Applied Microbiology, Center for Chemistry
and Chemical Engineering, Lund Institute of Technology, Lund
University, SE-221 00 Lund, Sweden
To study the influence of phosphoglucomutase (PGM) activity on
exopolysaccharide (EPS) synthesis in glucose- and lactose-growing Streptococcus thermophilus, a knockout PGM mutant and a
strain with elevated PGM activity were constructed. The
pgmA gene, encoding PGM in S. thermophilus
LY03, was identified and cloned. The gene was functional in
Escherichia coli and was shown to be expressed from its own
promoter. The pgmA-deficient mutant was unable to grow on
glucose, while the mutation did not affect growth on lactose. Overexpression of pgmA had no significant effect on EPS
production in glucose-growing cells. Neither deletion nor
overexpression of pgmA changed the growth or EPS production
on lactose. Thus, the EPS precursors in lactose-utilizing S. thermophilus are most probably formed from the galactose moiety
of lactose via the Leloir pathway, which circumvents the need for a
functional PGM.
 |
INTRODUCTION |
Exopolysaccharides (EPSs) produced
by Streptococcus thermophilus have received a great deal of
interest recently, since they are important for the rheological
behaviour and texture of fermented milk (for a review, see reference
7). Furthermore, polysaccharides with defined properties
produced by safe lactic acid bacteria have a potential as thickeners,
stabilizers and texturizers. The biosynthetic pathways for EPSs from
precursors in the form of nucleotide sugars have been the focus of
recent studies (26, 27), and the genes coding for the
enzymes necessary for EPS synthesis in S. thermophilus have
been cloned (8, 25, 26). However, less is known about the
regulation of the metabolic flux toward the precursor nucleotide
sugars. UDP galactose and UDP glucose are formed from galactose
1-phosphate and glucose 1-phosphate (
-G1P), and the genes and
encoded enzymes in the Leloir pathway which are involved have been
characterized in S. thermophilus (20, 21).
Most strains of S. thermophilus are considered galactose
negative, since they do not ferment galactose, and the galactose moiety
of lactose is secreted when they are grown on lactose
(28). However, the genes necessary for galactose
catabolism are present, even though they are normally not expressed
(6, 11). At the branching point between glycolysis and the
Leloir pathway,
-phosphoglucomutase (PGM) is present, which
interconverts
-G1P and glucose 6-phosphate. It is thus a key enzyme
between glycolysis and the Leloir enzymes for EPS synthesis. When
glucose is the carbon source, PGM is required for the synthesis of
-G1P, which is used by uridyltransferases for the production of
nucleotide sugars. In S. pneumoniae, deletion of a gene
coding for PGM decreased capsule biosynthesis to less than 10%
(9). On the other hand, deletion of PGM in
Escherichia coli leads to the accumulation of intracellular
polysaccharide in galactose-growing cells since this prevents
-G1P
from entering glycolysis (1, 14), showing that the role of
PGM is dependent on the principal flux direction across the enzyme.
Recent results showed a linear relationship between PGM activity and
EPS production on different sugars in S. thermophilus
(4). However, the direction of the metabolic flux across
PGM has not been determined in S. thermophilus.
In this study, we describe the role of PGM in glucose and lactose
metabolism of S. thermophilus and its relationship to EPS production. The results indicate that the Leloir pathway is responsible for the generation of EPS precursors in lactose-growing streptococci.
 |
MATERIALS AND METHODS |
Bacterial strains, media, and culture conditions.
The
strains and plasmids used are listed in Table
1. S. thermophilus strains
were cultivated at 37 or 42°C. E. coli strains were grown
in Luria-Bertani medium or Terrific broth. S. thermophilus was maintained in Elliker broth (Difco) supplemented with 1% meat extract (Merck) or in M17 (Oxoid). In controlled batch experiments, a
modified MRS medium (5) with 25 g of Bacteriological
peptone (Oxoid) per liter and 5 g of yeast nitrogen base without
amino acids (Difco) per liter was used. Lactose (75 g
liter
1) or glucose (50 g liter
1) was used
as the carbohydrate source. Spectinomycin and ampicillin were used at
concentrations of 100 µg ml
1. Erythromycin was used at
a concentration of 200 µg ml
1 for E. coli
and 0.2 µg ml
1 for S. thermophilus. In batch
experiments, only the precultures were grown under selective pressure
and cell extracts from the late exponential growth phase were checked
for PGM activity. The batch cultures were performed in duplicate in
Bioflo III fermentors (New Brunswick Scientific Co., Edison, N.J.) at
42°C with an inital volume of 1.5 liters. Anaerobic conditions were
maintained by nitrogen flushing in the headspace. The pH was adjusted
to 6.2 by the automatic addition of 10 N NaOH.
