Previous Article | Next Article ![]()
Applied and Environmental Microbiology, June 2001, p. 2657-2664, Vol. 67, No. 6
Pharmaceutical Cosmetic Raw Materials and
Natural Products Research and Development Center, Institute for Science
and Technology Research and Development,1 and
Department of Pharmaceutical Technology, Faculty of
Pharmacy,2 and Department of Clinical
Immunology, Faculty of Associated Medical
Sciences,3 Chiang Mai University, 50200 Chiang Mai, Thailand, and Microbielle Genetik,
Universität Tübingen, D-72076
Tübingen,4 and Boehringer
Ingelheim Pharma KG, 88397 Biberach (Riss),5
Germany
Received 6 November 2000/Accepted 20 March 2001
The DNA fragment coding for kringle 2 plus serine protease
domains (K2S) of tissue plasminogen activator (tPA) was
inserted into a phagemid vector, pComb3HSS. In the recombinant vector, pComb3H-K2S, the K2S gene was fused to
gpIII of Tissue plasminogen activator
(tPA) is a polypeptide containing 527 amino acid residues (27,
33) with a molecular mass of 72 kDa. The molecule is divided
into five structural domains. Near the N-terminal region is a looped
finger domain followed by a growth factor domain and the two domains
kringle 1 and kringle 2. Both finger and kringle 2 domains bind
specifically to the fibrin clots, thereby accelerating tPA protein
activation of bound plasminogen. Next to the kringle 2 domain is the
serine protease domain, which has the catalytic site located at the C
terminus. This domain is responsible for converting plasminogen to
plasmin, which is important for the homeostasis of fibrin formation and clot dissolution. The correct folding of tPA requires the correct pairing of 17 disulfide bridges in the molecule (1).
Clinically, tPA is a thrombolytic agent of choice for the treatment of
acute myocardial infarction. It has the advantage of causing no side
effects such as systemic hemorrhaging and fibrinogen depletion
(7). Bowes melanoma cells were first used as a source of
tPA production for therapeutic purposes (12). Since a
consistent process efficiently producing high yields of highly purified
protein is required for clinical use, the construction of full-length recombinant tPA (rtPA) progressed to mammalian cells. Chinese hamster ovary cells were transfected with the tPA gene to synthesize rtPA (8, 22). The recombinant product produced by a
mammalian fermentation system was harvested from the culture medium.
Attracted by simplicity and economy of production, investigators made a number of efforts in producing rtPA from bacteria, especially from
Escherichia coli (10, 13, 30). Numerous
strategies have been proposed to overcome the problems of low yield and
the formation of inclusion bodies, which result in misfolding and in an
inactive enzyme. The other major criterion is to synthesize the
smallest molecule which is still active, instead of full-length tPA.
Several deletion-mutant variants including kringle 2 plus serine
protease (K2S) have been considered. However, the enzymatic activity of the recombinant K2S (rK2S) was obtained only when refolding
of the purified inclusion bodies from the cytoplasmic compartment was
achieved (16, 29). In order to avoid cumbersome refolding
processes and periplasmic protein delivery, special bacterial
expression systems were exploited (6, 31). Despite periplasmic expression of tPA, overexpression led to inactive aggregates, even in the relatively high-oxidizing conditions in the
periplasm. The other possibility is synthesis of the recombinant protein as an extracellular component. Kipriyanov et al.
(17) fused the PelB signal peptide to the N terminus of
the single chain (ScFv) and were able to obtain an active recombinant
product from E. coli culture supernatant. Recently, the
expression of certain recombinant antibody fragments in L forms of
Proteus mirabilis was described (28). As the
bacterial cells lack periplasmic space, the active recombinant antibody
fragment could be directly harvested from the culture supernatant.
However, the properties of an extracellular form of the heterologous
protein may be distinct from those of the periplasmic accumulated form.
In this study, we describe the production of extracellular and
periplasmic forms of K2S in E. coli. In a recent
report, the enzymatic properties of phage-displayed kringle 5 with the
plasminogen serine protease have been successfully demonstrated
(20). Since the cysteine number of this protein is similar
to that of K2S, we have evaluated whether the phage-displayed rK2S
exerts protease activity. Moreover, we applied a novel strategy to
secrete rK2S into the culture supernatant of E. coli. The
phage-displayed rK2S and the periplasmic and secreted forms were
compared with respect to fibrinogen-dependent serine protease activity.
Primer design.
In order to amplify a specific part of the
tPA gene, a pair of primers, SK2/174 (5'
GAGGAGGAGGTGGCCCAGGCGGCCTCTGAGGGAAACAGTGAC 3') and
ASSP (5' GAGGAGGAGCTGGCCGGCCTGGCCCGGTCGCATGTTGTCACG
3'), were synthesized (Life Technologies, Grand Island, N.Y.).
These primers were designed based on the human tPA gene retrieved from the National Center for Biotechnology Information databases (accession no. g137119). They were synthesized with SfiI end cloning
sites (underlined) in such a way that the reading frame from the ATG codon of the gp3 gene in the phagemid vector, pComb3HSS,
would be maintained throughout the inserted sequence.
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.6.2657-2664.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Secretion of Active Recombinant Human Tissue
Plasminogen Activator Derivatives in Escherichia
coli
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
M13 and linked to the OmpA signal sequence.
