Methylomonas albus in chemostat cultures under
N-limiting conditions. Amaral and Knowles (2) found that
in CH4-O2 countergradients members of the
Methylococcaceae grow preferentially at low CH4
concentrations and members of the Methylocystaceae grow
preferentially at high CH4 concentrations. In the complex
rice field ecosystem temporal and spatial changes in the microbial
environment occur and might result in shifts in the methanotrophic
community, which could influence overall CH4 oxidation
activity. A better understanding of the methanotrophic community
structure in rice fields is therefore important to understand this
dynamic ecosystem. It could also facilitate future attempts to activate
or affect CH4 oxidation in this or other systems with the
aim of reducing CH4 emission. A combination of process
measurements and molecular community analysis was used in this study to
compare community structure and actual activity of methanotrophs.
 |
MATERIALS AND METHODS |
Compartmented microcosms.
The microcosm system used in this
study was kindly provided by P. Bodelier (Netherlands Institute of
Ecology, Centre for Limnology, Maarssen, The Netherlands) and has been
described previously (6). In short, microcosms were built
of stainless steel cylinders (height, 12 cm; diameter, 9 cm). In the
center of each microcosm, the root compartment was separated by a
perforated stainless steel cylinder (diameter, 4 cm; hole diameter, 1 mm) that was covered with two layers of nylon gauze (mesh size, 0.45 µm). In each compartment, one porewater sampler was installed
vertically from below. Each porewater sampler consisted of a
hydrophilic porous membrane (pore diameter, 0.1 µm) fitted to a steel
needle and connected with plastic tubing for sampling. Porewater
samples were taken weekly by using evacuated vacuum tubes. The sampling
procedure and porewater analysis method used have been described
previously (30).
Soil.
Rice field soil was taken after plowing from an
Italian rice field in spring 1998 (Istituto Sperimentale per la
Cerealicoltura, Vercelli, Italy). This site has been used repeatedly to
study the microbial ecology of rice fields (30). The soil
is a sandy loam (Cambisol), and it was dried at room temperature,
ground with a jaw crusher, and sieved (hole size,
2 mm) before it was used in the microcosms. Each bulk soil compartment was filled with
495 g (dry weight) of soil, and each root compartment was filled
with 105 g (dry weight). The microcosms were flooded with demineralized
water and incubated at 25°C for 10 days before rice seedlings were transplanted.
Rice plants and growth conditions.
Rice seeds (Oryza
sativa type japonica variety KORAL) were germinated at
25°C for 12 days before transplanting. Planted microcosms were
incubated in a growth chamber with 12-h days and 12-h nights and a
light intensity of 0.22 to 0.55 mmol m
2 s
1.
The temperature was 25°C during the light phase and 20°C in the
dark. The humidity was adjusted to 70%.
Fertilization.
Each of the microcosms was fertilized weekly
with 2 ml of a fertilizer solution containing (per liter) 5.5 g of
urea, 4.2 g of KH2PO4, and 3.4 g of
KCl. The overall amount of fertilizer added during a 13-week growth
period was the amount of fertilizer added to rice fields during rice
growth, which was (per hectare) 160 kg of N, 140 kg of
P2O5, and 155 kg of
K2O2 in 1998 (30).
Flux measurements.
For CH4 flux measurement, the
microcosms were covered with glass cylinders (volume, 2 liters). In the
top of each glass cylinder a fan was installed to ensure complete
mixture of the headspace. The increase in the CH4
concentration was monitored for 2 h by taking 1-ml gas samples
(n = 18) through a butyl septum. The samples were
analyzed with a gas chromatograph equipped with a flame ionization detector. The in situ CH4 oxidation activity was determined
by comparing flux measurements before and after addition of
difluoromethane (CH2F2), a specific inhibitor
of methane oxidation (33). The inhibitor was injected into
the gas phase (final concentration, 1% [vol/vol]) immediately after
the microcosms were covered with the glass cylinders. Methane
concentrations were monitored for 2 h as described above. After
this the glass covers were removed, and the microcosms were allowed to
equilibrate with the amibient air for approximately 1 h outside
the growth chamber to remove the CH2F2. The in
situ oxidation value was calculated from the difference between
CH4 emission with the inhibitor and CH4
emission without the inhibitor. Methane flux was measured weekly in
four parallel microcosms. In situ CH4 oxidation was
determined every second week in an additional four microcosms of the
same plant age in order to allow direct comparison of fluxes with and
without inhibitor. The effect of the inhibitor was detectable within 20 to 40 min after it was added by the increase in CH4
emission compared to that of the untreated microcosms. The recovery of
the system after CH2F2 treatment was studied by
measuring the CH4 fluxes without the inhibitor 1 day and 2 weeks after the inhibitor treatment. After 1 day the CH4
emission from CH2F2-treated microcosms was about 70% of the CH4 emission from the controls. After 14 days the fluxes of the controls and the inhibitor-treated microcosms were equal, which allowed repeated inhibitor measurements with the same microcosms.
Division into compartments.
The bulk soil was taken directly
from the non-root-containing compartments of the microcosms and mixed
1:3 (by weight) with sterile tap water. The root-containing soil
(rhizosphere) was strongly attached to the roots and therefore was
removed together with the plants. To separate the soil, the roots were
washed twice in 125 ml of sterile tap water. The resulting soil
suspensions were subsequently pooled and are referred to below as the
rhizosphere. The roots were washed again with tap water to remove the
remaining soil particles. The rhizoplane was detached by adding sterile glass beads and tap water to the roots (ratio of roots to glass beads
to water, 1:10:10 [wt/wt/wt]) and shaking the preparation at 180 rpm
for at least 30 min. The resulting suspension was decanted and is
referred to below as the rhizoplane. The remaining roots were
thoroughly washed with sterile tap water and cut into small pieces.
Root pieces and sterile tap water (1:10, wt/wt) were homogenized for 2 min (Standard Blender 260: catalog no. FD-216; Buddeberg, Mannheim,
Germany). The resulting suspension is referred to below as the homogenate.
Potential methane oxidation.