DNA techniques and cloning procedure.
Plasmid DNA was
isolated from E. coli using Quantum kits (Bio-Rad
Laboratories AB). For S. thermophilus plasmid preparations, the Quantum miniprep kit was modified so that the cell pellets were
dissolved in 140 µl of cell resuspension solution plus 60 µl of 100 mg of lysozyme solution ml
1 and incubated at 37°C for
15 min. Chromosomal DNA was isolated using Qiagen genomic tips. DNA
digestion, dephosphorylation, agarose gel electrophoresis, and ligation
were performed by standard methods (3). All DNA enzymes
were obtained from Roche Diagnostics Scandinavia AB. Gel fragments
were purified using Qiaquick kits (Qiagen Inc., Santa Clarita,
Calif.). Ultracompetent E. coli strains were prepared and
transformed as previously described (12). S. thermophilus was transformed as previously described
(18). PCR was performed with Pwo DNA
polymerase, and Inverse PCR was performed with an Expand High Fidelity
system, using standard conditions as recommended by the manufacturer
(Roche). Cycle sequencing was performed with the dRhodamine Terminator
Ready kit (Perkin-Elmer, Boston, Mass.). Degenerate primers
5'-GGAATTCCACNGCNGGNATGMGNGG-3' (restriction sites underlined) and 5'-GCTCTAGAGCRTCNGGRTCNGTNGC-3'
were used to amplify an internal fragment of pgmA. The
product was cut with EcoRI and XbaI, inserted
into pUC19, and sequenced. Chromosomal S. thermophilus DNA
was cleaved in separate reactions with XbaI, EcoRI, and HindIII. The cleaved DNA was
religated and used as a template for inverse PCR with primers
5'-GAAACTGCAGTTGGACGAAGGCTCTCGA-3' and
5'-GAAACTGCAGATGCCGACGTATTGGTTG-3'. The products
were cloned in pUC19 and used to sequence the remainder of
pgmA and to map the surroundings. The whole gene was finally
amplified from chromosomal DNA by PCR and sequenced. The gene was
sequenced in both directions, using DNA templates from at least two
independent PCR amplicons.
Overexpression of pgmA.
For overexpression of
pgmA in E. coli, the gene was amplified from
S. thermophilus LY03 with primers
5'-CGGGATCCTTTAGTTGTGATACAATGTAAG-3' and
5'-TGCGAGCTCTTGGTGTAGCAGCGAAAG-3', cleaved with
BamHI and SacI, and inserted into pUC19, yielding
pFL36. The resulting plasmid was transformed into
W1485pgm
::tet, giving TMB2001. For
promoter analysis in S. thermophilus, pFL36 was digested
with BamHI and partially digested with EcoRI and
the pgmA gene was inserted into pLZ12spec, resulting in
pFL38. The pgmA gene was also cloned in the other direction
in pFL39 by ligating the pgmA gene from pFL36, obtained by
BamHI and partial Asp700I cleavage, into
XbaI-blunt and BamHI-digested pLZ12spec. pFL42
was created by PCR-amplifying the pgmA gene with a promoter
using primers CG GGATCCCGTAATTCTACTCAGCAGTGGA and 5'-TGCGAGCTCTTGGTGTAGCAGCGAAAG-3'. The
product was cleaved with BamHI and inserted into pLZ12spec
(BamHI-EcoRI blunt).
Inactivation of pgmA.
An internal 1,091-bp
EcoRI-HindIII fragment of pgmA was
cut from pFL36 and inserted into pG+host9, yielding pFL41.
pFL41 was transformed into LY03, and the transformants were recovered
at 30°C. Plasmid integration was selected for by growing the cells at
37°C in M17 containing erythromycin. Colonies on agar plates were
checked by PCR for single integration. One integrant was chosen and
checked for pgmA activity. The strain was named TMB 6001 and
maintained at 42°C or
80°C to prevent loss of the integration.
