Previous Article | Next Article 
Applied and Environmental Microbiology, June 2001, p. 2404-2409, Vol. 67, No. 6
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.6.2404-2409.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Hydrolysis of 4-Hydroxybenzoic Acid Esters
(Parabens) and Their Aerobic Transformation into Phenol by the
Resistant Enterobacter cloacae Strain EM
Nelly
Valkova,
François
Lépine,*
Loredana
Valeanu,
Maryse
Dupont,
Louisette
Labrie,
Jean-Guy
Bisaillon,
Réjean
Beaudet,
François
Shareck, and
Richard
Villemur
INRS-Institut Armand-Frappier,
Université du Québec, Laval, Québec, Canada H7V 1B7
Received 29 November 2000/Accepted 16 March 2001
 |
ABSTRACT |
Enterobacter cloacae strain EM was isolated from a
commercial dietary mineral supplement stabilized by a mixture of
methylparaben and propylparaben. It harbored a high-molecular-weight
plasmid and was resistant to high concentrations of parabens. Strain EM was able to grow in liquid media containing similar amounts of parabens
as found in the mineral supplement (1,700 and 180 mg of methyl and
propylparaben, respectively, per liter or 11.2 and 1.0 mM) and in very
high concentrations of methylparaben (3,000 mg liter
1, or
19.7 mM). This strain was able to hydrolyze approximately 500 mg of
methyl-, ethyl-, or propylparaben liter
1 (3 mM) in less
than 2 h in liquid culture, and the supernatant of a sonicated
culture, after a 30-fold dilution, was able to hydrolyze 1,000 mg of
methylparaben liter
1 (6.6 mM) in 15 min. The first step
of paraben degradation was the hydrolysis of the ester bond to produce
4-hydroxybenzoic acid, followed by a decarboxylation step to produce
phenol under aerobic conditions. The transformation of 4-hydroxybenzoic
acid into phenol was stoichiometric. The conversion of approximately
500 mg of parabens liter
1 (3 mM) to phenol in liquid
culture was completed within 5 h without significant hindrance to
the growth of strain EM, while higher concentrations of parabens
partially inhibited its growth.
 |
INTRODUCTION |
The esters of 4-hydroxybenzoic acid,
also called parabens, are widely used as antimicrobial agents in a
large variety of food, pharmaceutical, and cosmetic products
(20) due to their excellent antimicrobial activities and
low toxicity (11). They are stable, effective over a wide
pH range, and active against a broad spectrum of microorganisms.
However, their mode of action is not well understood. They are
postulated to act by disrupting membrane transport processes (7) or by inhibiting synthesis of DNA and RNA
(17) or of some key enzymes, such as ATPases and
phosphotransferases, in some bacterial species (15).
Propylparaben is considered more active against most bacteria than
methylparaben. However, because the latter is more soluble in water,
they are often used as a mixture in commercial preparations.
Batches of a dietary mineral supplement normally well stabilized with a
mixture of methylparaben and propylparaben have shown signs of
microbial contamination in conjunction with the disappearance of the
parabens. Very little has been established regarding microbial resistance and degradation pathways with respect to parabens. There are
few cases in the scientific literature of microbial growth in
paraben-stabilized products, although resistance to parabens by strains
of Pseudomonas aeruginosa, Burkholderia cepacia, and
Cladosporium resinae has been reported (4, 27, 29, 31). However, as parabens are prominent antimicrobial agents in
a variety of industries, the economic and medical impact of their
degradation by microbial contaminants can be significant. Here, we
report the characterization of a highly resistant strain of the
ubiquitous bacterium Enterobacter cloacae isolated from a
paraben-stabilized mineral supplement and the identity of the main
degradation products generated by this strain.
 |
MATERIALS AND METHODS |
Materials.
Chemicals were obtained as follows:
4-hydroxybenzoic acid esters, 4-hydroxybenzoic acid, protocatechuic
acid, and bovine albumin from Sigma-Aldrich (St. Louis, Mo.); phenol
from Fluka (Buchs, Switzerland); bistrimethylsilyltrifluoroacetamide
from Pierce (Rockford, Ill.); ethyl acetate and acetonitrile from EM
Science (Gibbstown, N.J.); acetic acid from Mallinckrodt
(Pointe-Claire, Quebec, Canada); ultrapure sucrose from GibcoBRL (Life
Technologies, Inc., Gaithersburg, Md.); tryptic soy broth, tryptic soy
agar, and all other growth media from Difco Laboratories (Detroit,
Mich.); and all other chemicals from Anachemia (Ville Saint-Pierre,
Quebec, Canada). Antibiotics were purchased as follows: streptomycin, penicillin, trimethoprim, polymyxin B, and norfloxacin from Sigma; rifampin and chloramphenicol from Boehringer Mannheim (Mannheim, Germany); tetracycline, erythromycin, ampicillin, and gentamicin from
ICN Biomedicals (Aurora, Ohio); and kanamycin from Fisher (Fair Lawn,
N.J.). Restriction endonucleases were purchased from Pharmacia Biotech
(Baie d'Urfé, Quebec, Canada), and molecular weight markers were
purchased from MBI Fermentas (Vilnius, Lithuania).