Four microcosms containing
plants of each age (28, 57, and 92 days after transplanting [dap])
were used. Slurries of the soils in the two soil compartments of each
microcosm were prepared as described above. To study the potential
CH4 oxidation rates (MOR) on the rice roots, whole washed
roots were used. All samples were measured in three parallel
incubations. Soil slurries (20 ml) and roots were transferred into
sterile glass bottles (150 ml for slurries; 50 ml for roots), which
were closed with stoppers and supplemented with 10,000 ppm (by volume)
of CH4 each. The bottles were incubated at 25°C in the
dark and shaken at 120 rpm. Methane depletion was monitored by sampling
the headspace after the bottles were shaken thoroughly and then
performing an analysis with a gas chromtograph equipped with a flame
ionization detector. The first sample was taken 30 min after
CH4 was added, and this was followed by sampling at 2-h
intervals during the first 8 h of the experiments. Then the
bottles were left overnight and sampled the next day at 2-h intervals
again. From the mean CH4 depletion curves for the three
parallel samples from one microcosm, two linear regressions were
calculated. The first regression described the initial CH4
oxidation, which corresponded to the CH4 depletion at the
beginning of the measurements until the onset of fast (induced) CH4 oxidation. The second regression described the fast
(induced) CH4 oxidation period. The initial and induced MOR
were calculated from the slopes of these regression lines. The time lag
until the onset of induced CH4 oxidation was determined
from the point of intersection of the two regression lines.
Cell counting by the MPN technique.
All four compartments
(bulk soil, rhizosphere, rhizoplane, and homogenate) of one (20 and 72 dap), two (85 dap), or four (28, 57, and 92 dap) parallel microcosms
were used for most-probable-number (MPN) determinations. Each sample
was diluted in twofold steps in 2 × 8 parallel dilution series
(microtiter plates) by using ammonia mineral salt medium (modified as
described by Whittenbury et al. [47]) containing
0.5 g of NH4Cl per liter and 0.54 g of
KH2PO4 per liter; the pH was adjusted to 6.8. Trace element solution SL10a (2 ml liter
1),
MgSO4 (final concentration, 0.2 g
liter
1), and CaCl2 (final concentration,
0.015 g liter
1) were added after autoclaving
(19). Inoculated plates were incubated in gas-tight jars
at 25°C for 4 weeks in the dark. One of the two parallel microtiter
plates was incubated in an atmosphere containing 20% CH4
in synthetic air (20.5% O2 in N2): the other plate was incubated in synthetic air as a control for heterotrophic growth. Cell numbers and standard deviations for the eight parallel dilution series from one sample were calculated from positive dilutions
by using the code number system and table of Rowe et al.
(38). To illustrate the importance of the compartments for the whole system, the number of cells per total mass of each
compartment was calculated. On average, the total root biomasses per
plant were 0.24, 0.98, 4.46, 3.06, 2.74, and 3.37 g (dry weight)
for the plants 20, 28, 57, 71, 85, and 92 dap, respectively.
16S rRNA targeting oligonucleotide probes.
Different
oligonucleotide probes with high specificity for the two families of
methanotrophs have been described recently (17). The
following probes were used in this study (target sites refer to
Escherichia coli numbering [12]): M
450
(5'ATCCAGGTACCGTCATTATC3'), M
84
(5'CCACTCGTCAGCGCCCGA3'), and M
705
(5'CTGGTGTTCCTTCAGATC3'). For probe M
450 no
nonmethanotrophic pure culture with sequence identity to the probe was
found in the EMBL database. The sequence of Methylocella
(15), a new genus of acidotolerant
-protebacterial methanotrophs, exhibited two mismatches with this probe and
therefore was not detected under the hybridization conditions used. For probe M
84 organisms like Thiorhodovibrio sibirica,
Thiothrix eikelboomii, and Thiobacillus neapolitanus (a
halophile), as well as Ectothiorodospira strains and
phototrophic bacteria, exhibited no mismatches. However, parallel
hybridization with probe M
84 and probe M
705, which showed no
identity to cultures other than methanotrophic cultures, and adjustment
of specificity with Thiobacillus thiooxidans allowed in situ
quantification of both families of methanotrophs with these probes. The
probes were synthesized and labeled with fluorochromes (fluorescein,
Texas red, CY5) by MWG Biotech (Ebersberg, Germany).
Fixation and whole-cell hybridization.
Samples of diluted
soil slurries (2 ml of a 1:100 dilution), rhizoplane (1 to 2 ml), and
homogenate (1 ml) were centrifuged at 13,000 × g for 8 min. The pellets were resuspended in 100 µl of phosphate-buffered
saline (PBS) (pH 7.0) and were fixed with 300 µl of 4%
paraformaldehyde (in PBS) for 2 h at room temperature. After they
were washed five times with PBS, the pellets were resuspended in
ethanol-PBS (1:1) and stored at
20°C until hybridization.
The hybridization protocol used was modified from the protocol of
Assmus et al. (5) and has been described in detail
previously (17). Prior to hybridization, 20 µl of fixed
rhizoplane or homogenate suspension or 40 µl of soil suspension was
transferred to eight-well coated slides and left to dry at room
temperature overnight. Autofluorescence was quenched with 10 µl of
0.01% (wt/vol) toluidine blue 0 (Sigma, Steinheim, Germany) in PBS (pH
7.0) for 30 min at room temperature. After they were rinsed with
distilled water, the slides were washed in 50, 80, and 96% aqueous
ethanol and hybridized with 20% formamide in hybridization buffer for
2 to 2.5 h at 46°C as described previously (5, 17).
Samples were hybridized with universal eubacterial probe Eub338
(1), probe M
450 (Methylocystaceae
[17]), and probes M
84 and 705 (Methylococcaceae [17]) at the same time, and
the DNA was stained with DAPI (4',6-diamidino-2-phenylindole). The
slides were analyzed by confocal laser scanning microscopy with a Leica
DMR XE microscope, an ×63 oil immersion lens, and TCS NT 1.6.582 software. Cells were counted by comparing images obtained for the four
different single channels (DAPI, Eub338, M
450, and M
84 plus 705).
The number of DAPI-stained cells counted was the sum of all of the DAPI
signals detected. The number of eubacterial cells was the number of
DAPI- and Eub338-positive cells, and the methanotrophs counted were
stained with DAPI, Eub338, and the family-specific probe.
DNA extraction.
Soil slurries (2 ml, undiluted) or 5-ml
portions of either rhizoplane or homogenate suspensions were pelleted
by centrifugation in 2-ml screw-cap tubes (13,000 × g,
5 min). The pellets were stored at
20°C until DNA was extracted.
The DNA extraction protocol used was based on cell lysis with 10%
sodium dodecyl sulfate in a cell disrupter, followed by DNA
purification with ammonium acetate precipitation and isopropanol
precipitation. The procedure was described in detail by Henckel et al.
(24). To avoid interference from humic acids during PCR
amplification, DNA derived from soil samples was purified further
by using polyvinylpolypyrrolidine (Sigma-Aldrich Chemie GmbH,
Steinheim, Germany), columns and a modified protocol described by
Holben et al. (26). Polyvinylpolypyrrolidine was suspended
overnight in 5 M HCl, and then washed with Tris-EDTA buffer (10 mM
Tris, 1 mM EDTA; pH 8.0), and the pH was adjusted to 8.0 with NaOH.