The resulting gene, rK2S-gpIII, was inducibly expressed
in Escherichia coli XL-1 Blue. The protein was presented
on the phage particle. To stop the expression of gpIII,
a stop codon between K2S and the gpIII
gene was inserted by site-directed mutagenesis. This mutated vector,
MpComb3H-K2S, was transformed in XL-1 Blue. After
induction with IPTG
(isopropyl-
-D-thiogalactopyranoside), rK2S was found
both in the periplasm as an inactive form of approximately 32% and in
the culture supernatant as an active form of approximately 68%.
The secreted form of rK2S was partially purified by ammonium sulfate
(55%) precipitation. The periplasmic form was isolated from whole
cells by chloroform extraction. The fibrin binding site of kringle 2 was demonstrated in all expressed versions (phage-bound, periplasmic,
and secreted forms) using the monoclonal anti-kringle 2 antibody
(16/B). Only the secreted form of rK2S revealed a fibrinogen-dependent amidolytic activity with the specific activity of 236 IU/µg. No amidolytic activity of rK2S was observed in either the periplasmic or
the phage-bound form. The secretion of rK2S as an active enzyme offers
a novel approach for the production of the active-domain deletion
mutant tPA, rK2S, without any requirements for bacterial compartment
preparation and in vitro refolding processes. This finding is an
important technological advance in the development of large-scale,
bacterium-based tPA production systems.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Amplification of the K2S gene by PCR. One microgram of SK2/174 and ASSP primers together with 50 ng of p51-3 template (obtained from Hiroshi Sasaki, Fujisawa Pharmaceutical, Osaka, Japan) was suspended in 100 µl of PCR mixture. Taq polymerase (2.5 U; Roche Molecular Biochemicals, Indianapolis, Ind.) was finally added to the solution. The titrated amplification condition was initiated with a jump start at 85°C for 4 min and then denaturation at 95°C for 50 s, annealing at 42°C for 50 s, and extension at 72°C for 1.5 min. Thirty-five rounds were performed. The mixture was further incubated at 72°C for 10 min. The 1,110-bp amplified product was subsequently purified with the QIAquick PCR purification kit (Qiagen, Hilden, Germany). The correctness of the purified product was confirmed by restriction enzymes.
Construction of phagemid expressing K2S. The purified PCR product of K2S and pComb3HSS phagemid (kindly provided by Carlos F. Barbas, Scripps Institute, La Jolla, Calif.) were digested with SfiI (Roche Molecular Biochemicals) to prepare specific cohesive cloning sites. Four micrograms of the purified PCR product was digested with 60 U of SfiI at 50°C for 18 h. For pComb3HSS, 20 µg of phagemid vectors was treated with 100 U of SfiI. Digested products of the purified PCR product of K2S and pComb3HSS (~3,300 bp) were subsequently gel purified with the QIAquick gel extraction kit (Qiagen). Five units of T4 ligase (Roche Molecular Biochemicals) was introduced to the mixture of 0.7 µg of purified SfiI-digested pComb3HSS and 0.9 µg of purified SfiI-digested PCR product. The ligation reaction mixture was incubated at 30°C for 18 h. The newly constructed phagemid was named pComb3H-K2S.
Transformation of XL-1 Blue. Two hundred microliters of CaCl2-competent E. coli XL-1 Blue (Stratagene, La Jolla, Calif.) was transformed with 70 ng of ligated or mutated product. The transformed cells were propagated by being spread on Luria-Bertani agar containing 100 µg of ampicillin and 10 µg of tetracycline (Sigma, St. Louis, Mo.) per ml. After cultivation at 37°C for 18 h, several antibiotic-resistant colonies were selected for plasmid minipreparations by the alkaline lysis method. Each purified plasmid was subjected to SfiI restriction site analysis. A transformant-harboring plasmid with the correct SfiI restriction site(s) was subsequently propagated for 18 h at 37°C in 100 ml of Luria-Bertani broth with ampicillin (100 µg/ml) and tetracycline (10 µg/ml). A plasmid maxipreparation was performed using the Qiagen Plasmid Maxi kit (Qiagen). The purified plasmid was reexamined for specific restriction sites by SfiI and sequenced with the AmpliTaq DNA Polymerase Terminator Cycle Sequencing kit (Perkin-Elmer Corporation, Foster City, Calif.).
Site-directed mutagenesis of pComb3H-K2S. Ten nanograms of pComb3H-K2S template was mixed with 125 ng of MSTPA and MASTPA primers. PfuTurbo DNA polymerase (Stratagene; 2.5 U) was added to the mixture for cycle amplification. The reaction started with one round of 95°C for 30 s followed by 16 rounds consisting of 95°C for 30 s, 55°C for 1 min, and 68°C for 9 min. The reaction tube was subsequently placed on ice for 2 min. In order to destroy the template strands, 10 U of DpnI restriction enzyme (Stratagene) was added to the amplification reaction and incubated for 1 h at 37°C. This synthesized product (MpComb3H-K2S) was further used to transform E. coli XL-1 Blue.
Preparation of phage-displayed rK2S.