Growth conditions.
Solid medium containing paraben crystals
was prepared by autoclaving tryptic soy agar, and while still hot,
methylparaben (5 g liter
1) or propylparaben (1 g
liter
1) was added. Immediately after pouring, the petri
dishes were cooled at 4°C, which caused the parabens to form small,
but clearly visible, crystals within the agar (4). The
plates were incubated at 30°C overnight, and disappearance of the
crystals around growing bacteria was monitored as an indication of
paraben degradation. Liquid cultures of tryptic soy broth with parabens
were prepared by autoclaving media already containing parabens. Paraben
stability during autoclaving was verified by high-pressure liquid
chromatography (HPLC). Determination of the optimum growth temperature
was performed in tryptic soy broth with and without a mixture of
methyl- and propylparabens at concentrations similar to those of the
mineral supplement. Cell growth in liquid media was monitored by
optical density (OD) readings at 600 nm, which were always measured
below an OD of 0.3 after dilution, and where a reading of 1.0 OD
corresponded to 6 × 108 cells/ml. All cultures for
subsequent assays were grown at 30°C in a rotary agitator at 250 rpm
under aerobic conditions.
Plasmid extraction.
E. cloacae strains EM and E
were cultured in tryptic soy broth in the absence of parabens. The
alkaline lysis protocol for plasmid extraction was followed as
described by Sambrook et al. (25), and plasmid DNA was
purified by CsCl gradient centrifugation (25). Plasmid
transfer experiments were attempted by transformation of competent
cells of strain E treated with calcium chloride according to the method
of Sambrook et al. (25), by transformation of commercially
prepared competent cells of Escherichia coli XL1-Blue (Stratagene, La Jolla, Calif.), and by electroporation of strain E
according to the method of Smith and Iglewski (26), using a Gene Pulser apparatus (Bio-Rad Laboratories, Richmond, Calif.).
Paraben sensitivity.
MICs were determined in tryptic soy
broth by the method of Eklund (6), with the following
modifications: a small aliquot of a culture grown overnight in tryptic
soy broth was diluted into tryptic soy broth medium that had been
autoclaved with the appropriate concentrations of parabens such that
the starting OD of the culture was approximately 0.05 at 600 nm. The
density of the bacterial suspensions was measured immediately after
dilution and after 24 and 48 h of incubation at 30°C with
shaking. The MICs were defined as the amounts of preservative added to
the media that prevented an increase in the OD of the cell suspension after 48 h relative to the density immediately after inoculation.
Characterization of hydrolytic activity.
Liquid cultures
were prepared from EM cells grown in tryptic soy broth overnight,
centrifuged, and resuspended in fresh medium before being inoculated
into tryptic soy broth containing the appropriate paraben. The OD of
all cultures was monitored in the same manner as for the MICs. The
cells were incubated at 30°C with shaking; at timed intervals, 1-ml
aliquots were removed for HPLC analysis and heated immediately to
80°C for 10 min to prevent further enzymatic degradation of the
parabens. Cell lysates of strain EM grown in tryptic soy broth without
parabens were prepared with an ultrasonicator probe (Heat Systems,
Inc., Farmingdale, N.Y.) using three 20-s pulses at 143 W, followed by
centrifugation at 16,000 × g for 15 min. A 30-fold
dilution of the cell lysate was subsequently made in tryptic soy broth
containing 1,000 mg of methylparaben liter
1 (6.6 mM) and
incubated for 2 h at 30°C with shaking. Sampling was performed at
timed intervals as described above, and a control was prepared in the
same manner from an EM culture that had not been sonicated. Total
protein concentration was measured in the cell extracts of sonicated
and nonsonicated cultures with the Bio-Rad protein assay (Bio-Rad
Laboratories, Richmond, Calif.) by the method of Bradford
(3), using bovine albumin as a standard.
Identification of paraben degradation products.
The
metabolites of the parabens were identified both by HPLC and gas
chromatography (GC)-mass spectrometry (MS). The HPLC analyses were
performed on an HP 1100 (Agilent Technologies, Kirkland, Quebec,
Canada) equipped with a 150- by 4-mm C18 reverse-phase Hypersil ODS column (5 µm; Agilent Technologies) and a
variable-wavelength UV detector. A water-acetonitrile gradient
containing a constant amount of 0.1% acetic acid was used, starting
with 90% water and ending with 90% acetonitrile after 5 min at a flow
rate of 2 ml/min. The GC was a Varian 3500 (Varian Canada, St-Laurent,
Quebec, Canada) equipped with a DB-5 column (30 m; 320-µm inside
diameter; film thickness, 0.25 µm). The carrier gas was helium at a
flow rate of 2.2 ml/min. The temperature gradient started at 70°C,
rising to 250°C at 10°C/min and to 310°C at 25°C/min. The MS
was a Finnigan Ion Trap 800 (Thermo Quest, Schaumburg, Ill.), and the
scan range was from 70 to 440 Da.