Spin columns (Micro Bio-Spin chromatography columns: BioRad, Munich,
Germany) were filled with 2 ml of this suspension and packed and dried
by centrifugation (375 × g, 1 min) before they were
loaded with 150 µl of DNA extract. DNA concentrations were estimated
by spectrometry at a wavelength of 260 nm (GeneQuant spectrophotometer;
Pharmacia Biotech, Uppsala, Sweden) by using 1:10 dilutions in water.
For PCR amplification, all DNA concentrations were adjusted to 2 ng of
DNA µl
1.
PCR amplification.
The DNA was amplified by using three
primer sets targeting 16S rRNA genes: a universal eubacterial primer
set (primers 533f and 907r [45]), the 10
primer set
(primers 197f and 533r [42]) targeting methylotrophs
that use the ribulose monophosphate (RuMP) pathway for carbon
assimilation (including members of the Methylococcaceae), and the 9
primer set targeting methylotrophs that use the serine pathway for carbon assimilation (including members of the
Methylocystaceae) (42). Additionally, one
primer set for the
-subunit of the methanol dehydrogenase gene,
which is present in all gram-negative (proteobacterial) methylotrophs,
mxaF (primers 1003f and 15621r [32]), was used. For all
primer pairs a GC clamp was attached to the 5' end of one primer for
subsequent denaturing gradient gel electrophoresis (DGGE) analysis. The
PCR protocols and primers used have been described in detail previously
(24).
DGGE.
DGGE analysis was carried out as described by Henckel
et al. (24) at 60°C and 150 V for 5 h (Dcode
system; BioRad). Denaturing gradients from 40 to 70% were used for the
primer set 9
amplification products, whereas for the amplification
products of all other primer sets gradients from 35 to 70% were used
(80% corresponded to 6.5% acrylamide, 5.6 M urea, and 32% deionized
formamide). Gels were stained after electrophoresis in 1:30,000-diluted
SYBR green I (Biozym, Hess Oldendorf, Germany) for 30 min and were scanned with a Storm 860 phosphor imager (Molecular Dynamics).
Reamplification and sequencing of DGGE bands.
DGGE bands
were illuminated with a Dark Reader transilluminator (Clare Chemical
Research, Ross on Wye, United Kingdom), excised, suspended in 200 µl
of PCR grade water, and stored at
20°C. Band purity was controlled
by reamplification and subsequent DGGE. Only reamplification products
which resulted in a single band with the predicted electrophoretic
mobility were sequenced. For sequencing, PCR products were purified by
using QIAQuick PCR purification columns (QIAGEN GmbH, Hilden, Germany).
Sequencing reactions were performed by using an ABI-Dye terminator
cycle sequencing kit (Perkin Elmer Applied Biosystems, Weiterstadt,
Germany) as specified by the manufacturer. Cycle sequencing products
were purified by using Microspin G-50 columns (Pharmacia Biotech,
Freiburg, Germany) and were analyzed with an ABI 373 DNA sequencer
(Perkin Elmer Applied Biosystems).
Sequences were analyzed by using the Lasergene software package (DNA
STAR, Madison, Wis.), 16S ribosomal DNA (rDNA) sequences
were aligned
and phylogenetically analyzed with the ARB software
package (1998 database, including about 13,000 sequences [
41])
by
using maximum-parsimony equations and the Jukes-Cantor correction.
All
sequences were also checked for the closest relatives by performing
a
BLAST search with a recent EMBL data library. The sequences
of the
closest relatives found in EMBL data library were aligned
and added to
the ARB database before trees were constructed. Phylogenetic
trees were
constructed by the neighbor-joining method (ARB) by
using complete 16S
rDNA sequences of members of the

and

subclasses
of the
Proteobacteria, as well as other species, whose sequences
were closely related to the partial sequences retrieved in this
study.
The partial 16S rDNA sequences were placed in the neighbor-joining
tree
by keeping the tree topology constant (
31). Sequences
derived
with the
mxaF primer set were manually aligned with
sequences
retrieved from the GenBank database on the basis of amino
acid
sequences. Trees were constructed by using the neighbor-joining
method and the protein correction algorithm PAM included in the
ARB
software
package.
Nucleotide sequence accession numbers.
The accession numbers
of the nucleotide sequences determined in this study are as follows:
sequences obtained from 10
amplifications, AJ300106 to AJ300120;
sequences obtained from 9
amplifications, AJ300121 to AJ300127; and
methanol dehydrogenase gene sequences, AJ300128, AJ300129, AJ300159,
and AJ300160.
 |
RESULTS |
Methane oxidation activity and cell numbers.
The level of in
situ CH4 oxidation in the microcosms decreased from 70% at
the beginning of plant growth to negligible values around 60 dap (Fig.
1). In parallel, the level of
CH4 emission increased from 25 to 55 mg of CH4
m
2 h
1 and then remained stable until the
end of the season (Fig. 1). The in situ CH4 oxidation
activity was correlated with the plant growth phase, as the
decline coincided with the onset of the reproductive growth
phase.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 1.
In situ CH4 oxidation and emission from rice
microcosms during the growth period. In situ oxidation was calculated
from differences in the fluxes with and without the inhibitor
CH2F2. The error bars indicate standard errors
based on four parallel microcosms.
|
|
The porewater CH
4 concentrations were lower in the
rhizosphere than in the bulk soil for the whole growth period but never
reached values less than 500 µM (Fig.
2). In the rhizosphere,
the
CH
4 concentration was influenced by CH
4 loss
via the rice
plants, as well as by CH
4 oxidation activity.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 2.
Methane concentrations in the porewater of rhizosphere
and bulk soil of rice microcosms during the growth period of rice. The
error bars indicate standard errors based on three to six parallel
microcosms.
|
|
The potential CH
4 oxidation in the soil slurries showed
constant induced rates during the growth period and did not reflect
in
situ CH
4 oxidation (Fig.
3).
In contrast to the rates for the
soil compartments, the induced rates
measured for the whole, washed
roots decreased from 3.3 µmol
h
1 g (dry weight)
1 at 28 dap to 0.7 µmol
h
1 g (dry weight)
1 at 92 dap and thus
corresponded to the in situ activities measured
(Fig.
3). For the
initial MOR (Fig.
3) and lag phase (Table
1)
almost no differences occurred during
the growth period in the
bulk soil, whereas in the rhizosphere the
initial MOR decreased
with increasing plant age (Fig.