After
pComb3H-K2S was transformed to XL-1 Blue, the phage display
technique was used. A clone of pComb3H-K2S-transformed XL-1 Blue was propagated in 10 ml of super broth (3% [wt/vol] tryptone, 2% [wt/vol] yeast extract, and 1% [wt/vol]
morpholinepropanesulfonic acid [MOPS]) containing ampicillin (100 µg/ml) and tetracycline (10 µg/ml) at 37°C until the optical
density (OD) at 600 nm of 1.5 was reached. The bacterial culture was
subsequently propagated in 100 ml of the same medium and cultured for
2 h. An amount (1012 PFU) of VCSM13 helper
phage (Stratagene) was used to infect the transformed XL-1 Blue. After
3 h of incubation, kanamycin at a final concentration of 70 µg/ml was added to the culture. The culture was left shaking (200 rpm) for 18 h at 37°C. Bacteriophages which harbored K2S on gp3
(K2S-
) were then harvested by adding 4% (wt/vol)
polyethylene glycol (PEG) with a molecular weight of 8,000 (Sigma) and
3% (wt/vol) NaCl. Finally, the harvested phage was resuspended in 2 ml
of phosphate-buffered saline, pH 7.4. The phage number was determined
by infecting XL-1 Blue. The CFU per milliliter was calculated as
described previously (21).
Expression of rK2S in shaker flasks.
MpComb3H-K2S-transformed XL-1 Blue was cultivated in 100 ml
of super broth at pH 7.0 in the presence of ampicillin (100 µg/ml) at
37°C until an OD at 600 nm of 0.8 was reached. Subsequently, the
protein synthesis was induced by 1 mM IPTG
(isopropyl-
-D-thiogalactopyranoside; Promega,
Madison, Wis.). The bacteria were further cultured by shaking (200 rpm)
for 6 h at 30°C. The culture supernatant was collected and
precipitated with 55% saturated ammonium sulfate (32).
The precipitate was reconstituted with phosphate-buffered saline, pH
7.2, and dialyzed in the same buffer solution at 4°C for 18 h.
Periplasmic proteins from bacterial cells were extracted by using a
chloroform shock as previously described by Ames et al.
(2).
Immunoassay quantification of rK2S.
In order to detect rK2S,
solid phase was coated with monoclonal anti-kringle 2 domain (16/B)
(generously provided by Ute Zacharias, Central Institute of Molecular
Biology, Berlin-Buch, Germany). The standard enzyme-linked
immunosorbent assay (ELISA) washing and blocking processes were
performed. Fifty microliters of 1011-CFU/ml
K2S-
or secretory rK2S was added into each anti-kringle 2-coated well. Antigen-antibody detection was carried out as follows. Either sheep anti-M13 conjugated with horseradish peroxidase (HRP; Pharmacia Biotech, Uppsala, Sweden) or sheep anti-tPA conjugated with
HRP (Cedarlane, Hornby, Ontario, Canada) was added to each reaction
well after the washing step. The substrate tetramethylbenzidine was added to every well, and the reaction was finally stopped with H2SO4 solution after
30 min of incubation. The standard melanoma tPA 86/670 (National
Institute for Biological Standards and Control, Potters Bar,
Hertfordshire, United Kingdom) was used as a positive control.
Amidolytic activity assay.
A test kit for the detection of
tPA amidolytic activity was purchased from Chromogenix (Molndal,
Sweden). The substrate mixture containing plasminogen and S-2251 was
used to determine serine protease activity. The
10
2 dilution of each ammonium-precipitated
sample was assayed with and without the stimulant, human fibrinogen
fragments. The assay procedure was carried out according to the COASET
tPA manual (Chromogenix).
SDS-PAGE and immunoblotting. The dialyzed precipitate product from the culture supernatant was further concentrated 10-fold with a Centricon 10 concentrator (Amicon, Beverly, Mass.). The concentrated sample was subjected to protein separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), 10% resolving gel, in the reducing buffer followed by electroblotting to nitrocellulose. The nitrocellulose was then blocked with 4% skimmed milk for 2 h. In order to detect rK2S, a proper dilution of monoclonal anti-tPA (107/1) (provided by Stefano Grammatikos, Zellbiologie, Boehringer Ingelheim Pharma KG, Biberach [Riss], Germany) was used. After the washing step, sheep anti-mouse immunoglobulin conjugated with HRP was applied to the nitrocellulose. The chemiluminescence substrate, ECL Western blotting detection reagent (Amersham, Little Chalfont, United Kingdom), was used to locate the reactive band. The immunoreactive band was visualized by exposing the processed nitrocellulose membrane to Hyperfilm ECL (Amersham).
Copolymerized plasminogen PAGE. An 11% resolving polyacrylamide gel was copolymerized with plasminogen and gelatin as previously described by Heussen and Dowdle (14). The stacking gel was prepared as a 4% concentration without plasminogen and gelatin. Electrophoresis was performed at 4°C in a constant current of 8 mA. The residual SDS in the gel slab was removed after gentle shaking at room temperature for 1 h in 2.5% Triton X-100. Then, the gel slab was incubated in 0.1 M glycine-NaOH, pH 8.3, for 5 h at 37°C. Finally, the gel slab was stained and destained by a standard Coomassie brilliant blue (R-250) dyeing system. The location of the peptide harboring enzymatic activity was not stained by dye, in contrast to the blue-paint background.
| |
RESULTS |
|---|
|
|
|---|
Construction of K2S gene carrying vector.
