Previous Article | Next Article 
Applied and Environmental Microbiology, July 2001, p. 3180-3187, Vol. 67, No. 7
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.7.3180-3187.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Development of a Genetic System for
Geobacter sulfurreducens
Maddalena V.
Coppi,
Ching
Leang,
Steven J.
Sandler, and
Derek R.
Lovley*
Department of Microbiology, University of
Massachusetts at Amherst, Amherst, Massachusetts 01003
Received 2 February 2001/Accepted 27 April 2001
 |
ABSTRACT |
Members of the genus Geobacter are the dominant
metal-reducing microorganisms in a variety of anaerobic subsurface
environments and have been shown to be involved in the bioremediation
of both organic and metal contaminants. To facilitate the study of the physiology of these organisms, a genetic system was developed for
Geobacter sulfurreducens. The antibiotic sensitivity of
this organism was characterized, and optimal conditions for plating it
at high efficiency were established. A protocol for the introduction of
foreign DNA into G. sulfurreducens by electroporation
was also developed. Two classes of broad-host-range vectors, IncQ and
pBBR1, were found to be capable of replication in G.
sulfurreducens. In particular, the IncQ plasmid pCD342 was
found to be a suitable expression vector for this organism. When the
information and novel methods described above were utilized, the
nifD gene of G. sulfurreducens was
disrupted by the single-step gene replacement method. Insertional
mutagenesis of this key gene in the nitrogen fixation pathway impaired
the ability of G. sulfurreducens to grow in medium
lacking a source of fixed nitrogen. Expression of the
nifD gene in trans complemented this
phenotype. This paper constitutes the first report of genetic
manipulation of a member of the Geobacter genus.
 |
INTRODUCTION |
Dissimilatory metal-reducing
microorganisms play an important role in the natural cycling of organic
matter and minerals in aquatic sediments, submerged soils, and
subsurface environments and can be important agents for the
bioremediation of both organic and metal contamination
(13-15). Molecular analyses (16S ribosomal DNA) have
revealed that dissimilatory metal-reducing microorganisms in the
genus Geobacter are prominent members of the microbial community in a diversity of environments in which dissimilatory metal
reduction is either naturally occurring or artificially stimulated
(22, 28). Geobacter species are obligate
anaerobes belonging to the delta subdivision of the
Proteobacteria. These organisms have the ability to
completely oxidize organic compounds to carbon dioxide with either
humic substances or Fe(III) as the sole electron acceptor
(15). Other metals which can serve as electron acceptors
for Geobacter species include Mn(IV), U(IV), Co(III), and
Tc(VII). Several Geobacter species can also reduce nitrate
and fumarate. The organic compounds oxidized by Geobacter species invariably include acetate and other short-chain fatty acids.
In addition, some Geobacter species are capable of
completely oxidizing monoaromatic compounds such as benzoate, phenol,
p-cresol, and toluene to carbon dioxide with Fe(III) as the
electron acceptor.
Little is known about the biochemical pathways that couple the
oxidation of organic compounds to the reduction of metals in Geobacter species or about the regulation of these
processes. Because many electron carriers will nonspecifically reduce
metals and humic substances in vitro, it has been difficult to use
biochemical studies to determine which of the numerous redox active
proteins present in Geobacter species are actually involved
in the reduction of metals and humic substances in vivo. It may
therefore be easier to deduce the physiological roles of redox active
proteins and enzyme complexes via a genetic approach
gene disruption
followed by phenotypic analysis. Until now, the lack of a genetic
system for Geobacter species has prevented the application
of this type of approach to the study of the physiology of these organisms.
Here we report the development of a genetic system for Geobacter
sulfurreducens. G. sulfurreducens, which was isolated from hydrocarbon-contaminated soil (7), has all of the
important metabolic features of Geobacter species, including
the ability to oxidize monoaromatic compounds (15).
Furthermore, G. sulfurreducens also has the capacity to grow
with fumarate serving as the sole electron acceptor, a property which
is essential for the generation of mutants that are defective in the
transfer of electrons to metals and humic substances.
Preliminary studies have suggested that G. sulfurreducens
might have genes for nitrogen fixation (4). The ability to
fix nitrogen may be required for Geobacter to compete
successfully in petroleum-contaminated subsurface environments which
are carbon rich but contain little fixed nitrogen (4).