The samples were prepared for HPLC analysis by centrifugation of the
cell suspensions to remove cell debris and adding acetonitrile containing 1% acetic acid to the supernatants to a final concentration of 10%. The parabens, 4-hydroxybenzoic acid, and phenol were
identified according to their retention times and quantified with the
appropriate calibration curves. Samples for GC-MS analysis were
prepared by homogenizing the cell cultures by vortexing, saturating
with sodium chloride, and extracting with ethyl acetate. The organic
layer was dried with anhydrous sodium sulfate, and the compounds
retained in the organic layer were derivatized by direct addition of
bistrimethylsilyltrifluoroacetamide and heating at 70°C before
injection. The trimethylsilyl derivatives of 4-hydroxybenzoic acid and
phenol were identified by comparison of their retention times and mass
spectra to those of standards derivatized in the same manner.
 |
RESULTS AND DISCUSSION |
Characterization of bacterial strains.
The paraben-resistant
E. cloacae strain EM was isolated from batches of a dietary
mineral supplement which was normally well stabilized with methyl- and
propylparabens. This supplement contained various mineral
glycerophosphates, plant extracts, and methyl- and propylparabens at
1.7 and 0.18 g liter
1, respectively. The
contamination was observed simultaneously in batches manufactured at
distant production plants, indicating that the origin of the
contaminants was not environmental but that they were probably
introduced from one of the ingredients of the mixture. The most obvious
sign of bacterial growth was the inflation of the plastic bottles due
to the production of gas. A facultatively anaerobic gram-negative short
rod isolated from these bottles was identified as E. cloacae
by API 20E galleries (bioMerieux, St-Laurent, Quebec, Canada) and named
strain EM. The identification was further verified by comparing it to a
collection strain E. cloacae LSPQ 3022 (Laboratoire de
Santé Publique du Québec, St-Anne de Bellevue, Quebec,
Canada), named strain E. Strain EM formed large smooth colorless
colonies with an aspect and color identical to those of the reference
strain E on tryptic soy agar, blood, and McConkey and Hektoën
media. The identification was confirmed by sequencing a 591-bp
PCR-amplified portion of the 16S rRNA gene using the universal
eubacterial primers 5'AGAGTTTGATCCTGGCTCAG3' (nucleotides 8 to 27) and 5'AAGGAGGTGATCCAGCCGCA3' (nucleotides 1522 to
1541) for E. coli (GenBank accession no. J01695). A similarity of >99% compared to the sequence of the E. cloacae 16S rRNA gene (ATCC 13047T; GenBank accession no.
AJ251469) was obtained. Strain EM grew in tryptic soy broth with the
production of gas at temperatures between 25 and 37°C, and its
optimal growth temperature was found to be 30°C with or without
parabens (data not shown). Comparative antibiograms of the two strains
demonstrated that, as previously reported for this species, both
E. cloacae strains were resistant to high concentrations of
penicillin and ampicillin (100 µg/ml) (21, 30) and were
equally resistant to 100 µg of erythromycin per ml and to 50 µg of
trimethoprim per ml. Both strains were found to be sensitive to 25 µg
of streptomycin per ml, as well as to 10 µg of tetracycline or
polymyxin B per ml and to 0.5 µg of norfloxacin per ml. Strain EM was
found to differ from the reference strain E by being sensitive to 50 µg of rifampin per ml and to 10 µg of either chloramphenicol,
gentamicin, or kanamycin per ml, although at 50 µg of the three
latter compounds per ml, both strains became sensitive.
Plasmid characterization.
Resistance to biocides is often
associated with plasmids (24). A large plasmid was
detected in strain EM, while no plasmid was found in the reference
strain E. The plasmid in strain EM was extracted and purified by CsCl
gradient centrifugation, and its molecular size was estimated at
100 ± 20 kb. High-molecular-weight plasmids were previously found
in E. cloacae isolates from nosocomial infections that had a
high level of multiresistance (14, 22). Transfer of the
plasmid from strain EM by transformation of strains E. cloacae E and of E. coli XL1-Blue did not yield
transformants able to hydrolyze crystallized parabens on tryptic soy
agar. Further attempts to transfer the plasmid to strain E by
electroporation did not yield transformants able to grow on plates
containing 2,500 mg of crystallized ethylparaben liter
1
(15.0 mM), suggesting that the large size of the plasmid may not permit
it to cross the bacterial membrane. Strain EM was also not cured of its
plasmid by growing cultures at 42°C or in ethidium bromide.
Interestingly, strain EM was able to grow in the presence of
concentrations of ethidium bromide as high as 1,000 mg
liter
1 (2.5 mM). Such resistance has been associated with
plasmid-mediated efflux in Staphylococcus aureus and has
been cloned into E. coli (23).