3). At 92 dap the
initial rates
measured in the rhizosphere were almost as low as those
in the
bulk soil, but the lag phase value remained one-third of the
bulk
soil value, indicating that the physiological state of
methanotrophs
in the rhizosphere was different. The differences in the
initial
rates and the lag phase were even more pronounced for the
roots,
where the initial MOR decreased from 0.4 µmol h
1
g (dry weight)
1 at 28 dap to 0.2 µmol h
1
g (dry weight)
1 at 92 dap and the length of the lag phase
increased from 16 to
52 h. Due to the different but unknown
weight/surface ratios of
soil and roots, a direct comparison of the
rates in the soil compartments
and on the roots was not possible.
Nevertheless, the increasing
lag phase and the decreasing potential
rates of CH
4 oxidation
on roots with increasing plant age,
which occured parallel to
the decrease in in situ oxidation, indicated
the importance of
the roots for the overall oxidation.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 3.
Initial and induced rates of potential CH4
oxidation (MO) in soil slurries and on roots from rice microcosms
containing plants of different ages. Bulk, bulk soil. The error bars
indicate standard errors for samples from four parallel microcosms. The
standard error for the initial MOR in bulk soil at 57 dap was too small
to be seen. gdw, grams (dry weight).
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Lag times until the onset of induced CH4
oxidation in vitro in samples from rice microcosms containing
plants of different ages
|
|
The initial MOR in the soil compartments decreased more slowly than the
in situ CH
4 oxidation and were still relatively high
at 57 dap (0.15 and 0.05 µmol g [dry weight]
1
h
1 for rhizosphere and bulk soil, respectively) (Fig.
3).
This less
pronounced decrease indicates that there was in situ
limitation
of methane oxidation. The parallel decreases in porewater
NH
4 concentrations and in situ CH
4 oxidation
(Fig.
4) indicate that
methanotrophs are
limited by N sources.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
Ammonia concentrations in the porewater of rice
microcosms during the growth period. The in situ CH4
oxidation from Fig. 1 is given for comparison. The error bars indicate
standard errors based on four parallel microcosms.
|
|
Like the potential MOR, the methanotrophic cell numbers reflected the
stimulating effect of the roots, and the highest numbers
per
compartment were detected in the rhizosphere (Fig.
5). Even
in the homogenate relatively
high numbers of methanotrophs were
detected, indicating that strong
attachment of methanotrophs to
the roots occurred. The increase in cell
numbers continued after
in situ CH
4 oxidation decreased.
The ongoing growth may be explained
by a partially active
methanotrophic population with an overall
level of activity below the
detection limit of the inhibitor measurements.
Additionally, in the MPN
assay vegetative cells plus resting stages
were detected, which
resulted in overestimation of the active
population.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 5.
MPNs of methanotrophs (MOB) in the different
compartments of rice microcosms during the growth period. Cell numbers
were calculated based on the total masses in the compartments. The
error bars indicate standard errors based on two to four parallel
microcosms. At 20 and 72 dap only one microcosm was counted.
|
|
Community analysis.
16S rDNA amplification with the universal
eubacterial primer set resulted in PCR products for all of the samples
investigated. The sequences of the DGGE bands obtained did not cluster
with methanotroph sequences, indicating that this group was not
dominant among the eubacteria. However, DGGE analysis based on
amplifications with the 9
and 10
primer sets and fluorescent in
situ hybridization (FISH) revealed the presence of members of both
families of methanotrophs in all compartments during the whole season.
The DGGE band patterns of the 9
amplification products indicated
that there was a stable population of serine pathway methylotrophs
(including members of the Methylocystaceae) during the whole
growth period and in all compartments (Fig.
6A). The major bands in different DGGE lanes (Fig. 6A, bands 1, 2, 4, and 5) were excised and sequenced, and
they clustered with the group of Methylosinus and
Methylocystis spp.; the most closely related sequences were
those found by Henckel et al. (24) (accession no. AF126928
and AF126914) in rice field soil and those found by Wise et al.
(48) (accession no. AF177318 and AF177320) in landfill
soil (Fig. 7). Minor bands with lower
electrophoretic mobility (Fig. 6A, bands 6 and 7) clustered distantly
with Methylobacterium sp. and were most closely related to
sequences found in the rape rhizosphere (O. Kaiser, A. Puehler, and W. Selbitschka, unpublished data) (EMBL Data Library accession no.
AJ295558) and in rice field soil (25) (accession no.
AF283225) (Fig. 7).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 6.
DGGE band patterns retrieved after 16S rDNA
amplification from soil and root compartments of rice microcosms. The
bands that were excised and sequenced are indicated. B, bulk soil; Rh,
rhizosphere; RP, rhizoplane; H, homogenate. (A) Band patterns of primer
set 9 amplification products. Mss, amplification product obtained
with DNA from a Methylosinus sporium culture. (B) Band
patterns of primer set 10 amplification products. Mcc, amplification
product obtained with DNA from a Methylococcus capsulatus
culture; Ac, sequence that clustered with Acinetobacter; Az,
sequence that clustered with Azoarcus; Mx, sequence that
clustered with Myxococcales; Th, sequence that clustered
with Thiothrix.
|
|

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 7.
Phylogenetic placement of sequences retrieved from DGGE
gels after PCR amplification of rice microcosm samples with the 9
and 10 primer sets for 16S rDNA. The tree was constructed by the
neighbor-joining method, using the maximum-parsimony algorithm and the
Jukes-Cantor correction. Sequences are indicated as follows: running
number (DGGE band number in Fig. 6), followed by the compartment (B,
bulk soil; Rh, rhizosphere; RP, rhizoplane; H, homogenate), the age of
the microcosm (in dap), and the primer set used for DNA amplification
(primer set 9 or 10 ). proteobact., proteobacterium; bact.,
bacterium.
|
|
The band patterns resulting from 10

amplifications suggested
dynamics in the population structure of methylotrophs that use
the RuMP
pathway for carbon assimilation, including members of
the
Methylococcaceae (Fig.
6B). The changes in band patterns
were
found to be changes in the genus
Methylobacter but
could not be
correlated with other genera of this family (Fig.
7).
Additionally,
sequencing showed that this assay was not specific for
RuMP pathway
methylotrophs, as some sequences clustered with the genus
Acinetobacter,
the genus
Azoarcus, the order
Myxococcales, and the genus
Thiothrix.
Therefore,
the changes in the band patterns of the 10

amplification
products
cannot be interpreted only as an indication of changes
in the
methylotrophic community. In the bulk soil, PCR amplification
of the
functional gene
mxaF (encoding the

-subunit of methanol
dehydrogenase) resulted in only faint DGGE bands, which could
not be
excised and analyzed further (Fig.
8A).
Four bands from
the rhizosphere and rhizoplane compartments could be
exised and
sequenced. The sequences obtained clustered with sequences
of
members of the family
Methylococcaceae (Fig.