The
kringle 2 and the serine protease portion of tPA
(Ser174 in kringle 2 domain to
Pro527 in the serine protease) in the vector
p51-3 were amplified using primers SK2/174 and ASSP. The amplified
1,110-bp product was demonstrated by agarose gel electrophoresis (Fig.
1, lane 2) and was inserted into
pComb3HSS phagemid by double SfiI cleavage sites on 5' and 3' ends in the correct reading frame. Thus, a new vector harboring the
K2S gene, pComb3H-K2S, was generated. In this
vector, K2S was flanked upstream by the OmpA signal sequence
and downstream by gpIII. The correct insertion of
K2S was verified by restriction analysis with
SfiI (Fig. 2, lane 3), PCR
analysis (demonstration of a single band at 1,110 bp), and DNA
sequencing. The map of pComb3H-K2S is shown in Fig.
3.
|
|
|
Phage-displayed rK2S.
VCSM13 filamentous phage was used to
infect the pComb3H-K2S transformant of XL-1 Blue,
X[K2S]. VCSM13 was propagated and incorporated into the
K2S-gpIII fusion protein during the viral packaging processes. The
harvested recombinant phage (K2S-
) gave a concentration
of 5.4 × 1011 CFU/ml determined by
reinfecting XL-1 Blue with PEG-precipitated phages. These recombinant
phage particles were verified for the expression of rK2S by the
sandwich ELISA. The phage-bound heterologous K2S protein was recognized
by the monoclonal anti-kringle 2 antibody (16/B) using an
HRP-conjugated sheep anti-tPA antibody detection system. The absorbance
of this assay was 1.12 ± 0.03 (Table
1). The detectable amount of K2S on
1012 phage particles is 336 ng of protein using a
standard melanoma tPA as a control. In order to corroborate that
K2S-gpIII fusion protein was associated with phage particles,
HRP-conjugated sheep anti-tPA antibody was replaced by HRP-conjugated
sheep anti-M13 antibody. This immunoreaction exhibited an absorbance of
1.89 ± 0.07 (Table 1). When the capture antibody was sheep
anti-M13 antibody, an extremely low level of K2S was observed with
HRP-conjugated sheep anti-tPA antibody. The absorbance was only
0.17 ± 0.01 (Table 1). This suggested that there was only a
minority of purified phage particles which carried the K2S-gpIII fusion
protein. VCSM13 prepared from nontransformed XL-1 Blue was used as a
negative control.
|
Construction of MpComb3H-K2S.
A stop codon
between K2S and gpIII in pComb3H-K2S
was generated with the aid of mutagenic primers (MSTPA and MASTPA)
(Fig. 4). In order to enrich the newly
synthesized and mutated MpComb3H-K2S, the cycle
amplification mixture was thoroughly digested with DpnI to
degrade the old dam-methylated pComb3H-K2S
template (DpnI prefers dam-methylated DNA).
After transforming XL-1 Blue with MpComb3H-K2S, a
transformant, XM[K2S], was selected for further study. As
a consequence of base pair substitution, one SfiI cleavage
site close to the 3' end of the K2S gene was lost after
site-directed mutagenesis. A linear version of SfiI-cleaved
MpComb3H-K2S was observed at 4,319 bp without the appearance
of the inserted K2S gene fragment (Fig.
5, lane 3). Thus, the K2S gene
encoded by MpComb3H-K2S was expressed in a
non-gpIII fusion form in XM[K2S].
|
|
Expression and purification of K2S. The K2S expression in XM[K2S] was induced by IPTG. The rK2S was detected both in the periplasmic space and in the culture supernatant by an ELISA technique. The amount of the heterologous protein in each preparation was determined by sandwich ELISA using standard tPA for comparison. From 100 ml of the bacterial culture in the shake flask with the OD at 600 nm of 5.0, the periplasmic fraction yielded 1.38 µg of rK2S (approximately 32%) whereas 2.96 µg (approximately 68%) was obtained in the ammonium-precipitated culture supernatant. Sandwich ELISA was used to verify the PEG-precipitated phage from the VCSM13-infected XM[K2S]. No rK2S captured by the monoclonal anti-kringle 2 antibody was detected by an HRP-conjugated anti-M13 antibody, indicating that K2S was not present on the phage particles when gpIII was missing.
Amidolytic activity measurement.
If the serine protease domain
is present in the sample, plasminogen will be converted to plasmin. The
plasmin produced will further digest the S-2251 substrate to a color
product, p-nitroaniline, which has a maximum absorbance at
405 nm. The specific activity of the recombinant product is directly
proportional to the absorbance. The fibrinogen-dependent
enzymatic activities of K2S-
, periplasmic rK2S, and
the culture supernatant rK2S were evaluated and compared. Both
K2S-
and periplasmic rK2S demonstrated notably low
enzymatic activity below the detection limit of the assay (0.25 IU/ml). The culture supernatant rK2S gave fibrinogen-dependent enzymatic activity of 7 IU/ml, i.e., 700 IU from a 100-ml culture. Without fibrinogen, no enzymatic activity of the rK2S purified from culture supernatant was observed, whereas the standard melanoma tPA showed some activity.
Demonstration of recombinant protein by immunoblotting.
Partially purified K2S from the culture supernatant of
XM[K2S] revealed a molecular mass of 39 kDa
by using monoclonal anti-tPA (107-30/1) (Fig.