Resistance to parabens.
Both strains E and EM grew to very
high cell densities in tryptic soy broth alone (Fig.
1A), with the reference strain E reaching slightly higher densities than strain EM. However, strain EM grew in
the presence of methyl- and propylparabens at concentrations similar to
those present in the mineral supplement (1,400 and 150 mg
liter
1, respectively, or 9.2 and 0.83 mM), while at these
concentrations, the growth of strain E was suppressed (Fig. 1A). Due to
limitations in the solubility of propylparaben, the effects of similar
concentrations of the series methyl-, ethyl-, and propylparabens could
only be studied at approximately 500 mg liter
1 (3 mM).
Growth of the reference strain E was considerably hindered by methyl-
and ethylparaben concentrations of 400 and 500 mg liter
1,
respectively, as it reached ODs of only 4.5 and 2.4 after 24 h
(Fig. 1B) and was suppressed by 400 mg of propylparaben
liter
1. The growth of strain EM at these paraben
concentrations was comparable to that obtained in tryptic soy broth
alone, reaching ODs of 3 after 5 h and 9 after 24 h for all
three parabens (results not shown). Furthermore, strain EM survived in
very high concentrations of methylparaben (3,000 mg
liter
1, or 19.7 mM) after 24 h and was further able
to grow, while the growth of strain E was suppressed at concentrations
of 2,000 mg liter
1 (13.1 mM) and remained significantly
below that of strain EM at lower paraben concentrations (Fig. 1C).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Growth of strains EM ( and ) and E ( and
) in tryptic soy broth ( ) and growth in tryptic soy broth
containing methyl- and propylparabens (1,400 and 150 mg, respectively,
liter 1, or 9.2 and 0.83 mM)
(· · · · · ·). (B) Growth of strain E in
the presence of 400 mg each of methylparaben (2.6 mM) ( ) and
propylparaben (2.2 mM) ( ) liter 1 and 500 mg of
ethylparaben liter 1 (3.0 mM) ( ). (C) Growth of strains
EM ( ) and E ( ) after 24 h in tryptic soy broth with
increasingly high concentrations of methylparaben.
|
|
The differences in the antimicrobial activities of methyl-, ethyl-, and
propylparabens are clearly demonstrated by the effects
of similar
concentrations on the growth of the paraben-sensitive
strain E (Fig.
1B). Propylparaben was the most effective of the
three, as 400 mg
liter
1 (2.2 mM) suppressed the growth of strain E, while
similar amounts
of ethyl- or methylparaben did not inhibit cell growth
entirely.
The stronger antibacterial action of propylparaben may be due
to its greater solubility in the bacterial membrane, which may
allow it
to reach cytoplasmic targets in greater concentrations.
However, since
a majority of the studies on the mechanism of action
of parabens
suggest that their antibacterial action is linked
to the membrane
(
6,
7), it is possible that its greater
lipid solubility
disrupts the lipid bilayer, thereby interfering
with membrane transport
processes and perhaps causing the leakage
of intracellular
constituents.
Paraben resistance of strain EM relative to strain E is also reflected
in the MICs of the four most commonly used parabens.
The methylparaben
concentration required to suppress the growth
of strain EM was 4,000 mg
liter
1 (26.3 mM). Due to limitations in their
solubilities, the concentrations
of ethyl-, propyl-, and butylparabens
required to prevent growth
of strain EM could be determined only as
higher than 1,600, 600,
and 200 mg liter
1 (9.6, 3.3, and
1.0 mM), respectively, as this strain was able
to reach very high ODs
(>7 at 600 nm) at these concentrations.
In comparison, the MICs for
strain E of methyl-, ethyl-, and propylparabens
were 2,000, 800, and
600 mg liter
1 (13.1, 4.8, and 3.3 mM), respectively,
while butylparaben limited
the growth of strain E considerably without
completely suppressing
it at 200 mg liter
1 (1.0 mM). The
MICs reported in the literature of these four parabens
for
E. cloacae ATCC 23355 are 1,000, 1,000, 500, and 250 mg
liter
1 (6.6, 6.0, 2.8, and 1.3 mM) (
11),
respectively, showing the
remarkable resistance of strain EM toward
these compounds. Due
to the high resistance of strain EM to all four
parabens, as evidenced
by the MICs, the minimum bactericidal
concentrations were not
determined.
Degradation of parabens by strain EM.