8B), and
were most
closely related to other sequences from rice field soil
(
25)
(accession no.
AF283243 and
AF283244). Unfortunately,
many
single bands from the original DGGE gel resulted in multiple bands
after reamplification and therefore could not be sequenced. Hence,
the
four bands analyzed do not reflect the complete diversity
of the
methylotrophic community in the system. However, these
results
illustrate that members of the
Methylococcaceae were
present
in the root-influenced compartments.

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 8.
(A) DGGE band patterns of mxaF amplification
products from soil and root samples of rice microcosms. The bands that
were excised and sequenced are indicated. Mss, amplification product
obtained with DNA from a Methylosinus sporium culture; B,
bulk soil; Rh, rhizosphere; RP, rhizoplane; H, homogenate. (B) Unrooted
phylogenetic tree for mxaF sequences from rice microcosm
samples compared to previously published sequences. Sequences are
indicated as follows: running number (DGGE band number in Fig. 8A),
followed by the compartment (Rh, rhizosphere; RP, rhizoplane), and the
age of the microcosm (in dap). uncul. putative methanotr., uncultivated
putative methanotroph.
|
|
The in situ dominance of both families of methanotrophs was
investigated by using family-specific probes for FISH. This approach
was limited by the relatively low number of methanotroph cells
compared
to the total number of cells determined by DAPI counting.
In most cases
the percentages of methanotrophs compared to the
DAPI counts ranged
from 0.5 to 0.9% in the soil compartments during
the whole season; the
flooded soil before planting was the only
exception (3.4% of the DAPI
counts) (Table
2). Only the rhizoplane
and the homogenate at 92 dap contained higher percentages of
methanotrophs
(1.3 to 4.9%). Nevertheless, the results obtained
with this method
indicated the in situ dominance of the family
Methylocystaceae over the whole season and in all
compartments. Despite their low
proportional cell numbers, members of
the family
Methylococcaceae were present in all
compartments. In the rhizoplane higher percentages
of these organisms
were detected, and they accounted for one-half
to two-thirds of the
detectable methanotrophic population. Thus,
the rhizoplane seems to be
the most important site for growth
of methanotrophs and maintenance of
their diversity in the rice
field ecosystem.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Relative numbers of eubacteria and methanotrophs detected
by FISH in relation to the total DAPI counts during growth of rice in
different microcosm compartments
|
|
The high relative proportions of members of both families detected in
flooded soil before planting illustrate the ability
of the organisms to
survive starvation and stress, such as drying
of the soil in
winter.
 |
DISCUSSION |
Limitation of in situ CH4 oxidation activity.
The
short period of high levels of in situ CH4 oxidation at the
beginning of the growth period is in contrast to the results of
previous studies, which showed that in situ CH4 oxidation
occurred during the whole growth period of rice (10, 19).
However, the latter in situ oxidation was determined by using other
methods (e.g., CH3F inhibition or N2
headspace), another rice variety, and different growth conditions for
the plants. All these factors might affect the percentage of in situ
CH4 oxidation measured. The time pattern for in situ
CH4 oxidation and CH4 emission detected in our
study was confirmed by obtaining measurements in a rice field
(30) using the inhibitor CH2F2 and
the same rice variety that was used in the microcosms (KORAL).
The comparison of potential oxidation and in situ CH
4
oxidation in this study indicated that there was in situ limitation
of
methanotrophs in the microcosms, as the initial MOR in the
soil
slurries decreased more slowly than the in situ CH
4
oxidation.
The most obvious limiting factor for methanotrophs is the
availability
of CH
4 and O
2. In this study the
CH
4 concentrations in the porewater
always remained above
500 µM (Fig.
2) and thus did not limit methanotrophs.
In microcosms
of the same type incubated in parellel, rhizospheric
O
2 was
detectable even 70 dap (
4). Thus, the O
2
concentration
in the rhizosphere should allow a period of in situ
CH
4 oxidation
longer than that detected in this study.
Another important factor
for methanotrophs is the availability of N
sources (
21,
23).
The NH
4+
concentrations in both soil compartments decreased during the
first few
weeks of plant growth to values around the detection
limit,
illustrating that the N cycle in the rice microcosms was
dominated by N
uptake by the rice plants. The parallel decreases
in in situ
CH
4 oxidation and the NH
4+
concentration in the porewater are consistent with experiments
in which
a positive effect of ammonia fertilization on methanotrophs
in rice
microcosms was shown (
7). These recent findings are
in
contrast to the results of other studies, in which
NH
4+ fertilization had an inhibitory effect on
CH
4 oxidation in soils
(
22,
39,
40), sediments
(
8,
44), and dryland rice fields
(
16).
However, a flooded rice field is characterized by elevated
CH
4 concentrations even in the rhizosphere, which leads to
less
pronounced competitive inhibition of the methane monooxygenase
by
NH
4+ (
13,
29,
44). Additionally,
fast uptake of NH
4+ and other ions by rice
plants affects the influence of NH
4+
fertilization on methanotrophs, as toxic compounds (e.g.,
NO
2
) cannot accumulate in the
porewater.
Community structure of methanotrophs.
The DGGE band patterns
of the 9
primer set PCR amplification products showed that the
community of serine pathway methylotrophs (including members of the
Methylocystaceae) remained stable during the whole growth
period and in all compartments of the system. Most sequences derived
from the DGGE gel clustered with the known genera of the
Methylocystaceae, Methylocystis and Methylosinus, and were most closely related to sequences detected previously in rice
field soil after cloning of PCR amplification products (24). No differences in band intensities or numbers were
detected after the decrease in in situ CH4 oxidation; thus,
DGGE band patterns showed no direct correlation with in situ
activities. Henckel et al. (24), in contrast, found that
there were increases in the number and intensities of bands after the
onset of CH4 oxidation in rice field soil with a
nonsaturated water content in their experiment. In our system, the soil
was flooded for 10 days before the first samples were taken. Therefore,
the effects of increasing CH4 concentrations in the soil
porewater and the onset of CH4 oxidation in the unplanted
system on the methanotrophic community could not be monitored.
The DGGE band patterns for the RuMP pathway methylotrophs
(including members of the
Methylococcaceae) suggested that
there
were changes in the community of these methanotrophs.
Sequencing
showed that these changes occurred only with the genus
Methylobacter,
as all sequences related to the
Methylococcaceae clustered with
this genus. This indicates
that members of the genus
Methylobacter might be the
dominant members of the family
Methylococcaceae in
the
system studied, possibly reflecting the type of resting stage
formed.