Measurement of growth, substrate consumption, and product
formation.
The optical density at 620 nm was used to monitor cell
growth after appropriate dilution of samples. Samples for substrate and
product determination were filtered through 0.2-µm-pore-size filters
immediately after sampling and kept at 4°C until analysis. Lactose,
galactose, and lactate were separated at 65°C on a cation-exchange column (Aminex HPX-87H; Bio-Rad) and quantified using a refractive index detector (RID 6A; Shimadzu Co.). The mobile phase was 5 mM
H2SO4 at a flow rate of 0.6 ml
min
1. At least three samples were taken for EPS analysis
during the exponential growth phase. EPSs were isolated by spinning
after removal of cells and proteins with trichloracetic acid and
precipitation with acetone, as described by Degeest and De Vuyst
(5). The anthrone method with a glucose standard was used
for quantification of the isolated EPS (16). The EPS
concentrations were converted to moles of carbon (cmol) by using
30 g cmol
1, as in the repeating units consisting of
galactose and glucose (5).
PGM and PMM measurements.
Cell extracts were prepared from
cells harvested in the mid-exponential phase that were washed twice in
50 mM potassium phosphate buffer (pH 7.0). E. coli was lysed
by incubation of the cells in buffer containing lysozyme, DNase, RNase,
and phenylmethylsulfonyl fluoride, followed by freezing and thawing.
S. thermophilus cell extracts were prepared in an X-press
(AB Biox). Cell debris was removed by centrifugation at
15,000 × g for 15 min at 4°C. PGM and
phosphomannomutase (PMM) activities were measured in 50 mM triethanolamine buffer (pH 7.2) with 5 mM MgCl2 in coupled
assays at 37°C by monitoring the formation of NADPH
spectrophotometrically. The assay mixture for PGM contained 0.4 mM
NADP+, 65 µM glucose 1,6-bisphosphate, and 2 U of glucose
6-phosphate dehydrogenase ml
1, and the assay was started
by addition of
-G1P to 1 mM (23). The PMM assay mixture
contained 1 mM NADP+, 25 mM glucose 1,6-bisphosphate, 0.5 U
of phosphomannose isomerase ml
1, 0.5 U of phosphoglucose
isomerase ml
1, and 0.5 U of glucose 6-phosphate
dehydrogenase ml
1, and the assay was started with 1 mM
mannose 1-phosphate (24). Protein concentrations were
determined by the Micro BCA method (Pierce, Rockford, Ill.).
Bioinformatic methods.
PGM protein sequences were downloaded
from Swissprot, Sptrembl, and GenBank. Putative sequences coding for
PGMs and PMMs were obtained from Streptococcus pyogenes,
Streptococcus pneumoniae, Streptococcus mutans, and
Enterococcus faecalis sequencing projects by using BlastX
(2) at the National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov). Multiple alignment of protein
sequences was performed with the ClustalX program (29). Trees were constructed with the ClustalX program and visualized with
TreeView (19).
Nucleotide sequence accession number.
The gene sequence
described in this section has been submitted to the EMBL database,
accession number AJ243290.
 |
RESULTS AND DISCUSSION |
Functional analysis of the pgmA gene.
Enzymes with
PGM and/or PMM activity can be phylogenetically grouped according to
their substrate specificity (31). A search through current
sequencing projects revealed that S. pyogenes, S. pneumoniae, and S. mutans all had at least two PGM
and/or PMM homologues (Fig. 1). Based on
alignments, these could be divided into two groups, and the group
closest to E. coli PGM was sought for unique motifs since
none of the sequences had been experimentally evaluated at the time of
cloning. The motifs TAGMRG and ATDPDA were chosen for construction of
degenerate primers for PCR. These primers were used for amplification
of an internal fragment of a gene, pgmA, which was
homologous to the expected group of putative PGMs. The remainder of the
gene was cloned by inverse PCR and then sequenced. After the cloning of
pgmA from S. thermophilus, the pgm
gene of S. pneumoniae, which also belongs to the same group,
was characterized and shown to have PGM activity (9). The
573-amino-acid protein product of pgmA showed 82% identity to PGM of S. pneumoniae, 46% identity to YHXB of
Bacillus subtilis, and 24% identity to PGM of E. coli.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Phylogenetic tree with characterized PGMs and/or PMMs
and putative proteins from sequencing projects. Bootstrap values from
1,000 bootstrap trials are marked in the branches. The number in front
of the organism name is the contig number, or the location of the
sequence in the case of the single contig of S. pneumoniae.