6). For the negative control, the
partially purified culture supernatant of nontransformed XL-1 Blue
showed no reactive band of a similar size.
|
Localization of active enzyme by PAGE.
The plasminogen was
copolymerized and immobilized with gelatin in the polyacrylamide gel
prior to electrophoresis. The ammonium sulfate-precipitated culture
supernatants of XL-1 Blue, XL-1 Blue transformed with pComb3HSS, and
XM[K2S] were analyzed (Fig.
7). All samples were processed under
nonreducing conditions in order to preserve the correct conformation
and activity of the serine protease domain. The transparent areas of
the serine protease-digested plasminogen were observed only in the
ammonium sulfate-precipitated culture supernatants of
XM[K2S] at 34- and 37-kDa positions. Other samples gave no
clear zones. The positive control lane of the standard melanoma tPA
demonstrated enzymatic activities at 66- and 72-kDa positions.
|
| |
DISCUSSION |
|---|
|
|
|---|
In this study, we constructed an expression vector, pComb3H-K2S, encoding kringle 2 plus serine protease domains. Phage display of K2S was successfully performed since the backbone of pComb3H-K2S was phagemid pComb3HSS, a variant of pComb3 (3). The expressed heterologous protein was fused to the essential domain of gpIII. The K2S portion was identified in the phage preparation by a sandwich ELISA technique. By using HRP-conjugated anti-M13, the packed filamentous phages presenting K2S on their surfaces were confirmed. However, only small numbers of phage particles having the K2S-gpIII fusion molecule were present. This was due to the low turnover of substrate in the ELISA used to detect the anchored phages on a solid phase with HRP-conjugated anti-tPA. The low amount of fusion protein was likely due to the fact that K2S-gpIII expression was not induced by IPTG. Overexpression of K2S-gpIII led to an incomplete packaging of the fusion protein on the phage particles (data not shown). The number of harvested phages packaging pComb3H-K2S was independent of foreign protein incorporation. The concentration of the harvested phages was significantly high (5.4 × 1011 CFU/ml). These data were unambiguous because K2S was not detected in the control (VCSM13 phage from the infected XL-1 Blue).
In general, pComb3HSS has been used to clone Fd and light chain genes (4). The gpIII gene plus the first stop codon can be removed by cleaving with NheI 3' to the first stop codon and SpeI 5' to gpIII and religated (NheI and SpeI leave complementary cohesive ends). Consequently, the second stop codon is placed behind the Fd gene and the free form of Fd is obtained (please see the PhageAB website at http://www.ams.cmu.ac.th/clinimm/phageab.htm). In our study, K2S was inserted at the two SfiI cloning sites; as a consequence, one SpeI cleavage site is lost. Thus, to synthesize rK2S in a free form, a stop codon was introduced 3' of the K2S gene by non-PCR site-directed mutagenesis using a set of mutation primers. After transformation, the MX[K2S] carrying the mutated vector (MpComb3H-K2S) which lacked one of the SfiI cleavage sites was established. This strategy facilitated the production of free rK2S and its release to the periplasmic space and the culture supernatant. Free rK2S also lost its competence to assemble phage particles since the gpIII essential domain was absent. This cloning strategy can be applied to other genes whose gene products should be presented on phages or found in the free form. This approach appears to be advantageous, since it uses only a single restriction enzyme in cloning and does not require further restriction enzyme digestion, fragment purification, and ligation steps.
The K2S polypeptide has nine disulfide bridges (5, 29),
which are needed for proper folding. For the detection of rK2S either
in the free-form rK2S or the K2S-
, a monoclonal antibody (16/B)
recognizing the kringle 2 domain was used. This antibody recognizes
only the correctly folded rK2S at the kringle 2 domain (36). In addition, this antibody also binds to the area
involved in fibrin binding. Therefore, the recombinant molecule
detected by sandwich ELISA retained at least a fibrin binding site. Our data demonstrated that the free-form rK2S and the K2S-
consisted of an active kringle 2 domain.
The amidolytic activity assay was used to evaluate the functions of the
periplasmic rK2S, ammonium-precipitated culture supernatant rK2S, and
K2S-
. The role of the kringle 2-specific region in augmenting the enzymatic activity was verified under the condition of
fibrinogen stimulation (25). The digestion of plasminogen to plasmin by every heterologous protein preparation was remarkably low
when fibrinogen was not included in the reaction. Interestingly, only
ammonium-precipitated culture supernatant rK2S demonstrated specific
activity in the fibrinogen stimulation experiment. This implies that
partially purified rK2S from the culture supernatant harbors functional
kringle 2 and serine protease. The molecular sizes of these active
products, which were analyzed by a copolymerized plasminogen PAGE, were
34 and 37 kDa. They were not exactly equal to that demonstrated by
immunoblotting (39 kDa) because the samples for copolymerized
plasminogen PAGE were prepared under nonreducing conditions. rK2S
obtained from the periplasmic fraction gave low enzymatic activity.
This may be due to the effect of improper folding and aggregation
inside the periplasmic space resulting from overproduction of the
heterologous protein. However, this explanation cannot be used for the
low enzymatic activity of K2S-
, since the K2S-gpIII
fusion protein was not overexpressed.