When a 10-µl/aliquot
of an overnight culture of EM grown in tryptic soy broth without
parabens was deposited in the middle of a tryptic soy agar plate
containing 1, 5, or 10 g of crystallized propylparaben
liter
1, a time-dependent clearance zone around the
growing bacteria was observed within a few hours. After 8 days of
incubation, the diameter of this zone on 1 g of propylparaben
liter
1 had increased to the extent that the paraben
crystals over the entire area of a standard 100-mm-diameter petri dish
had disappeared, although the diameter of the bacterial spot where the
cells were initially deposited did not increase significantly (results
not shown). Furthermore, when a small area of agar cleared of
crystallized parabens by strain EM, but outside the diameter of
bacterial growth, was transferred to liquid medium containing 1,000 mg
of methylparaben liter
1 (6.6 mM), only 7% of the
original amount of paraben remained after 24 h and 0.02% of the
paraben was found in the medium after 48 h. No evidence of cell
growth was detected at these time points, demonstrating that the factor
responsible for paraben degradation diffused through agar outward from
the perimeter of bacterial growth (results not shown). Additionally,
when a culture filtrate (0.2 µm) of strain EM was placed on tryptic
soy agar containing crystallized propylparaben, a 2.5-cm clearance zone
was observed after a 24 h of incubation. No clearance zone was
observed with a EM filtrate heated to boiling, indicating that the
factor was heat sensitive and probably enzymatic in nature.
Additionally, no clearance zone was observed with a filtrate of strain
E (results not shown). Hence, the considerable growth of strain EM in
methyl-, ethyl-, and propylparabens above their reported MICs
(11) and in comparison with the control strain E can be
explained in terms of the enzymatic degradation of these antibacterial agents.
Conversion of parabens to 4-hydroxybenzoic acid.
When strain
EM was incubated at 30°C overnight in tryptic soy broth containing
concentrations of methyl- and propylparabens similar to those in the
mineral supplement (1,400 and 150 mg liter
1,
respectively, or 9.2 and 0.83 mM), both parabens disappeared within
24 h of incubation at 30°C, while no significant change occurred
in the concentrations of parabens present in a parallel culture of
strain E (results not shown). Additionally, when the supernatant of a
culture of strain EM grown without parabens was diluted 1:30 and
inoculated into tryptic soy broth containing 1,000 mg of methylparaben
liter
1 (6.6 mM), only 6% (0.4 mM) of the initial paraben
remained in the medium after 2 h (Fig.
2). The disappearance of the paraben was
accompanied by a corresponding increase in the amounts of 4-hydroxybenzoic acid, which reached 900 mg liter
1 (6.5 mM) after 2 h. To assess if the enzyme responsible for paraben hydrolysis was extra- or intracellular, the same EM culture was sonicated, and the supernatant was equally diluted and placed in 1,000 mg of methylparaben liter
1 (6.6 mM) (Fig. 2). It was
found that only 0.06% of the methylparaben (0.004 mM) remained in the
medium after 15 min of incubation, while 80% of the paraben still
remained in the supernatant of the nonsonicated culture after the same
time, resulting in a hydrolysis rate difference greater than 800-fold,
while the amount of protein released after sonication was only 69-fold
greater (1.1 mg/ml). This extremely rapid hydrolysis by the sonicated
cell suspension was paralleled by the rapid appearance of 950 mg of
4-hydroxybenzoic acid liter
1 (6.8 mM). The nature of the
degradation product and the differences between its rate of formation
by the sonicated and the nonsonicated cultures indicate that the enzyme
may be of intracellular nature or that it may be targeted to the
periplasm.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
Conversion of 1,000 mg of methylparaben
liter 1 (6.6 mM) ( and ) into 4-hydroxybenzoic acid
( and ) by the supernatants of sonicated ( ) and nonsonicated
(· · · ·) cultures of strain EM, yielding
4-hydroxybenzoic acid concentrations of 950 and 900 mg
liter 1 (6.9 and 6.5 mM), respectively. The appearance of
the degradation product was monitored by HPLC.
|
|
Transformation of 4-hydroxybenzoic acid into phenol.
Strain EM
grown without parabens was inoculated into tryptic soy broth containing
400 mg of methylparaben liter
1 (2.6 mM) and after 60 min
transformed more than 99% of the paraben into 4-hydroxybenzoic acid
(Fig. 3). However, the acid produced accumulated in the medium only
transiently, as more than 99.9% was transformed into phenol after
5 h of incubation (Fig. 3). The
kinetics of paraben hydrolysis and phenol formation were nearly identical for ethyl- and propylparabens at similar concentrations (results not shown). No cell lysis, indicated by decreases in OD, was
observed in cultures of EM in media containing approximately 500 mg of
either of the three parabens liter
1 (3 mM) after 5 h of
incubation, at which point phenol reached its maximal concentration
(Fig. 3). Further confirmation of the origin of phenol was obtained
from the 1:1 stoichiometric conversion of 4-hydroxybenzoic acid to
phenol obtained by incubating strain EM with 700, 1,500, 2,300, 2,400, and 3,000 mg of methylparaben liter
1 (4.6, 9.9, 15.1, 15.8, and 19.7 mM) A linear relationship with a slope of 1.0 was
established between the amount of 4-hydroxybenzoic acid produced from
the parabens and the amount of phenol present after the complete
disappearance of the acid (results not shown). It is reported in the
literature that 800 mg of phenol liter
1 (8.5 mM) induced
a lag phase in Enterobacter aerogenes, a species closely
related to E. cloacae (28), during which the
cells nonetheless remained viable (5). This concentration
is close to the 900 mg of phenol liter
1 (9.6 mM) which
accumulated in the media when strain EM was grown in a mixture of
methylparaben (1,400 mg liter
1 [9.2 mM]) and
propylparaben (150 mg liter
1 [0.83 mM]). The growth of
strain EM at these concentrations of parabens was considerably reduced
after 24 h in comparison with EM grown in tryptic soy broth alone
(Fig. 1A). The main difference with this latter experiment, aside from
the presence of rapidly degraded parabens, is the transient
accumulation of 4-hydroxybenzoic acid and subsequently of phenol
(results not shown). This suggests that these compounds may be
responsible for the reduced growth over 24 h of strain EM
initially cultivated in the presence of parabens.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
Complete transformation of methylparaben by strain EM in
tryptic soy broth. The paraben ( ) at a concentration of 400 mg
liter 1 (2.6 mM) is rapidly hydrolyzed into
4-hydroxybenzoic acid ( ), which is stoichiometrically decarboxylated
into phenol ( ). The appearance of the degradation products was
monitored by HPLC.