Experimentally confirmed enzyme functions are indicated to the right
and uncharacterized proteins are marked with an asterisk. Accesion
numbers: XanA, P29955; ManB, P24175; YbbT, O87090; CelB, Q44417; Pgm
A. xylinum, P38569; Pgm E. coli, P36938; YhxB,
P18159; Pgm S. pneumoniae, Q9RP94.
|
|
To verify the function of pgmA, a 1,863-bp fragment
containing the gene was expressed under the lac promoter of
pUC19 in E. coli W1485
pgm
::tet, which lacks PGM. The
resulting strain showed a PGM activity of 15 U mg of
protein
1, while the host E. coli strain had an
activity of <0.01 U mg of protein
1.
To establish whether pgmA is the only gene coding for PGM
activity in S. thermophilus LY03, a knockout mutant, TMB
6001, was constructed by single-crossover recombination. No detectable
PGM activity was found in TMB 6001 grown on lactose, while the parent strain had a PGM activity of 0.9 U mg of protein
1,
showing that the gene is coding for a unique PGM in this strain.
Sequence analysis showed potential promoter regions upstream of the
gene, and to confirm this, the pgmA gene was cloned onto a
multicopy vector. When 50 bp upstream of the gene was included in the
insert (pFL38), no elevated PGM activity was observed in S. thermophilus LY03. However, when 210 bp upstream of the gene was
included (pFL42), the PGM activity in the resulting strain, TMB 6002, was 7 U mg of protein
1 in lactose-growing cells.
To investigate if pgmA also encodes PMM activity, cell
extracts from LY03, TMB 6001, and TMB 6002 were checked for PMM
activity. The specific PMM activities in lactose-grown LY03 and TMB
6002 were 0.2 and 2 U mg of protein
1, respectively, while
no detectable PMM activity could be found in TMB 6001. Thus, there was
a linear relationship between the PGM and PMM activities in the cell
extracts, with the PMM activity being about fourfold lower than the PGM
activity. This shows that the enzyme is bifunctional, like XanA from
Xanthomonas campestris (13). The results also
suggest that some presumed PGMs could have PMM activity, and they
question the function of the other group of putative PGM homologues in
the phylogenetic tree (Fig. 1).
Role of PGM in EPS production.
To investigate the role of PGM
at the branching point between catabolism and anabolism in S. thermophilus LY03, strains with different levels of PGM activity
were cultivated in batch cultures under conditions optimal for EPS
production (5). With glucose as the carbon source, growth
was rapid in LY03 and TMB 6002, and the yields of lactate and EPS were
similar in these two strains (Table 2).
The EPS yields decreased at the end of the exponential growth phase
(reference 5 and data not shown), and for comparison a
point was chosen in the late exponential phase. When the PGM-deficient TMB 6001 was transferred from M17-lactose to M17-glucose agar plates,
no colonies appeared. Adaption to glucose was also done in liquid
cultures that were transferred from MRS-lactose to MRS-glucose. After a
long lag phase, this resulted in growth on glucose, but when the PGM
activity was assayed in the cultures it had been restored to that of
the host strain, even under antibiotic pressure, indicating that PGM
activity was essential for growth on glucose. To verify that the growth
deficiency on glucose was due to lack of PGM activity and not a result
of polar effects from the insertion inactivation of pgmA,
the terminal part of pgmA was integrated with another
pG+host9 derivative, which kept pgmA intact but
abolished downstream transcription (data not shown). In this insertion
mutant, growth on glucose was unaffected. Furthermore, sequence
analysis showed a putative gene downstream of pgmA in the
opposite direction, encoding a protein with homology to
methylentetrahydrofolate reductases.
PGM mutants have been constructed from a number of gram-negative
bacteria (1, 13, 14, 30, 32) and recently from the
gram-positive bacterium S. pneumoniae (9). No
growth defects have been reported in any of the gram-negative bacteria.