Recently, Lasters et al. (20) succeeded in displaying an
active enzyme of a plasminogen derivative containing kringle 5 to
serine protease (K5S) on phage particles using the Fd-Tet-SN vector.
The main difference between that work and our study is that our
pComb3HSS contains residues 230 to 406 of gpIII whereas their vector
has complete sequences of 406 amino acids of gpIII (26).
According to the smaller molecular size, the serine protease active
site of rK2S was supposed to be closer to the phage particle than to
rK5S. The steric hindrance of the huge phage particle may affect the
binding of plasminogen to the catalytic site of the K2S molecule,
resulting in the low p-nitroaniline product of
plasmin-digested S-2251. Moreover, the activity of K5S-
was measured by using direct plasmin substrate S-2403. This small substrate molecule eventually can reach the enzyme groove without being
obstructed by the phage particle. Therefore, if the ligand-binding site
of the recombinant protein is proximal to the C terminus, the length of
gpIII encoded on the vector has to be considered.
The specific activity of rK2S from the ammonium-precipitated culture supernatant was 236 IU/µg, which was approximately twofold less than the activity of the standard melanoma tPA. We presume that not all of the rK2S was successfully folded and left the periplasmic space before inactive molecules were formed. The beneficial effect of using L-form cells of P. mirabilis lacking periplasmic space for production of active secretory ScFv supports this notion (28). The enzymatic activity of rK2S from ammonium-precipitated E. coli culture supernatant can be increased by varying the amounts of inducer (IPTG), the incubation conditions, and the harvesting period (17). One recent report suggested the use of glycerol in combination with IPTG to increase the productive yield of insulin-like growth factor in E. coli (23). The amount of active recombinant protein depends on the amount of glycerol used. This finding will be useful in further studies. As has been known, oxidizing compounds such as H2O2 might favor the formation of disulfide bridges. We have also investigated the influence of H2O2 concentrations ranging from 0.005 to 2.0% on extracellular K2S production and folding (data not shown). Not only was the positive effect not observed, but also H2O2 concentrations above 0.005% stopped cell growth and caused cell damage.
So far, at least four reports have described the preparation of active
rK2S from E. coli. Obukowicz et al. (25)
expressed and purified rK2S from periplasmic space. High enzymatic
activity, of 396 IU/µg, was obtained for this heterologous protein
since purification of the active form was done with
Erythrina inhibitor-Sepharose (15, 19). The
obvious disadvantage of this method was an extra periplasmic extraction
step, which was not suitable for large-scale production. Therefore, we
employed the OmpA instead of the PhoA signal peptide. As the OmpA
signal peptide translocates the recombinant proteins to the outer
surface, it facilitates the release of the molecule into the culture
medium to a greater extent than does the PhoA signal peptide. The OmpA
delivery system has been successfully demonstrated in a number of
studies, e.g., studies using streptokinase (18) and TolAII
(35). In addition, incomplete cleavage of the PhoA leader
peptide was used to produce human interleukin-1
(9,
11). This can affect the acquisition of the mature and active
form of the heterologous protein. Apart from the release of rK2S into
the periplasm, the expressed rK2S found in the cytoplasm is also of
interest. Saito et al. (29) introduced in vivo
renaturation processes for the expressed rK2S, which was purified from
the cytoplasmic space of E. coli as inclusion bodies. In
fact, the improvement of refolding processes was established by
Boehringer Mannheim for the commercial product Reteplase
(24). However, the renaturation procedure is not
cost-effective.
In 1991, Waldenström et al. (34) first constructed a
vector (pEZZK2P) for the secretion of kringle 2 plus the serine
protease domain in E. coli culture supernatant.
Hydroxylamine was used to remove the ZZ fusion peptide from the
immunoglobulin G-Sepharose-purified fraction. The cleavage sites of the
kringle 2 plus serine protease were modified
(Asn177
Ser and Asn184
Gln) to protect the protein from hydroxylamine digestion. Thus, the
synthetic molecule is not suitable for therapeutic purposes since the
unusual sequence may activate the human immune system. Moreover, the
conformation of the kringle 2 domain that enhances the amidolytic
activity was not elucidated.
We describe here an alternative strategy for synthesizing active rK2S and its partial purification from the E. coli culture supernatant. This improved method will also facilitate the study of other complex polypeptides. The selection of a suitable host strain of E. coli and large-scale production of rK2S in an appropriate fermenting system will be established in the near future.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by The Thailand Research Fund (TRF) under the Royal Golden Jubilee Ph.D. Scholarship Program (RGJ-TRF) and Institute for Science and Technology Research and Development (IST), Chiang Mai University, Chiang Mai, Thailand.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Pharmaceutical Technology, Faculty of Pharmacy, Chiang Mai University, 50200 Chiang Mai, Thailand. Phone: 66-53-894806 or 66-53-944338. Fax: 66-53-894169. E-mail: pmpti006{at}chiangmai.ac.th.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Allen, S.,
H. Y. Naim, and N. J. Bulleid.
1995.
Intracellular folding of tissue-type plasminogen activator. Effects of disulfide bond formation on N-linked glycosylation and secretion.
J. Biol. Chem.
270:4797-4804 |
| 2. |
Ames, G. F.,
C. Prody, and S. Kustu.
1984.
Simple, rapid, and quantitative release of periplasmic proteins by chloroform.