|
|
The decarboxylation of 4-hydroxybenzoic acid into phenol by aerobic
bacteria has been reported only once, with a strain of
E. aerogenes, (
28), under both aerobic (
19)
and anaerobic
(
10) conditions. The usual degradation
pathway of 4-hydroxybenzoic
acid by aerobic bacteria is through the

-ketoadipate pathway,
resulting in the formation of protocatechuic
acid instead of phenol
(Fig.
4). This
pathway and the enzymes necessary for the degradation
reactions,
encoded by the
pca operon, are highly conserved and
have
been extensively characterized in several prokaryotes, including
Acinetobacter calcoaceticus,
Pseudomonas putida,
and
Agrobacterium tumefaciens (
12,
18). The
metabolism of the 4-hydroxybenzoic
acid generated from parabens by a
resistant
P. aeruginosa strain
was also found to proceed
through the formation of protocatechuic
acid (
31). In the
present study, no protocatechuic acid was
detected by HPLC or GC-MS
during paraben degradation by strain
EM. Instead, the decarboxylation
of 4-hydroxybenzoic acid to phenol
proceeded stoichiometrically (Fig.
4). It has been documented
that under anaerobic conditions,
4-hydroxybenzoic acid can be
decarboxylated into phenol. This pathway
has been found in a number
of anaerobic consortia isolated from the
environment (
1,
8,
33) as well as in
Clostridium
hydroxybenzoicum and
Moorella (basonym,
Clostridium)
thermoacetica (
13,
32).
However, the
aerobic transformation of 4-hydroxybenzoic acid into
phenol is
a rarely documented pathway and raises questions about the
ability
of other ubiquitous
Enterobacteriaceae to carry out
these reactions.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Degradation pathway of esters of 4-hydroxybenzoic acid
into phenol by strain EM. The initial hydrolysis of methylparaben
produces 4-hydroxybenzoic acid and methyl alcohol. Further degradation
of 4-hydroxybenzoic acid does not follow the protocatechuate pathway.
Instead, the 4-hydroxybenzoic acid produced is stoichiometrically
converted into phenol by a decarboxylase-type enzyme operating under
aerobic conditions.
|
|
The utilization of parabens as growth substrates by various bacterial
genera has been observed by Beveridge and Hart (
2).
Close
and Nielsen have reported hydrolysis of the parabens and
their
utilization as sole carbon source (
4), while Suemitsu
et
al. reported the formation of 4-hydroxybenzoic acid as a degradation
product (
29), both by strains of
Pseudomonas
cepacia. However,
in these studies, low concentrations of parabens
(less than 100
mg liter
1) were used, and more than 2 to 4 weeks were required to achieve
complete degradation. Similarly, a
P. aeruginosa strain isolated
by Zedan and Serry required 5 days to completely hydrolyze 100
mg of propylparaben
liter
1 (
31), while the
Cladosporium strain isolated by Sokolski et
al. was capable
of hydrolyzing 70% of a 2,000-mg liter
1 paraben solution
in 5 days (
27). In contrast, strain EM was
capable of
completely hydrolyzing approximately 500 mg of methyl-,
ethyl-, or
propylparaben liter
1 in less than 2 h and a mixture of
methyl- and propylparabens
(1,400 and 150 mg, respectively,
liter
1), similar to amounts used in commercial
preparations, in less
than 4 h, demonstrating the remarkable
activity of this strain
toward parabens. To our knowledge, this is the
first report of
a strain of
E. cloacae that can inactivate
high amounts of parabens
in the early stages of growth and continue to
grow in high concentrations
of 4-hydroxybenzoic acid and phenol. The
introduction of
Enterobacter species as clinical pathogens
has previously been reported for
strains of
E. cloacae
present in contaminated dextrose infusion
fluid or from sources as
varied as formulated oral feeds, hydrotherapy
tanks, or liner caps of
intravenous fluid bottles (
9,
16).