However, in all cases important effects on polysaccharide production
have been observed. These are probably due to changed levels of
-G1P that serves as a precursor for UDP sugars, but not to a total cessation
in the supply, since the UDP sugars are needed in cell wall
biosynthesis and for polysaccharide formation. For S. pneumoniae, the pgm mutants grew slowly and promotion
of second-site suppressor mutations outside the pgm gene was
observed, which restored growth to the normal level (9).
It is not clear whether these mutations resulted in PGM activity or
whether other pathways were activated, since these authors could not
measure PGM activity in their cell extracts due to NADPH oxidases. Our
results show that PGM activity is necessary for the growth of S. thermophilus on glucose, and PGM seems to be the only way to
provide the cells with
-G1P on this substrate. Furthermore, this
study demonstates that pgmA is the unique gene coding for
PGM in S. thermophilus LY03.
Lactose, the carbohydrate source of interest in milk fermentation, is
transported into S. thermophilus by LacS, which can act
either as a lactose-galactose antiporter or as a proton symporter (22). Lactose is split by
-galactosidase into glucose
and galactose (Fig. 2). The glucose
moiety enters the glycolysis, yielding lactate, while LacS normally
secretes galactose in exchange for lactose. Even if LY03 does not grow
on galactose, it assimilates some of the galactose derived from lactose
fermentation (5). It was thus not evident how altered PGM
levels would affect the EPS production on lactose. With lactose as the
carbon source, there was no significant difference in maximum specific
growth rate between the strains (Table
3). The EPS and galactose yields
decreased during fermentation, whereas the lactate yield increased. The
cells entered the stationary phase when about 50 g of lactose
liter
1 had been consumed, and for comparison a point just
before this was chosen (Table 3). No differences between the strains
could be seen at this stage. Interestingly, neither deletion nor
overexpression of pgmA had any significant effect on growth
or EPS production in the lactose-grown strains. This implies that the
precursors for EPS production originate from the galactose moiety of
lactose and also that the net flux over PGM is close to zero in
lactose-growing S. thermophilus LY03. Furthermore,
sufficient galactose is taken up to provide precursors for the cell
wall and EPS, but only small amounts enter the central metabolism.
After prolonged fermentation into the stationary phase, more of the
galactose was metabolized, resulting in lower galactose yields and
higher lactate yields (Table 4). At this
stage, the strain lacking PGM activity, TMB 6001, had secreted more
galactose than the other strains, demonstrating that PGM activity is
necessary to ferment galactose to lactate.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2.
Lactose metabolism in S. thermophilus.
Abbreviations for metabolites: Gal1P, galactose 1-phosphate; UDPgal,
UDP galactose; UDPglc, UDP glucose; G6P, glucose 6-phosphate. Enzymes
are in bold: LacS, lactose transporter; LacZ, -galactosidase; GalK,
galactokinase; GalT, galactose 1-phosphate uridyltransferase; GalE, UDP
galactose 4-epimerase; GalU, UDP glucose pyrophosphorylase.
|
|
The flux-controlling function of PGM was investigated by deletion and
overexpression of the pgmA gene. Recent studies of the same
strain showed a linear relationship between the activity of PGM, UDP
galactose 4-epimerase, and UDP glucose pyrophosphorylase and EPS
production in S. thermophilus LY03 (4). Their
data suggested that PGM might play a controlling role in the flux from glucose 6-phosphate to EPS production. However, our results after overexpressing pgmA indicated that the physiological amount
of PGM was not limiting for EPS production (Table 2 and 3).
The major implication of these results is that it is possible to
decouple lactose metabolism in S. thermophilus by deletion of pgmA. The glucose moiety is used for energy metabolism,
while the galactose moiety can be used for anabolic reactions. This implies a great potential for metabolic engineering of EPS production in this organism, which could be fine-tuned by controlled expression of
the enzymes in the Leloir pathway.
This work was supported by the European Community FAIR programme,
contract CT-98-4267.
| 1.
|
Adhya, S., and M. Schwartz.
1971.
Phosphoglucomutase mutants of Escherichia coli K-12.
J. Bacteriol.
108:621-626[Abstract/Free Full Text].
|
| 2.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[CrossRef][Medline].
|
| 3.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl.
1996.
Current protocols in molecular biology.