J. Bacteriol.
160:1181-1183 |
| 3. |
Barbas, C. F., III,
A. S. Kang,
R. A. Lerner, and S. J. Benkovic.
1991.
Assembly of combinatorial antibody libraries on phage surfaces: the gene III site.
Proc. Natl. Acad. Sci. USA
88:7978-7982 |
| 4. | Barbas, C. F., III, and J. Wagner. 1995. Synthetic human antibodies: selecting and evolving functional proteins. Compan. Methods Enzymol. 8:94-103[CrossRef]. |
| 5. |
Bennett, W. F.,
N. F. Paoni,
B. A. Keyt,
D. Botstein,
A. J. Jones,
L. Presta,
F. M. Wurm, and M. J. Zoller.
1991.
High resolution analysis of functional determinants on human tissue-type plasminogen activator.
J. Biol. Chem.
266:5191-5201 |
| 6. |
Betton, J. M.,
N. Sassoon,
M. Hofnung, and M. Laurent.
1998.
Degradation versus aggregation of misfolded maltose-binding protein in the periplasm of Escherichia coli.
J. Biol. Chem.
273:8897-8902 |
| 7. | Camiolo, S. M., S. Thorsen, and T. Astrup. 1971. Fibrinogenolysis and fibrinolysis with tissue plasminogen activator, urokinase, streptokinase-activated human globulin and plasmin. Proc. Soc. Exp. Biol. Med. 38:277-280. |
| 8. | Cartwright, T. 1992. Production of t-PA from animal cell culture. Anim. Cell Biotechnol. 5:217-245. |
| 9. | Curry, K. A., A. W. Yem, M. R. Deibel, Jr., N. T. Hatzenbuhler, J. G. Hoogerheide, and C. S. Tomich. 1990. Escherichia coli expression and processing of human interleukin-1 beta fused to signal peptides. DNA Cell Biol. 9:167-175[Medline]. |
| 10. | Datar, R. V., T. Cartwright, and C.-G. Rosen. 1993. Process economics of animal cell and bacterial fermentations: a case study analysis of tissue plasminogen activator. Bio/Technology 11:349-357[CrossRef][Medline]. |
| 11. | Denefle, P., S. Kovarik, T. Ciora, N. Gosselet, J. C. Benichou, M. Latta, F. Guinet, A. Ryter, and J. F. Mayaux. 1989. Heterologous protein export in Escherichia coli: influence of bacterial signal peptides on the export of human interleukin 1 beta. Gene 85:499-510[CrossRef][Medline]. |
| 12. | Griffiths, J. B., and A. Electricwala. 1987. Production of tissue plasminogen activators from animal cells. Adv. Biochem. Eng. Biotechnol. 34:147-166[Medline]. |
| 13. | Harris, T. J., T. Patel, F. A. Marston, S. Little, J. S. Emtage, G. Opdenakker, G. Volckaert, W. Rombauts, A. Billiau, and P. De Somer. 1986. Cloning of cDNA coding for human tissue-type plasminogen activator and its expression in Escherichia coli. Mol. Biol. Med. 3:279-292[Medline]. |
| 14. | Heussen, C., and E. B. Dowdle. 1980. Electrophoretic analysis of plasminogen activators in polyacrylamide gels containing sodium dodecyl sulfate and copolymerized substrates. Anal. Biochem. 102:196-202[CrossRef][Medline]. |
| 15. |
Heussen, C.,
F. Joubert, and E. B. Dowdle.
1984.
Purification of human tissue plasminogen activator with Erythrina trypsin inhibitor.
J. Biol. Chem.
259:11635-11638 |
| 16. | Hu, C. K., U. Kohnert, O. Wilhelm, S. Fischer, and M. Llinas. 1994. Tissue-type plasminogen activator domain-deletion mutant BM 06.022: modular stability, inhibitor binding, and activation cleavage. Biochemistry 33:11760-11766[CrossRef][Medline]. |
| 17. | Kipriyanov, S. M., G. Moldenhauer, and M. Little. 1997. High level production of soluble single chain antibodies in small-scale Escherichia coli cultures. J. Immunol. Methods 200:69-77[CrossRef][Medline]. |
| 18. | Ko, J. H., D. K. Park, I. C. Kim, S. H. Lee, and S. M. Byun. 1995. High-level expression and secretion of streptokinase in Escherichia coli. Biotechnol. Lett. 17:1019-1024[CrossRef]. |
| 19. |
Kouzuma, Y.,
N. Yamasaki, and M. Kimura.
1997.
The tissue-type plasminogen activator inhibitor ETIa from Erythrina variegata: structural basis for the inhibitory activity by cloning, expression, and mutagenesis of the cDNA encoding ETIa.
J. Biochem. (Tokyo)
121:456-463 |
| 20. | Lasters, I., N. Van Herzeele, H. R. Lijnen, D. Collen, and L. Jespers. 1997. Enzymatic properties of phage-displayed fragments of human plasminogen. Eur. J. Biochem. 244:946-952[Medline]. |
| 21. |
Lobel, L. I.,
P. Rausch,
I. Trakht,
S. Pollak, and J. W. Lustbader.
1997.
Filamentous phage displaying the extracellular domain of the hLH/CG receptor bind hCG specifically.