Methods for genetically manipulating G. sulfurreducens were
developed as part of a study assessing the capacity of this organism to
fix nitrogen. In this study, the targeted disruption of a G. sulfurreducens homolog of the nifD gene, a gene
required for nitrogen fixation by other microorganisms
(9), was found to eliminate the ability of G. sulfurreducens to grow in a medium devoid of fixed nitrogen. The ability of G. sulfurreducens to grow in this medium was
restored when a functional copy of the gene was reintroduced in
trans. These results indicate that G. sulfurreducens fixes nitrogen in a manner similar to that of other
nitrogen-fixing microorganisms. The genetic techniques described herein
should be applicable to the study of other aspects of G. sulfurreducens physiology and should make it possible to take full
advantage of the information present in the forthcoming sequence of the
genome of this environmentally significant organism.
 |
MATERIALS AND METHODS |
Bacterial strains and plasmids.
The plasmids and bacterial
strains, G. sulfurreducens (ATCC 51573) and
Escherichia coli, that were used in this study are listed
and described in Table 1.
DNA manipulations and plasmid construction.
Total G. sulfurreducens genomic DNA was prepared using the Genome DNA Kit
(Bio 101, Inc., Carlsbad, Calif.). Primers for amplification of DNA
fragments from the G. sulfurreducens chromosome were
designed using sequence data obtained from The Institute for Genomic
Research website at http://www.tigr.org. PCR amplification was
performed using AmpliTaq DNA polymerase (Roche Molecular
Systems, Branchburg, N.J.) according to the manufacturer's
instructions. Plasmid DNA was purified from E. coli and
G. sulfurreducens strains using the Qiagen midi- or
miniplasmid purification kits (Qiagen Inc., Valencia, Calif.). DNA
samples for electrotransformation were subjected to a second ethanol
precipitation and 70% ethanol wash followed by resuspension in 0.5×
TE buffer (0.5 mM Tris HCl [pH 8.0], 0.5 mM EDTA) in order to reduce
their salt concentration and prevent arcing.
The suicide vector, pBRnif::kan, was constructed
for the targeted disruption of the G. sulfurreducens nifD
gene. A 1.1-kb fragment consisting of the first ~0.9 kb of the
nifD coding region and ~0.2 kb of upstream sequence was
amplified from the G. sulfurreducens chromosome using the
primers prDL1 (CCCCGCTGGAGATGGAAGAGC) and
prDL2 (GGCGGATCCAGCCAGGGGATGCC). In
primer sequences, restriction sites are italicized and annealing
nucleotides are indicated in boldface. This fragment was digested with
EcoRI (cleaves 18 bp downstream of prDL1) and
BamHI (cleaves prDL2) and was inserted into the
corresponding sites of pBR322 (6), resulting in the intermediate construct pBRnif. A kanamycin resistance
cassette was amplified from pBBR1MCS-2 (12) with the
primers prDL3
(CCCGGTAACCGGATGAATGTCAGC) and prDL4
(CCCGATATCGCGGTGGAATCG). The final
suicide vector, pBRnif::kan (Fig. 2B), was
constructed by inserting this cassette into a unique EcoRV
site within pBRnif (at position 373 of the nifD
coding sequence).
The nifD expression vector pCDSnifD was
constructed in order to complement the nifD1::kan
phenotype. The nifD coding sequence was amplified from
G. sulfurreducens genomic DNA with the primers prDL5
(CCCGGTACCTGACAGGAGAATAC) and prDL6
(CCCAAGCTTAAAAGCGGACTCCG) and was
inserted into pCR2.1-TOPO (Invitrogen, Carlsbad, Calif.). It was
subsequently excised from this plasmid with EcoRI and
HindIII and was inserted into the corresponding sites of
the IncQ expression vector pCD342 (10). Because the
resulting vector pCDnifD conferred resistance to kanamycin,
it was not suitable for carrying out complementation studies in our
nifD1::kan mutants. Therefore, the kanamycin
resistance cassette of pCDnifD was excised with BglII and BstBI and replaced with a streptomycin
resistance cassette that had been amplified from pJRD215
(8) with the primers prDL7 (CCCAGATCTTTCTCATGTTTGACAGC) and prDL8
(CCCTTCGAATGAGATTGATGTGTTCC).
Culturing conditions and growth media.
The two E. coli strains listed in Table 1 were propagated according to
established methods (26).