John Wiley & Sons, Inc., New York, N.Y.
|
| 4.
|
Degeest, B., and L. De Vuyst.
2000.
Correlation of activities of the enzymes -phosphoglucomutase, UDP-galactose 4-epimerase, and UDP-glucose pyrophosphorylase with exopolysaccharide biosynthesis by Streptococcus thermophilus LY03.
Appl. Environ. Microbiol.
66:3519-3527[Abstract/Free Full Text].
|
| 5.
|
Degeest, B., and L. De Vuyst.
1999.
Indication that the nitrogen source influences both amount and size of exopolysaccharides produced by Streptococcus thermophilus LY03 and modelling of the bacterial growth and exopolysaccharide production in a complex medium.
Appl. Environ. Microbiol.
65:2863-2870[Abstract/Free Full Text].
|
| 6.
|
de Vos, W. M., and E. E. Vaughan.
1994.
Genetics of lactose utilization in lactic acid bacteria.
FEMS Microbiol. Rev.
15:217-237[Medline].
|
| 7.
|
De Vuyst, L., and B. Degeest.
1999.
Heteropolysaccharides from lactic acid bacteria.
FEMS Microbiol. Rev.
23:153-177[CrossRef][Medline].
|
| 8.
|
Griffin, A. M.,
V. J. Morris, and M. J. Gasson.
1996.
The cpsABCDE genes involved in polysaccharide production in Streptococcus salivarius ssp. thermophilus strain NCBF 2393.
Gene
183:23-27[CrossRef][Medline].
|
| 9.
|
Hardy, G. G.,
M. J. Caimano, and J. Yother.
2000.
Capsule biosynthesis and basic metabolism in Streptococcus pneumoniae are linked through the cellular phosphoglucomutase.
J. Bacteriol.
182:1854-1863[Abstract/Free Full Text].
|
| 10.
|
Husmann, L. K.,
J. R. Scott,
G. Lindahl, and L. Stenberg.
1995.
Expression of the Arp protein, a member of the M protein family, is not sufficient to inhibit phagocytosis of Streptococcus pyogenes.
Infect. Immun.
63:345-348[Abstract].
|
| 11.
|
Hutkins, R.,
H. A. Morris, and L. L. McKay.
1985.
Galactokinase activity in Streptococcus thermophilus.
Appl. Environ. Microbiol.
50:777-780[Abstract/Free Full Text].
|
| 12.
|
Inoue, H.,
H. Nojima, and H. Okayama.
1990.
High efficiency transformation of Escherichia coli with plasmids.
Gene
96:23-28[CrossRef][Medline].
|
| 13.
|
Köplin, R.,
W. Arnold,
B. Hötte,
R. Simon,
G. Wang, and A. Pühler.
1992.
Genetics of xanthan production in Xanthomonas campestris: the xanA and xanB genes are involved in UDP-glucose and GDP-mannose biosynthesis.
J. Bacteriol.
174:191-199[Abstract/Free Full Text].
|
| 14.
|
Lu, M., and N. Kleckner.
1994.
Molecular cloning and characterization of the pgm gene encoding phosphoglucomutase of Escherichia coli.
J. Bacteriol.
176:5847-5851[Abstract/Free Full Text].
|
| 15.
|
Maguin, E.,
H. Prevost,
S. D. Ehrlich, and A. Gruss.
1996.
Efficient insertional mutagenesis in lactococci and other gram-positive bacteria.
J. Bacteriol.
178:931-935[Abstract/Free Full Text].
|
| 16.
|
Morris, D. L.
1948.
Quantitative determination of carbohydrates with Dreywood's anthrone reagent.
Science
107:254-255[Free Full Text].
|
| 17.
|
Norrander, J.,
T. Kempe, and J. Messing.
1983.
Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis.
Gene
26:101-106[CrossRef][Medline].
|
| 18.
|
O'Sullivan, T. F., and G. F. Fitzgerald.
1999.
Electrotransformation of industrial strains of Streptococcus thermophilus.
J. Appl. Microbiol.
86:275-283[CrossRef][Medline].
|
| 19.
|
Page, R. D.
1996.
Tree View: an application to display phylogenetic trees on personal computers.
Comput. Appl. Biosci.
12:357-358[Free Full Text].
|
| 20.
|
Poolman, B.
1993.
Energy transduction in lactic acid bacteria.
