INTRODUCTION

Top Abstract Introduction Materials and Methods Results and Discussion References

Exopolysaccharides (EPSs) produced by Streptococcus thermophilus have received a great deal of interest recently, since they are important for the rheological behaviour and texture of fermented milk (for a review, see reference 7). Furthermore, polysaccharides with defined properties produced by safe lactic acid bacteria have a potential as thickeners, stabilizers and texturizers. The biosynthetic pathways for EPSs from precursors in the form of nucleotide sugars have been the focus of recent studies (26, 27), and the genes coding for the enzymes necessary for EPS synthesis in S. thermophilus have been cloned (8, 25, 26). However, less is known about the regulation of the metabolic flux toward the precursor nucleotide sugars. UDP galactose and UDP glucose are formed from galactose 1-phosphate and glucose 1-phosphate (-G1P), and the genes and encoded enzymes in the Leloir pathway which are involved have been characterized in S. thermophilus (20, 21).

Most strains of S. thermophilus are considered galactose negative, since they do not ferment galactose, and the galactose moiety of lactose is secreted when they are grown on lactose (28). However, the genes necessary for galactose catabolism are present, even though they are normally not expressed (6, 11). At the branching point between glycolysis and the Leloir pathway, -phosphoglucomutase (PGM) is present, which interconverts -G1P and glucose 6-phosphate. It is thus a key enzyme between glycolysis and the Leloir enzymes for EPS synthesis. When glucose is the carbon source, PGM is required for the synthesis of -G1P, which is used by uridyltransferases for the production of nucleotide sugars. In S. pneumoniae, deletion of a gene coding for PGM decreased capsule biosynthesis to less than 10% (9). On the other hand, deletion of PGM in Escherichia coli leads to the accumulation of intracellular polysaccharide in galactose-growing cells since this prevents -G1P from entering glycolysis (1, 14), showing that the role of PGM is dependent on the principal flux direction across the enzyme. Recent results showed a linear relationship between PGM activity and EPS production on different sugars in S. thermophilus (4). However, the direction of the metabolic flux across PGM has not been determined in S. thermophilus.

In this study, we describe the role of PGM in glucose and lactose metabolism of S. thermophilus and its relationship to EPS production. The results indicate that the Leloir pathway is responsible for the generation of EPS precursors in lactose-growing streptococci.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results and Discussion References

Bacterial strains, media, and culture conditions. The strains and plasmids used are listed in Table 1. S. thermophilus strains were cultivated at 37 or 42°C. E. coli strains were grown in Luria-Bertani medium or Terrific broth. S. thermophilus was maintained in Elliker broth (Difco) supplemented with 1% meat extract (Merck) or in M17 (Oxoid). In controlled batch experiments, a modified MRS medium (5) with 25 g of Bacteriological peptone (Oxoid) per liter and 5 g of yeast nitrogen base without amino acids (Difco) per liter was used. Lactose (75 g liter¹) or glucose (50 g liter¹) was used as the carbohydrate source. Spectinomycin and ampicillin were used at concentrations of 100 µg ml¹. Erythromycin was used at a concentration of 200 µg ml¹ for E. coli and 0.2 µg ml¹ for S. thermophilus. In batch experiments, only the precultures were grown under selective pressure and cell extracts from the late exponential growth phase were checked for PGM activity. The batch cultures were performed in duplicate in Bioflo III fermentors (New Brunswick Scientific Co., Edison, N.J.) at 42°C with an inital volume of 1.5 liters. Anaerobic conditions were maintained by nitrogen flushing in the headspace. The pH was adjusted to 6.2 by the automatic addition of 10 N NaOH.

DNA techniques and cloning procedure. Plasmid DNA was isolated from E. coli using Quantum kits (Bio-Rad Laboratories AB). For S. thermophilus plasmid preparations, the Quantum miniprep kit was modified so that the cell pellets were dissolved in 140 µl of cell resuspension solution plus 60 µl of 100 mg of lysozyme solution ml¹ and incubated at 37°C for 15 min. Chromosomal DNA was isolated using Qiagen genomic tips. DNA digestion, dephosphorylation, agarose gel electrophoresis, and ligation were performed by standard methods (3). All DNA enzymes were obtained from Roche Diagnostics Scandinavia AB. Gel fragments were purified using Qiaquick kits (Qiagen Inc., Santa Clarita, Calif.). Ultracompetent E. coli strains were prepared and transformed as previously described (12). S. thermophilus was transformed as previously described (18). PCR was performed with Pwo DNA polymerase, and Inverse PCR was performed with an Expand High Fidelity system, using standard conditions as recommended by the manufacturer (Roche). Cycle sequencing was performed with the dRhodamine Terminator Ready kit (Perkin-Elmer, Boston, Mass.). Degenerate primers 5'-GGAATTCCACNGCNGGNATGMGNGG-3' (restriction sites underlined) and 5'-GCTCTAGAGCRTCNGGRTCNGTNGC-3' were used to amplify an internal fragment of pgmA. The product was cut with EcoRI and XbaI, inserted into pUC19, and sequenced. Chromosomal S. thermophilus DNA was cleaved in separate reactions with XbaI, EcoRI, and HindIII. The cleaved DNA was religated and used as a template for inverse PCR with primers 5'-GAAACTGCAGTTGGACGAAGGCTCTCGA-3' and 5'-GAAACTGCAGATGCCGACGTATTGGTTG-3'. The products were cloned in pUC19 and used to sequence the remainder of pgmA and to map the surroundings. The whole gene was finally amplified from chromosomal DNA by PCR and sequenced. The gene was sequenced in both directions, using DNA templates from at least two independent PCR amplicons.