G. sulfurreducens strains were cultured at 30°C under
strict anaerobic conditions as previously described (19).
Plating and incubations on solid media were performed inside an
anaerobic chamber (Coy Laboratory Products Inc., Grass Lake, Mich.)
containing a 7%
H2-10%CO2-83%
N2 atmosphere heated to 30°C. G. sulfurreducens strains were propagated in two types of media (see
compositions below): NBAF supplemented with 0.1% yeast extract
and 1 mM cysteine (NBAFYE) and FWAFC. NBAFYE was used for general
propagation and plating and for the preparation of electrocompetent
cells, whereas FWAFC was used for the analysis of nitrogen fixation
phenotypes. Antibiotics were added to cultures or plates as needed.
During extended incubations of liquid cultures, fresh antibiotics were added every 48 h.
All media were dispensed into anaerobic pressure tubes or bottles with
butyl rubber stoppers and, unless otherwise indicated, bubbled with an
80% N2-20% CO2 gas
mixture to remove dissolved oxygen and obtain a final pH of ~6.7.
NBAF, a modified form of the medium described by Lovley et al.
(16), contains 15 mM acetate as the electron donor and 40 mM fumarate as the electron acceptor. Its composition per liter of
deionized water is 0.42 g of
KH2PO4, 0.22 g of
K2HPO4, 0.2 g of
NH4Cl, 0.38 g of KCl, 0.36 g of NaCl,
0.04 g of CaCl2 · 2H2O, 0.1 g of
MgSO4 · 7H2O,
1.8 g of NaHCO3, 0.5 g of
Na2CO3, 2.04 g of
NaC2H3O2
· 3H2O, 6.4 g of
Na2C4H4O4,
0.5 ml of 0.1% resazurin, 1.0 ml of 100 mM
Na2SeO4, 10.0 ml of a
vitamin solution (17), and 10.0 ml of NB trace
mineral solution. The composition of the NB trace mineral solution per
liter of deionized water is 2.14 g of nitriloacetic acid, 0.1 g of MnCl2 · 4H2O,
0.3 g of FeSO4 · 7H2O, 0.17 g of
CoCl2 · 6H2O,
0.2 g of ZnSO4 · 7H2O, 0.3 g of CuCl2 · 2H2O, 0.005 g of AlK(SO4)2 · 12H2O, 0.005 g of
H3BO3, 0.09 g of
Na2MoO4, 0.11 g of
NiSO4 · 6H2O, and
0.2 g of Na2WO4 · 2H2O.
Liquid NBAFYE medium was prepared by adding appropriate volumes of
sterile anoxic stock solutions of yeast extract and cysteine to NBAF
medium to achieve final concentrations of 0.1% (wt/vol) and 1 mM,
respectively. If NBAFYE medium was to be used for manipulations within
the anaerobic chamber, the final cysteine concentration was increased
to 5 mM. Solid NBAFYE was prepared by amending NBAF medium lacking
CaCl2 and MgSO4 with
15 g of purified agar/liter. Following sterilization, the molten
medium was cooled to 50°C and appropriate volumes of anaerobic stock
solutions of CaCl2, MgSO4,
yeast extract, and cysteine were added to yield final concentrations of
0.004%, 0.01%, 0.1%, and 5 mM, respectively. If necessary, antibiotics (concentrations listed below) were also added at this time.
FWAFC is a modification of FWA-Fe(III) citrate medium
(19), a freshwater minimal medium containing 20 mM acetate
as the electron donor and 55.9 mM Fe(III) citrate as the electron
acceptor. Its composition per liter of deionized water is 13.7 g
of FeC6O7, 2.5 g of
NaHCO3, 0.25 g of
NH4Cl, 0.6 g of
NaH3PO4 · H2O, 0.1 g of KCl, 1.0 ml of 100 mM
Na2SeO4, 10.0 ml of a
vitamin solution (17), and 10.0 ml of a trace mineral
solution (17).
Ammonium- and nitrogen-free FWAFC medium was prepared by sparging and
overlaying ammonium-free FWAFC medium with an 80% Ar-20% CO2 gas mixture.
Antibiotics (200 µg of kanamycin, 400 µg of streptomycin, or 10 µg of chloramphenicol per ml) were added to liquid and solid medium
as needed. All antibiotic stock solutions were sterile and anoxic
(sparged and overlaid with an N2 atmosphere).