The resistance of
strain EM to such common preservatives as parabens
can engender
health-related concerns, as they are used in a number
of pharmaceutical
products, which might create the potential for
the spread of
paraben-resistant bacteria as nosocomial
pathogens.
 |
ACKNOWLEDGMENTS |
We thank Gilles Paquette for his participation as well as Louis
Racine and Sylvain Milot for technical assistance in the identification of paraben degradation products.
This work was funded in part by an NRC grant and an NSERC postgraduate fellowship.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: INRS-Institut
Armand-Frappier, 531 boul. des Prairies, Laval, Québec, Canada,
H7V 1B7. Phone: (514) 687-5010. Fax: (514) 686-5501. E-mail:
francois_lepine{at}inrs-iaf.uquebec.ca.
 |
REFERENCES |
| 1.
|
Béchard, G. B.,
J.-G. Bisaillon, and R. Beaudet.
1990.
Degradation of phenol by a bacterial consortium under methanogenic conditions.
Can. J. Microbiol.
36:573-578.
|
| 2.
|
Beveridge, E. G., and A. Hart.
1970.
The utilisation for growth and the degradation of p-hydroxybenzoate esters by bacteria.
Int. Biodeterior. Bull.
6:9-12.
|
| 3.
|
Bradford, M. M.
1976.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem.
72:248-254[CrossRef][Medline].
|
| 4.
|
Close, J.-A., and P. A. Nielsen.
1976.
Resistance of a strain of Pseudomonas cepacia to esters of p-hydroxybenzoic acid.
Appl. Environ. Microbiol.
31:718-722[Abstract/Free Full Text].
|
| 5.
|
Dagley, S.,
E. A. Dawes, and G. A. Morrison.
1950.
Inhibition of growth of Aerobacter aerogenes: the mode of action of phenols, alcohols, acetone, and ethyl acetate.
J. Bacteriol.
60:369-379[Free Full Text].
|
| 6.
|
Eklund, T.
1980.
Inhibition of growth and uptake processes in bacteria by some chemical food preservatives.
J. Appl. Bacteriol.
48:423-432[Medline].
|
| 7.
|
Freese, E.,
C. W. Sheu, and E. Galliers.
1973.
Function of lipophilic acids as antimicrobial food additives.
Nature
241:321-325[CrossRef][Medline].
|
| 8.
|
Gallert, C., and J. Winter.
1992.
Comparison of 4-hydroxybenzoate decarboxylase and phenol carboxylase activities in cell-free extracts of a defined, 4-hydroxybenzoate and phenol-degrading anaerobic consortium.
Appl. Microbiol. Biotechnol.
37:119-124.
|
| 9.
|
Gaston, M. A.
1988.
Enterobacter: an emerging nosocomial pathogen.
J. Hosp. Infect.
11:197-208[CrossRef][Medline].
|
| 10.
|
Grant, D. J. W., and J. C. Patel.
1969.
The non-oxidative decarboxylation of p-hydroxybenzoic acid, gentisic acid, protocatechuic acid and gallic acid by Klebsiella aerogenes (Aerobacter aerogenes).
Antonie Leeuwenhoek
35:325-343.
|
| 11.
|
Haag, T., and D. F. Loncrini.
1984.
Esters of para-hydroxybenzoic acid.
Cosmet. Sci. Technol. Ser.
1:63-77.
|
| 12.
|
Harwood, C. S., and R. E. Parales.
1996.
The -ketoadipate pathway and the biology of self-identity.
Annu. Rev. Microbiol.
50:553-590[CrossRef][Medline].
|
| 13.
|
Hsu, T.,
S. L. Daniel,
M. F. Lux, and H. L. Drake.
1990.
Biotransformations of carboxylated aromatic compounds by the acetogen Clostridium thermoaceticum: generation of growth-supportive CO2 equivalents under CO2-limited conditions.
J. Bacteriol.
172:212-217[Abstract/Free Full Text].
|
| 14.
|
John, J. F.,
R. J. Sharbaugh, and E. R. Bannister.
1982.
Enterobacter cloacae: bacteremia, epidemiology, and antibiotic resistance.
Rev. Infect. Dis.
4:13-28[Medline].
|
| 15.
|
Ma, Y., and R. E. Marquis.
1996.
Irreversible paraben inhibition of glycolysis by Streptococcus mutans GS-5.
Lett. Appl. Microbiol.
23:329-333[Medline].
|
| 16.
|
Maki, D. G.,
F. S. Rhame,
D. C. Mackel, and J. V. Bennett.
1976.
Nationwide epidemic of septicemia caused by contaminated intravenous products.
Am. J. Med.
60:471-485[CrossRef][Medline].
|
| 17.
|
Nes, I. F., and T. Eklund.