Overexpression of pgmA. For overexpression of pgmA in E. coli, the gene was amplified from S. thermophilus LY03 with primers 5'-CGGGATCCTTTAGTTGTGATACAATGTAAG-3' and 5'-TGCGAGCTCTTGGTGTAGCAGCGAAAG-3', cleaved with BamHI and SacI, and inserted into pUC19, yielding pFL36. The resulting plasmid was transformed into W1485pgm::tet, giving TMB2001. For promoter analysis in S. thermophilus, pFL36 was digested with BamHI and partially digested with EcoRI and the pgmA gene was inserted into pLZ12spec, resulting in pFL38. The pgmA gene was also cloned in the other direction in pFL39 by ligating the pgmA gene from pFL36, obtained by BamHI and partial Asp700I cleavage, into XbaI-blunt and BamHI-digested pLZ12spec. pFL42 was created by PCR-amplifying the pgmA gene with a promoter using primers CG GGATCCCGTAATTCTACTCAGCAGTGGA and 5'-TGCGAGCTCTTGGTGTAGCAGCGAAAG-3'. The product was cleaved with BamHI and inserted into pLZ12spec (BamHI-EcoRI blunt).

Inactivation of pgmA. An internal 1,091-bp EcoRI-HindIII fragment of pgmA was cut from pFL36 and inserted into pG⁺host9, yielding pFL41. pFL41 was transformed into LY03, and the transformants were recovered at 30°C. Plasmid integration was selected for by growing the cells at 37°C in M17 containing erythromycin. Colonies on agar plates were checked by PCR for single integration. One integrant was chosen and checked for pgmA activity. The strain was named TMB 6001 and maintained at 42°C or 80°C to prevent loss of the integration.

Measurement of growth, substrate consumption, and product formation. The optical density at 620 nm was used to monitor cell growth after appropriate dilution of samples. Samples for substrate and product determination were filtered through 0.2-µm-pore-size filters immediately after sampling and kept at 4°C until analysis. Lactose, galactose, and lactate were separated at 65°C on a cation-exchange column (Aminex HPX-87H; Bio-Rad) and quantified using a refractive index detector (RID 6A; Shimadzu Co.). The mobile phase was 5 mM H₂SO₄ at a flow rate of 0.6 ml min¹. At least three samples were taken for EPS analysis during the exponential growth phase. EPSs were isolated by spinning after removal of cells and proteins with trichloracetic acid and precipitation with acetone, as described by Degeest and De Vuyst (5). The anthrone method with a glucose standard was used for quantification of the isolated EPS (16). The EPS concentrations were converted to moles of carbon (cmol) by using 30 g cmol¹, as in the repeating units consisting of galactose and glucose (5).

PGM and PMM measurements. Cell extracts were prepared from cells harvested in the mid-exponential phase that were washed twice in 50 mM potassium phosphate buffer (pH 7.0). E. coli was lysed by incubation of the cells in buffer containing lysozyme, DNase, RNase, and phenylmethylsulfonyl fluoride, followed by freezing and thawing. S. thermophilus cell extracts were prepared in an X-press (AB Biox). Cell debris was removed by centrifugation at 15,000 × g for 15 min at 4°C. PGM and phosphomannomutase (PMM) activities were measured in 50 mM triethanolamine buffer (pH 7.2) with 5 mM MgCl₂ in coupled assays at 37°C by monitoring the formation of NADPH spectrophotometrically. The assay mixture for PGM contained 0.4 mM NADP⁺, 65 µM glucose 1,6-bisphosphate, and 2 U of glucose 6-phosphate dehydrogenase ml¹, and the assay was started by addition of -G1P to 1 mM (23). The PMM assay mixture contained 1 mM NADP⁺, 25 mM glucose 1,6-bisphosphate, 0.5 U of phosphomannose isomerase ml¹, 0.5 U of phosphoglucose isomerase ml¹, and 0.5 U of glucose 6-phosphate dehydrogenase ml¹, and the assay was started with 1 mM mannose 1-phosphate (24). Protein concentrations were determined by the Micro BCA method (Pierce, Rockford, Ill.).