The immature cysts of
Methylomonas, Methylococcus, and
Methylomicrobium strains do not survive desiccation
(
46); however,
the
Azotobacter-like cysts of
Methylobacter
strains, the exospores
formed by
Methylosinus
strains, and the lipid cysts of
Methylocystis strains
are all desiccation resistant for several months (
46).
Drying of the rice field soil before use in the microcosm
experiments
might therefore have selected for
Methylobacter strains as the
only desiccation-resistant
methanotrophs belonging to the
Methylococcaceae.
Drying of
rice fields during the winter might have a similar effect
in the
natural environment. This hypothesis has to be proven with
field
studies.
The variation in the
Methylococcaceae community that
occurred parallel to the stability of the
Methylocystaceae
community
led to the assumption that members of the two families
behaved
differently in response to changing environmental
conditions.
It is possible that members of the
Methylococcaceae did react
to changes in O
2
leakage from the roots, which varies with root
type and age (
3,
18) and thereby influences the availability
of O
2
for methanotrophs. However, previously published data for
the
predominance of either family of methanotrophs based on
CH
4 and O
2 concentrations are contradictory.
The CH
4 concentration
seems to be the most important
factor, influencing the dominance
of one family, whereas no
differences in the preferred O
2 concentrations
were
found (
2,
25,
35).
On the other hand, the change in the
Methylococcaceae
community occurred parallel to the decrease in the
NH
4+ concentration in the porewater (Fig.
4 and
6B) and might therefore
be explained by a stronger influence of
the availability of N
sources on members of the
Methylococcaceae than on members of
the
Methylocystaceae. A positive effect of
NH
4+ on members of the
Methylococcaceae was suggested previously by
Hanson and
Hanson (
23) and was shown experimentally with soil
slurries from rice microcosms by Bodelier et al. (
7), who
observed
a greater increase in the biomass of members of the
Methylococcaceae than of members of the
Methylocystaceae after NH
4+
fertilization. Graham et al. (
21) found that members of
the
Methylocystaceae dominated under nitrogen-limited
conditions in
a pulp mill treatment pond and in a laboratory
continuous-flow
reactor, suggesting that members of the genera of this
family
can outcompete members of the
Methylococcaceae under
these
conditions.
In situ dominance of Methylocystaceae.
This is the
first study to show the in situ dominance of either family of
methanotrophs with family-specific probes (17) and
FISH. Despite the low percentage of methanotrophic cells compared to
the overall DAPI counts, there was evidence of in situ dominance of
members of the Methylocystaceae during the whole season and in all compartments. Members of the Methylococcaceae
occurred at higher relative proportions only in the rhizoplane,
illustrating the importance of the rice roots for the
methanotrophic diversity of the rice field ecosystem. In previous
studies strains belonging to the Methylocystaceae have been
isolated from the highest positive MPN dilutions of rice root and rice
field soil incubation mixtures (7, 43), indicating the
numerical dominance of this family. Our FISH results indicate that
these data were not influenced by cultivation biases but reflected the
numerical ratio of members of the methanotrophic families in situ.
Members of the
Methylocystaceae were detected by FISH
at constant relative amounts even in the bulk soil, where no
methanotrophic
growth and activity should have been possible due the
lack of
O
2. The cells of these organisms have a high
ribosome content
and might have entered a stage of anaerobic dormancy,
in which
they survive as vegetative cells (
36,
37). This
corresponds
to the initial MOR in bulk soil even 92
dap.
The large increase in the overall methanotrophic cell counts in the
root compartments compared to the more stable numbers
in the soil
compartments (Fig.
5) showed the importance of the
roots for the growth
of methanotrophs. This conclusion was supported
by amplification of the
gene for methanol dehydrogenase (
mxaF),
which resulted in
visible DGGE bands only for the rhizosphere
and the rhizoplane,
indicating that there were higher target numbers
and thus growth of
methanotrophs in these compartments (
24).
The
O
2 supplied by the roots thus seems to be the key factor
regulating
methanotrophic growth in rice microcosms, followed by the
availability
of N
sources.
The finding that the MPNs in the homogenate were nearly 10% of MPNs
obtained from the rhizoplane is intriguing, because CH
4 oxidation has been shown to be associated with the stems of rice
plants
(
9) and methanotrophs have been detected even in the
xylem
of rice roots (
20). However, our observation should not
be
taken as proof that methanotrophs are endophytic; rather, it
shows that
strong binding of methanotrophs to rice roots
occurs.
Conclusions.
Both families of methanotrophs occur in the rice
microcosm system, but drying of the soil selected for genera with a
desiccation-resistant resting stage. The main population growth
occurred during the first 2 months of the growth period,
accounting for the losses during the remainder of the year. The
rhizoplane supported the greatest diversity of methanotrophs.
FISH analysis provided evidence that in situ dominance by members of
the family Methylocystaceae occurred during the whole season
and in all compartments. The methanotrophic activity in the rice
microcosms seemed to be influenced mainly by the rice roots and the
availability of N sources.
 |
ACKNOWLEDGMENTS |
This work was supported by grants Fr1054 and SFB 395 from the
Deutsche Forschungsgemeinschaft.
We thank Paul L. E. Bodelier and Martin Krüger for
cooperation, Stephan Stubner for an introduction to confocal laser
scanning microscope use, and Alexandra Hahn and Bianca Wagner for
technical assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Max Planck
Institute for Terrestrial Microbiology, Karl-von-Frisch Strasse,
D-35043 Marburg, Germany. Phone: 49-(0)6421-178 820. Fax:
49-(0)6421-178 809. E-mail:
frenzel{at}mailer.uni-marburg.de.
 |
REFERENCES |
| 1.
|
Amann, R. I.,
B. J. Binder,
R. J. Olson,
S. W. Chisholm,
R. Devereux, and D. A. Stahl.
1990.
Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations.
Appl. Environ. Microbiol.
56:1919-1925[Abstract/Free Full Text].
|
| 2.
|
Amaral, J. A., and R. Knowles.
1995.
Growth of methanotrophs in methane and oxygen counter gradients.
FEMS Microbiol. Lett.
126:215-220[CrossRef].
|
| 3.
|
Armstrong, W.
1971.
Radial oxygen losses from intact rice roots as affected by distance from the apex, respiration and waterlogging.
Physiol. Plant.
25:192-197[CrossRef].
|
| 4.
|
Arth, I., and P. Frenzel.
2000.
Nitrification and denitrification in the rhizosphere of rice: the detection of processes by a new multichannel electrode.
Biol. Fertil. Soils
31:427-435[CrossRef].
|
| 5.
|
Assmus, B.,
P. Hutzler,
G. Kirchhof,
R. Amann,
J. R. Lawrence, and A. Hartmann.
1995.