Determination of plating efficiency.
The cell density
(cells/milliliter) of prestationary-phase liquid cultures was
determined by staining cells with acridine orange and utilizing
epifluorescence microscopy as previously described (19).
The density of CFU in these cultures was determined by plating serial dilutions.
Preparation of electrocompetent cells.
Electrocompetent
E. coli was prepared according to Sambrook et al.
(26). Electrocompetent G. sulfurreducens was
prepared from cultures maintained in NBAFYE medium as described below.
All manipulations were carried out on ice in an anaerobic chamber, and
any buffers used were ice-cold and anoxic. Four hundred milliliters of
mid-log-phase cultures (optical density at 600 nm = 0.2 to 0.35;
9 × 107 to 1.8 × 108 cells/ml) was harvested by centrifugation at
4°C for 8 min at 4,300 × g. The cells were washed
twice with 400 ml of electroporation buffer (1 mM HEPES [pH 7.0], 1 mM MgCl2, and 175 mM sucrose) and resuspended in
the same buffer at a final concentration of
~1011 cells/ml. Because G. sulfurreducens was found to be particularly susceptible to
shearing, pipetting of cell suspensions was minimized and, when
necessary, performed with large-bore pipette tips. An appropriate
volume of a 60% dimethyl sulfoxide (DMSO)-40% electroporation buffer
solution was added to the final cell suspension to achieve a final DMSO
concentration of 10%. The resulting electrocompetent cells were either
electroporated immediately or stored at
70°C for future use.
Electrotransformation procedures.
All electrotransformations
were performed in 0.15-cm-gap microelectroporation chambers using a
Cell-Porator equipped with a Voltage Booster (Life Technologies Inc.,
Gaithersburg, Md.). Electrocompetent E. coli cells were
transformed according to the manufacturer's instructions.
Electrocompetent G. sulfurreducens cells (25 µl), either
freshly prepared or thawed on ice, were pulsed at 14.7 kV/cm for ~6
ms (resistance = 4 k
; capacitance = 25 µF). Immediately
following electroporation, cells were washed into the bottom of the
microelectroporation chamber with 1 ml of room temperature
phosphate-buffered NBAF (NBAF medium containing 50 mM potassium
phosphate instead of bicarbonate). The cells were then transferred to a
prewarmed anaerobic pressure tube containing 9 ml of NBAFYE. The
electroporated cells were allowed to recover for 5 h at 30°C,
prior to plating onto the appropriate solid growth medium.
Assessment of plasmid stability under nonselective
conditions.
G. sulfurreducens was electrotransformed
with either pBBR1MCS-2 or pJRD215 (Table 1) and plated onto selective
medium (NBAFYE containing 200 µg of kanamycin/ml). The resulting
kanamycin-resistant colonies were transferred to liquid selective
medium until the cultures became turbid (3 to 6 days). Selective
pressure was maintained throughout this incubation by adding fresh
kanamycin to the cultures every 48 h. Twenty-four hours prior to
the beginning of the experiment, cultures were diluted 10-fold into
fresh selective medium. At time zero, the cultures were serially
diluted into nonselective medium (NBAFYE) and were then plated onto
both selective and nonselective media. The remainder of the various
serial dilutions was incubated at 30°C. Every 48 h, a log-phase
culture was selected from among the various dilutions for analysis and
the process was repeated. The total number of CFU in the various
cultures was determined on nonselective medium, and the percentage of
kanamycin-resistant CFU was ascertained by comparison. The number of
generations between time points was determined from the total
CFU/milliliter using the following formula: log (final CFU per
milliliter/initial CFU per milliliter)/log2.
Southern blotting.
Following digestion of genomic DNA with
the restriction enzyme EcoRV, Southern blot analysis was
performed according to Sambrook et al. (26). Probes were
labeled with [
-32P]dCTP using the Multiprime
DNA labeling system (Amersham Pharmacia Biotech, Piscataway, N.J.).
[
-32P]dCTP was obtained from New England
Nuclear (Boston, Mass.).
 |
RESULTS AND DISCUSSION |
Growth on solid medium and characterization of antibiotic
sensitivity.
In order to be able to rapidly isolate clonal
populations of G. sulfurreducens, conditions for
high-efficiency plating onto solid growth medium were established.