Endocrinology
138:1232-1239 |
| 22. | Lubiniecki, A., R. Arathoon, G. Polastri, J. Thomas, M. Wiebe, R. Garnick, A. Jones, R. van Reis, and S. Builder. 1990. Selected strategies for manufacture and control of recombinant tissue plasminogen activator prepared from cell culture, p. 442-451. In R. E. Spier, J. B. Griffiths, J. Stephenne, and P. J. Crooy (ed.), Advances in animal cell biology and technology for bioprocesses. Butterworths, London, United Kingdom. |
| 23. | Lucic, M. R., B. E. Forbes, S. E. Grosvenor, J. M. Carr, J. C. Wallace, and G. Forsberg. 1998. Secretion in Escherichia coli and phage-display of recombinant insulin-like growth factor binding protein-2. J. Biotechnol. 61:95-108[CrossRef][Medline]. |
| 24. | Martin, U., S. Fischer, U. Kohnert, H. Lill, R. Rudolph, G. Sponer, A. Stern, and K. Strein. 1990. Properties of a novel plasminogen activator (BM 06.022) produced in Escherichia coli. Z. Kardiol. 79:167-170. |
| 25. | Obukowicz, M. G., M. E. Gustafson, K. D. Junger, R. M. Leimgruber, A. J. Wittwer, T. C. Wun, T. G. Warren, B. F. Bishop, K. J. Mathis, D. T. McPherson, N. R. Siegel, M. G. Jenning, B. B. Brightwell, J. A. Diaz-Clier, L. D. Bell, C. S. Craik, and W. C. Tacon. 1990. Secretion of active kringle-2-serine protease in Escherichia coli. Biochemistry 29:9737-9745[CrossRef][Medline]. |
| 26. | Parmley, S. F., and G. P. Smith. 1988. Antibody-selectable filamentous fd phage vectors: affinity purification of target genes. Gene 73:305-318[CrossRef][Medline]. |
| 27. | Pennica, D., W. E. Holmes, W. J. Kohr, R. N. Harkins, G. A. Vehar, C. A. Ward, W. F. Bennett, E. Yelverton, P. H. Seeburg, H. I. Heyneker, D. V. Goeddel, and D. Collen. 1983. Cloning and expression of human tissue-type plasminogen activator cDNA in E. coli. Nature 301:214-221[CrossRef][Medline]. |
| 28. |
Rippmann, J. F.,
M. Klein,
C. Hoischen,
B. Brocks,
W. J. Rettig,
J. Gumpert,
K. Pfizenmaier,
R. Mattes, and D. Moosmayer.
1998.
Procaryotic expression of single-chain variable-fragment (scFv) antibodies: secretion in L-form cells of Proteus mirabilis leads to active product and overcomes the limitations of periplasmic expression in Escherichia coli.
Appl. Environ. Microbiol.
64:4862-4869 |
| 29. | Saito, Y., Y. Ishii, H. Sasaki, M. Hayashi, T. Fujimura, Y. Imai, S. Nakamura, S. Suzuki, J. Notani, T. Asada, H. Horiai, K. Masakazu, and N. Mineo. 1994. Production and characterization of a novel tissue-type plasminogen activator derivative in Escherichia coli. Biotechnol. Prog. 10:472-479[CrossRef][Medline]. |
| 30. | Sarmientos, P., M. Duchesne, P. Denèfle, J. Boiziau, N. Fromage, N. Delporte, F. Parker, Y. Lelièvre, J.-F. Mayaux, and T. Cartwright. 1989. Synthesis and purification of active human tissue plasminogen activator from Escherichia coli. Bio/Technology 7:495-501[CrossRef]. |
| 31. | Scherrer, S., N. Robas, H. Zouheiry, G. Branlant, and C. Branlant. 1994. Periplasmic aggregation limits the proteolytic maturation of the Escherichia coli penicillin G amidase precursor polypeptide. Appl. Microbiol. Biotechnol. 42:85-89[CrossRef][Medline]. |
| 32. | Soeda, S., M. Kakiki, H. Shimeno, and A. Nagamatsu. 1986. Rapid and high-yield purification of porcine heart tissue-type plasminogen activator by heparin-sepharose choromatography. Life Sci. 39:1317-1324[CrossRef][Medline]. |
| 33. |
Szarka, S. J.,
E. G. Sihota,
H. R. Habibi, and S.-L. Wong.
1999.
Staphylokinase as a plasminogen activator component in recombinant fusion proteins.
Appl. Environ. Microbiol.
65:506-513 |
| 34. | Waldenström, M., E. Holmgren, A. Attersand, C. Kalderen, B. Lowenadler, B. Raden, L. Hansson, and G. Pohl. 1991. Synthesis and secretion of a fibrinolytically active tissue-type plasminogen activator variant in Escherichia coli. Gene 99:243-248[CrossRef][Medline]. |
| 35. | Wan, E. W.-M., and F. Baneyx. 1998. TolAIII co-overexpression facilitates the recovery of periplasmic recombinant proteins into the growth medium of Escherichia coli. Protein Expr. Purif. 14:13-22[CrossRef][Medline]. |
| 36. | Zacharias, U., B. Fischer, F. Noll, and H. Will. 1992. Characterization of human tissue-type plasminogen activator with monoclonal antibodies: mapping of epitopes and binding sites for fibrin and lysine. Thromb. Haemostasis 67:88-94[Medline]. |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»