In situ localization of Azospirillum brasilense in the rhizosphere of wheat with fluorescently labeled, rRNA-targeted oligonucleotide probes and scanning confocal laser microscopy.
Appl. Environ. Microbiol.
61:1013-1019[Abstract].
|
| 6.
|
Bodelier, P. L. E.,
H. Duyts,
C. W. P. M. Blom, and H. J. Laanbroek.
1998.
Interactions between nitrifying and denitrifying bacteria in gnotobiotic microcosms planted with the emergent macrophyte Glyceria maxima.
FEMS Microbiol. Ecol.
25:63-78[CrossRef].
|
| 7.
|
Bodelier, P. L. E.,
P. Roslev,
T. Henckel, and P. Frenzel.
2000.
Stimulation by ammonium-based fertilizers of methane oxidation in soil around rice roots.
Nature
403:421-424[CrossRef][Medline].
|
| 8.
|
Bosse, U.,
P. Frenzel, and R. Conrad.
1993.
Inhibition of methane oxidation by ammonium in the surface layer of a littoral sediment.
FEMS Microbiol. Ecol.
13:123-134[CrossRef].
|
| 9.
|
Bosse, U., and P. Frenzel.
1997.
Activity and distribution of CH4-oxidizing bacteria in flooded rice microcosms and in rice plants (Oryza sativa).
Appl. Environ. Microbiol.
63:1199-1207[Abstract].
|
| 10.
|
Bosse, U., and P. Frenzel.
1998.
Methane emissions from rice microcosms: the balance of production, accumulation and oxidation.
Biogeochemistry
41:199-214[CrossRef].
|
| 11.
|
Bowman, J. P.
1999, posting date..
The methanotrophs the families Methylococcaceae and Methylocystaceae. In M. Dworkin (ed.)
In
The prokaryotes. [Online.] Springer Verlag, New York, N.Y. http://link.springer-ny.com.
|
| 12.
|
Brosius, J.,
M. L. Palmer,
P. J. Kennedy, and H. H. Noller.
1978.
Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli.
Proc. Natl. Acad. Sci. USA
75:4801-4805[Abstract/Free Full Text].
|
| 13.
|
Cai, Z. C., and A. R. Mosier.
2000.
Effect of NH4Cl addition on methane oxidation by paddy soils.
Soil Biol. Biochem.
32:1537-1545[CrossRef].
|
| 14.
|
Cassman, K. G.,
S. Peng,
D. C. Olk,
J. K. Ladha,
W. Reichardt,
A. Doberman, and U. Singh.
1998.
Opportunities for increased nitrogen-use efficiency from improved resource management in irrigated rice systems.
Field Crops Res.
56:7-39.
|
| 15.
|
Dedysh, S. N.,
W. Liesack,
V. N. Khmelenina,
N. E. Suzina,
Y. A. Trotsenko,
J. D. Semrau,
A. M. Bares,
N. S. Panikov, and J. M. Tiedje.
2000.
Methylocella palustris gen. nov., sp. nov., a new methane-oxidizing acidophilic bacterium from peat bogs, representing a novel subtype of serine-pathway methanotrophs.
Int. J. Syst. Evol. Microbiol.
50:955-969[Abstract].
|
| 16.
|
Dubey, S. K., and J. S. Singh.
2000.
Spatio-temporal variation and effect of urea fertilization on methanotrophs in a tropical dryland rice field.
Soil Biol. Biochem.
32:521-526[CrossRef].
|
| 17.
|
Eller, G.,
S. Stubner, and P. Frenzel.
2001.
Group specific 16S rRNA targeted probes for the detection of type I and type II methanotrophs by fluorescence in situ hybridisation.
FEMS Microbiol. Lett.
198:31-37[CrossRef][Medline].
|
| 18.
|
Flessa, H., and W. R. Fischer.
1992.
Plant-induced changes in the redox potentials of rice rhizosphere.
Plant Soil
143:55-60[CrossRef].
|
| 19.
|
Gilbert, B., and P. Frenzel.
1995.
Methanotrophic bacteria in the rhizosphere of rice microcosms and their effect on porewater methane concentration and methane emission.
Biol. Fertil. Soils
20:93-100.
|
| 20.
|
Gilbert, B.,
B. Aßmus,
A. Hartmann, and P. Frenzel.
1998.
In-situ localization of two methanotrophic strains in the rhizosphere of rice plants by combined use of fluorescently labeled antibodies and 16S rRNA signature probes.
FEMS Microbiol. Ecol.
25:117-128[CrossRef].
|
| 21.
|
Graham, D. W.,
J. A. Chaudhary,
R. S. Hanson, and R. G. Arnold.
1993.
Factors affecting competition between type-I and type-II methanotrophs in 2-organism, continuous-flow reactors.
Microb. Ecol.
25:1-17.
|
| 22.
|
Gulledge, J.,
A. P. Doyle, and J. P. Schimel.
1997.
Different NH4+-inhibition patterns of soil CH4 consumption a result of distinct CH4-oxidizer populations across sites.
Soil Biol. Biochem.
29:13-21[CrossRef].
|
| 23.
|
Hanson, R. S., and T. E. Hanson.
1996.
Methanotrophic bacteria.
Microbiol. Rev.
60:439-471[Abstract/Free Full Text].
|
| 24.
|
Henckel, T.,
M. Friedrich, and R. Conrad.
1999.
Molecular analyses of the methane-oxidizing microbial community in rice field soil by targeting the genes of the 16S rRNA, particulate methane monooxygenase, and methanol dehydrogenase.
Appl. Environ. Microbiol.
65:1980-1990[Abstract/Free Full Text].
|
| 25.
|
Henckel, T.
2000.
Charakterisierung der methanotrophen Lebensgemeinschaften im Reisfeld- und Waldboden. Ph.D. thesis.
Phillips-Universität Marburg/Lahn, Marburg, Germany.
|
| 26.
|
Holben, W. E.,
J. K. Jansson,
B. K. Chelm, and J. M. Tiedje.
1988.
DNA probe method for the detection of specific microorganisms in the soil bacterial community.
Appl. Environ. Microbiol.
54:703-711[Abstract/Free Full Text].
|
| 27.
|
Holzapfel-Pschorn, A.,
R. Conrad, and W. Seiler.
1986.
Effects of vegetation on the emission of methane from submerged paddy soil.
Plant Soil
92:223-233[CrossRef].
|
| 28.
|
Intergovernmental Panel on Climate Change.
1994.
Radiative forcing of climate change and evaluation of the IPCC IS92 emission scenarios. Climate change.
Cambridge University Press, New York, N.Y.
|
| 29.
|
King, G. M., and S. Schnell.
1994.