1983.
The effect of parabens on DNA, RNA and protein synthesis in Escherichia coli and Bacillus subtilis.
J. Appl. Bacteriol.
54:237-242[Medline].
|
| 18.
|
Parke, D.
1995.
Superaoperonic clustering of pca genes for catabolism of the phenolic compound protocatechuate in Agrobacterium tumefaciens.
J. Bacteriol.
177:3808-3817[Abstract/Free Full Text].
|
| 19.
|
Patel, J. C., and D. J. W. Grant.
1969.
The formation of phenol in the degradation of p-hydroxybenzoic acid by Klebsiella aerogenes (Aerobacter aerogenes).
Antonie Leeuwenhoek
35:53-64.
|
| 20.
|
Rastogi, S. C.,
A. Schouten,
N. de Kruijf, and J. W. Weijland.
1995.
Content of methyl-, ethyl-, propyl-, butyl- and benzylparaben in cosmetic products.
Contact Dermatitis
32:28-30[CrossRef][Medline].
|
| 21.
|
Ristuccia, P. A., and B. A. Cunha.
1985.
Enterobacter.
Infect. Control
6:124-128[Medline].
|
| 22.
|
Rubens, C. E.,
W. E. Farrar,
Z. A. McGee, and W. Schaffner.
1981.
Evolution of a plasmid mediating resistance to multiple antimicrobial agents during a prolonged epidemic of nosocomial infections.
J. Infect. Dis.
143:170-181[Medline].
|
| 23.
|
Russell, A. D.
1997.
Plasmids and bacterial resistance to biocides.
J. Appl. Microbiol.
82:155-165.
|
| 24.
|
Russell, A. D.
1985.
The role of plasmids in bacterial resistance to antiseptics, disinfectants and preservatives.
J. Hosp. Infect.
6:9-19[Medline].
|
| 25.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2 ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 26.
|
Smith, A. W., and B. H. Iglewski.
1989.
Transformation of Pseudomonas aeruginosa by electroporation.
Nucleic Acids Res.
17:1059.
|
| 27.
|
Sokolski, W., T.,
C. G. Chidester, and G. E. Honeywell.
1962.
The hydrolysis of methyl p-hydroxybenzoate by Cladosporium resinae.
Dev. Ind. Microbiol.
3:179-187.
|
| 28.
|
Steigerwalt, A. G.,
G. R. Fanning,
M. A. Fife-Asbury, and D. J. Brenner.
1976.
DNA relatedness among species of Enterobacter and Serratia.
Can. J. Microbiol.
22:121-137[Medline].
|
| 29.
|
Suemitsu, R.,
K. Hioruchi,
S. Yanagawase, and T. Okamatsu.
1990.
Biotransformation activity of Pseudomonas cepacia on p-hydroxybenzoates and benzalkonium chloride.
J. Antibact. Antifung. Agents
18:579-582.
|
| 30.
|
Toala, P.,
Y. H. Lee,
C. Wilcox, and M. Finland.
1970.
Susceptibility of Enterobacter aerogenes and Enterobacter cloacae to 19 antimicrobial agents in vitro.
Am. J. Med. Sci.
260:41-55[Medline].
|
| 31.
|
Zedan, H. H., and F. M. Serry.
1984.
Metabolism of esters of p-hydroxybenzoic acid by a strain of Pseudomonas aeruginosa.
Egypt. J. Microbiol.
19:41-54.
|
| 32.
|
Zhang, X.,
L. Mandelco, and J. Wiegel.
1994.
Clostridium hydroxybenzoicum sp. nov., an amino acid-utilizing, hydroxybenzoate-decarboxylating bacterium isolated from methanogenic freshwater pond sediment.
Int. J. Syst. Bacteriol.
44:214-222[Abstract/Free Full Text].
|
| 33.
|
Zhang, X.,
T. V. Morgan, and J. Wiegel.
1990.
Conversion of 13C-1 phenol to 13C-4 benzoate, an intermediate in the anaerobic degradation of chlorophenols.
FEMS Microbiol. Lett.
67:63-66[CrossRef].
|
Applied and Environmental Microbiology, June 2001, p. 2404-2409, Vol. 67, No. 6
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.6.2404-2409.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Valkova, N., Lepine, F., Labrie, L., Dupont, M., Beaudet, R.
(2003). Purification and Characterization of PrbA, a New Esterase from Enterobacter cloacae Hydrolyzing the Esters of 4-Hydroxybenzoic Acid (Parabens). J. Biol. Chem.
278: 12779-12785
[Abstract]
[Full Text]
-
Valkova, N., Lepine, F., Bollet, C., Dupont, M., Villemur, R.
(2002). prbA, a Gene Coding for an Esterase Hydrolyzing Parabens in Enterobacter cloacae and Enterobacter gergoviae Strains. J. Bacteriol.
184: 5011-5017
[Abstract]
[Full Text]