FEMS Microbiol. Rev.
12:125-147[CrossRef][Medline].
|
| 21.
|
Poolman, B.,
T. J. Royer,
S. E. Mainzer, and B. F. Schmidt.
1990.
Carbohydrate utilization in Streptococcus thermophilus: characterization of the genes for aldose 1-epimerase (mutarotase) and UDPglucose 4-epimerase.
J. Bacteriol.
172:4037-4047[Abstract/Free Full Text].
|
| 22.
|
Poolman, B.,
T. J. Royer,
S. E. Mainzer, and B. F. Schmidt.
1989.
Lactose transport system of Streptococcus thermophilus: a hybrid protein with homology to the melibiose carrier and enzyme III of phosphoenolpyruvate-dependent phosphotransferase systems.
J. Bacteriol.
171:244-253[Abstract/Free Full Text].
|
| 23.
|
Qian, N.,
G. A. Stanley,
B. Hahn-Hägerdal, and P. Rådström.
1994.
Purification and characterization of two phosphoglucomutases from Lactococcus lactis subsp. lactis and their regulation in maltose- and glucose-utilizing cells.
J. Bacteriol.
176:5304-5311[Abstract/Free Full Text].
|
| 24.
|
Sa-Correia, I.,
A. Darzins,
S. K. Wang,
A. Berry, and A. M. Chakrabarty.
1987.
Alginate biosynthetic enzymes in mucoid and nonmucoid Pseudomonas aeruginosa: overproduction of phosphomannose isomerase, phosphomannomutase, and GDP-mannose pyrophosphorylase by overexpression of the phosphomannose isomerase (pmi) gene.
J Bacteriol.
169:3224-3231[Abstract/Free Full Text].
|
| 25.
|
Stingele, F., and B. Mollet.
1996.
Disruption of the gene encoding penicillin-binding protein 2b (pbp2b) causes altered cell morphology and cease in exopolysaccharide production in Streptococcus thermophilus Sfi6.
Mol. Microbiol.
22:357-366[CrossRef][Medline].
|
| 26.
|
Stingele, F.,
J. R. Neeser, and B. Mollet.
1996.
Identification and characterization of the eps (exopolysaccharide) gene cluster from Streptococcus thermophilus Sfi6.
J. Bacteriol.
178:1680-1690[Abstract/Free Full Text].
|
| 27.
|
Stingele, F.,
J. W. Newell, and J. R. Neeser.
1999.
Unraveling the function of glycosyltransferases in Streptococcus thermophilus Sfi6.
J. Bacteriol.
181:6354-6360[Abstract/Free Full Text].
|
| 28.
|
Thomas, T. D., and V. L. Crow.
1984.
Selection of galactose fermenting Streptococcus thermophilus in lactose-limited chemostat cultures.
Appl. Environ. Microbiol.
48:186-191[Abstract/Free Full Text].
|
| 29.
|
Thompson, J. D.,
T. J. Gibson,
F. Plewniak,
F. Jeanmougin, and D. G. Higgins.
1997.
The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res.
25:4876-4882[Abstract/Free Full Text].
|
| 30.
|
Uttaro, A. D.,
G. A. Cangelosi,
R. A. Geremia,
E. W. Nester, and R. A. Ugalde.
1990.
Biochemical characterization of avirulent exoC mutants of Agrobacterium tumefaciens.
J. Bacteriol.
172:1640-1646[Abstract/Free Full Text].
|
| 31.
|
Videira, P. A.,
L. L. Cortes,
A. M. Fialho, and I. Sa-Correia.
2000.
Identification of the pgmG gene, encoding a bifunctional protein with phosphoglucomutase and phosphomannomutase activities, in the gellan gum-producing strain Sphingomonas paucimobilis ATCC 31461.
Appl. Environ. Microbiol.
66:2252-2258[Abstract/Free Full Text].
|
| 32.
|
Zhou, D.,
D. S. Stephens,
B. W. Gibson,
J. J. Engstrom,
C. F. McAllister,
F. K. Lee, and M. A. Apicella.
1994.
Lipooligosacharide biosyntesis in pathogenic Neisseria. Cloning, identification, and characterization of the phosphoglucomutase gene.
J. Biol. Chem.
269:11162-11169[Abstract/Free Full Text].
|