Bioinformatic methods. PGM protein sequences were downloaded from Swissprot, Sptrembl, and GenBank. Putative sequences coding for PGMs and PMMs were obtained from Streptococcus pyogenes, Streptococcus pneumoniae, Streptococcus mutans, and Enterococcus faecalis sequencing projects by using BlastX (2) at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov). Multiple alignment of protein sequences was performed with the ClustalX program (29). Trees were constructed with the ClustalX program and visualized with TreeView (19).

Nucleotide sequence accession number. The gene sequence described in this section has been submitted to the EMBL database, accession number AJ243290.

	RESULTS AND DISCUSSION

Top Abstract Introduction Materials and Methods Results and Discussion References

Functional analysis of the pgmA gene. Enzymes with PGM and/or PMM activity can be phylogenetically grouped according to their substrate specificity (31). A search through current sequencing projects revealed that S. pyogenes, S. pneumoniae, and S. mutans all had at least two PGM and/or PMM homologues (Fig. 1). Based on alignments, these could be divided into two groups, and the group closest to E. coli PGM was sought for unique motifs since none of the sequences had been experimentally evaluated at the time of cloning. The motifs TAGMRG and ATDPDA were chosen for construction of degenerate primers for PCR. These primers were used for amplification of an internal fragment of a gene, pgmA, which was homologous to the expected group of putative PGMs. The remainder of the gene was cloned by inverse PCR and then sequenced. After the cloning of pgmA from S. thermophilus, the pgm gene of S. pneumoniae, which also belongs to the same group, was characterized and shown to have PGM activity (9). The 573-amino-acid protein product of pgmA showed 82% identity to PGM of S. pneumoniae, 46% identity to YHXB of Bacillus subtilis, and 24% identity to PGM of E. coli.

View larger version (18K): [in this window] [in a new window]   FIG. 1.   Phylogenetic tree with characterized PGMs and/or PMMs and putative proteins from sequencing projects. Bootstrap values from 1,000 bootstrap trials are marked in the branches. The number in front of the organism name is the contig number, or the location of the sequence in the case of the single contig of S. pneumoniae. Experimentally confirmed enzyme functions are indicated to the right and uncharacterized proteins are marked with an asterisk. Accesion numbers: XanA, P29955; ManB, P24175; YbbT, O87090; CelB, Q44417; Pgm A. xylinum, P38569; Pgm E. coli, P36938; YhxB, P18159; Pgm S. pneumoniae, Q9RP94.

1

1

1

1

1

Role of PGM in EPS production. To investigate the role of PGM at the branching point between catabolism and anabolism in S. thermophilus LY03, strains with different levels of PGM activity were cultivated in batch cultures under conditions optimal for EPS production (5). With glucose as the carbon source, growth was rapid in LY03 and TMB 6002, and the yields of lactate and EPS were similar in these two strains (Table 2). The EPS yields decreased at the end of the exponential growth phase (reference 5 and data not shown), and for comparison a point was chosen in the late exponential phase. When the PGM-deficient TMB 6001 was transferred from M17-lactose to M17-glucose agar plates, no colonies appeared. Adaption to glucose was also done in liquid cultures that were transferred from MRS-lactose to MRS-glucose. After a long lag phase, this resulted in growth on glucose, but when the PGM activity was assayed in the cultures it had been restored to that of the host strain, even under antibiotic pressure, indicating that PGM activity was essential for growth on glucose. To verify that the growth deficiency on glucose was due to lack of PGM activity and not a result of polar effects from the insertion inactivation of pgmA, the terminal part of pgmA was integrated with another pG⁺host9 derivative, which kept pgmA intact but abolished downstream transcription (data not shown). In this insertion mutant, growth on glucose was unaffected. Furthermore, sequence analysis showed a putative gene downstream of pgmA in the opposite direction, encoding a protein with homology to methylentetrahydrofolate reductases.

1

View larger version (19K): [in this window] [in a new window]   FIG. 2.   Lactose metabolism in S. thermophilus. Abbreviations for metabolites: Gal1P, galactose 1-phosphate; UDPgal, UDP galactose; UDPglc, UDP glucose; G6P, glucose 6-phosphate. Enzymes are in bold: LacS, lactose transporter; LacZ, -galactosidase; GalK, galactokinase; GalT, galactose 1-phosphate uridyltransferase; GalE, UDP galactose 4-epimerase; GalU, UDP glucose pyrophosphorylase.