Ammonium and nitrite inhibition of methane oxidation by Methylobacter albus BG8 and Methylosinus trichosporium OB3b at low methane concentrations.
Appl. Environ. Microbiol.
60:3508-3513[Abstract/Free Full Text].
|
| 30.
|
Krüger, M.,
P. Frenzel, and R. Conrad.
2001.
Microbial processes influencing methane emission from rice fields.
Global Change Biol.
7:49-64.
|
| 31.
|
Ludwig, W.,
O. Strunk,
S. Klugbauer,
N. Klugbauer,
M. Weizenegger,
J. Neumaier,
M. Bachleitner, and K. H. Schleifer.
1998.
Bacterial phylogeny based on comparative sequence analysis.
Electrophoresis
19:554-568[CrossRef][Medline].
|
| 32.
|
McDonald, I. R.,
E. M. Kenna, and J. C. Murrell.
1995.
Detection of methanotrophic bacteria in environmental samples with the PCR.
Appl. Environ. Microbiol.
61:116-121[Abstract].
|
| 33.
|
Miller, L. G.,
C. Sasson, and R. S. Oremland.
1998.
Difluoromethane, a new and improved inhibitor of methanotrophy.
Appl. Environ. Microbiol.
64:4357-4362[Abstract/Free Full Text].
|
| 34.
|
Neue, H. U.
1997.
Fluxes of methane from rice fields and potential for mitigation.
Soil Use Manag.
13:258-267[CrossRef].
|
| 35.
|
Ren, T.,
J. A. Amaral, and R. Knowles.
1997.
The response of methane consumption by pure cultures of methanotrophic bacteria to oxygen.
Can. J. Microbiol.
43:925-928.
|
| 36.
|
Roslev, P., and G. M. King.
1994.
Survival and recovery of methanotrophic bacteria starved under oxic and anoxic conditions.
Appl. Environ. Microbiol.
60:2602-2608[Abstract/Free Full Text].
|
| 37.
|
Roslev, P., and G. M. King.
1995.
Aerobic and anaerobic starvation metabolism in methanotrophic bacteria.
Appl. Environ. Microbiol.
61:1563-1570[Abstract].
|
| 38.
|
Rowe, R.,
R. Todd, and J. Waide.
1977.
Microtechnique for most-probable-number analysis.
Appl. Environ. Microbiol.
33:675-680[Abstract/Free Full Text].
|
| 39.
|
Schnell, S., and G. M. King.
1994.
Mechanistic analysis of ammonium inhibition of atmospheric methane consumption in forest soils.
Appl. Environ. Microbiol.
60:3514-3521[Abstract/Free Full Text].
|
| 40.
|
Steudler, P. A.,
R. D. Bowden,
J. M. Melillo, and J. D. Aber.
1989.
Influence of nitrogen fertilization on methane uptake in temperate forest soils.
Nature
341:314-316[CrossRef].
|
| 41.
|
Strunk, O., and W. Ludwig.
1996, posting date..
ARB: a software environment for sequence data. [Online.]
Technische Universität München, Munich, Germany. http://www.biol.chemie.tu-muenchen.de/pub/ARB.
|
| 42.
|
Tsien, H. C.,
B. J. Bratina,
K. Tsuji, and R. S. Hanson.
1990.
Use of oligodeoxynucleotide signature probes for identification of physiological groups of methylotrophic bacteria.
Appl. Environ. Microbiol.
56:2858-2865[Abstract/Free Full Text].
|
| 43.
|
van Bodegom, P.
2000.
Methane emissions from rice paddies; experiments and modelling. Ph.D. thesis.
Wageningen University, Wageningen, The Netherlands.
|
| 44.
|
van der Nat, F. J. W. A.,
J. F. C. de Brouwer,
J. J. Middelburg, and H. J. Laanbroek.
1997.
Spatial distribution and inhibition by ammonium of methane oxidation in intertidal freshwater marshes.
Appl. Environ. Microbiol.
63:4734-4740[Abstract].
|
| 45.
|
Weisburg, W. G.,
S. M. Barns,
D. A. Pelletier, and D. J. Lane.
1991.
16S ribosomal DNA amplification for phylogenetic study.
J. Bacteriol.
173:697-703[Abstract/Free Full Text].
|
| 46.
|
Whittenbury, R.,
S. L. Davies, and J. F. Davey.
1970.
Exospores and cysts formed by methane-utilizing bacteria.
J. Gen. Microbiol.
61:219-226[Abstract/Free Full Text].
|
| 47.
|
Whittenbury, R.,
K. C. Philips, and J. F. Wilkinson.
1970.
Enrichment, isolation, and some properties of methane-utilizing bacteria.
J. Gen. Microbiol.
61:205-218[Abstract/Free Full Text].
|
| 48.
|
Wise, M. G.,
J. V. McArthur, and L. J. Shimkets.
1999.
Methanotroph diversity in landfill soil: isolation of novel type I and type II methanotrophs whose presence was suggested by culture-independent 16S ribosomal DNA analysis.
Appl. Environ. Microbiol.
65:4887-4897[Abstract/Free Full Text].
|
Applied and Environmental Microbiology, June 2001, p. 2395-2403, Vol. 67, No. 6
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.6.2395-2403.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Rogers, S. W., Moorman, T. B., Ong, S. K.
(2007). Fluorescent In Situ Hybridization and Micro-autoradiography Applied to Ecophysiology in Soil. Soil Sci.
71: 620-631
[Abstract]
[Full Text]
-
Cebron, A., Bodrossy, L., Stralis-Pavese, N., Singer, A. C., Thompson, I. P., Prosser, J. I., Murrell, J. C.
(2007). Nutrient Amendments in Soil DNA Stable Isotope Probing Experiments Reduce the Observed Methanotroph Diversity. Appl. Environ. Microbiol.
73: 798-807
[Abstract]
[Full Text]
-
Pester, M., Friedrich, M. W., Schink, B., Brune, A.
(2004). pmoA-Based Analysis of Methanotrophs in a Littoral Lake Sediment Reveals a Diverse and Stable Community in a Dynamic Environment. Appl. Environ. Microbiol.
70: 3138-3142
[Abstract]
[Full Text]
-
Seghers, D., Wittebolle, L., Top, E. M., Verstraete, W., Siciliano, S. D.
(2004). Impact of Agricultural Practices on the Zea mays L. Endophytic Community. Appl. Environ. Microbiol.
70: 1475-1482
[Abstract]
[Full Text]
-
Kolb, S., Knief, C., Stubner, S., Conrad, R.
(2003). Quantitative Detection of Methanotrophs in Soil by Novel pmoA-Targeted Real-Time PCR Assays. Appl. Environ. Microbiol.
69: 2423-2429
[Abstract]
[Full Text]