Simply solidifying the two liquid media for G. sulfurreducens, NBAF and FWAFC (see Materials and Methods), was
not sufficient to achieve the rapid growth of G. sulfurreducens on plates. After considerable trial and error, it
was found that supplementation of the solid form of NBAF medium with
0.1% yeast extract and a high concentration (5 mM) of the reductant
cysteine yielded a solid medium, NBAFYE, on which both the growth rate
and the plating efficiency of G. sulfurreducens were
reproducibly high. Colonies were visible on solid NBAFYE medium after
only 5 days of incubation at 30°C. In addition, when pre-stationary-phase liquid cultures with a density of (3.25 ± 0.54) × 108 cells/ml were plated
onto this medium, (2.85 ± 0.48) × 108
CFU/ml were recovered (mean ± standard deviation;
n = 3), demonstrating a high plating efficiency.
The growth of G. sulfurreducens on solid medium could be
inhibited by a variety of commonly used antibiotics. Growth of
108 cells on solid medium could be inhibited by
choramphenicol (10 µg/ml), nalidixic acid (10 µg/ml), tetracycline
(10 µg/ml), kanamycin (200 µg/ml), spectinomycin (50 µg/ml),
streptomycin (400 µg/ml), and ampicillin (400 µg/ml). The
sensitivity of G. sulfurreducens to these antibiotics in
liquid culture was similar (data not shown). These results indicated
that it should be possible to select for the acquisition of multiple
antibiotic resistance markers by G. sulfurreducens, a
requirement for many genetic manipulations.
Development of an electrotransformation procedure.
A protocol
for the electrotransformation of G. sulfurreducens was
developed by modifying existing protocols (21) to account for the unique properties of G. sulfurreducens. The
preparation of electrocompetent cells typically involves extensive
washing of cells derived from mid-log-phase cultures in a suitable
low-ionic-strength electroporation buffer, followed by resuspension of
the cells at high density (109 to 1011
cells/ml) in this buffer (21). In order to attain
sufficient G. sulfurreducens biomass at mid-log phase, it
was necessary to supplement the NBAF medium routinely used to culture
the organism with 0.1% (wt/vol) yeast extract. When grown on this rich
medium at 30°C, G. sulfurreducens had a generation time of
~4.5 h and reached a cell density of ~108
cells/ml at mid-log phase (data not shown). The composition of the
electroporation buffer was found to be critical for maintaining the viability of G. sulfurreducens throughout the washing
and electrotransformation procedures. The optimal composition of the electroporation buffer was found to be 1 mM HEPES (pH 7.0), 1 mM
MgCl2, and 175 mM sucrose. The
addition of MgCl2 to the electroporation buffer
was absolutely required if G. sulfurreducens was to remain viable during washing and storage. In the absence of
MgCl2, 90% of the cells lysed prior to
electroporation (data not shown). MgCl2 is
thought to prevent bacterial lysis by stabilizing the outer membrane
(27). The concentration of sucrose was another crucial
variable in the composition of the electroporation buffer. Electrotransformed G. sulfurreducens could not tolerate
large changes in osmolarity upon dilution back into nonselective growth medium. To avoid such changes in osmotic pressure, 175 mM sucrose was
added to the electroporation buffer such that its osmolarity was
equivalent to that of NBAFYE medium. The addition of 10% DMSO to the
final cell suspension permitted storage of electrocompetent G. sulfurreducens at
70°C with little or no loss in
transformation efficiency. Glycerol was not a suitable cryopreservant
due to the sensitivity of G. sulfurreducens to rapid changes
in osmolarity.
Electroporation parameters were optimized by transforming G. sulfurreducens with the broad-host-range IncQ plasmid pJRD215 (Table 1). Electrotransformation of G. sulfurreducens
with pJRD215 resulted in the growth of kanamycin-resistant colonies.
The presence of pJRD215 in these colonies was confirmed by PCR (data
not shown) and by digesting plasmid DNA purified from these colonies
with restriction enzymes (Fig. 1A, lane
1). Electrotransformation was optimal when G. sulfurreducens
was pulsed at 14.7 kV/cm with a time constant of approximately 6 ms.
Under these conditions, (1.98 ± 0.32) × 105 transformants/µg of pJRD215 DNA were
obtained. Electroporation lethality was roughly 59% ± 5.23%, and
transformants constituted 1 out of (1.19 ± 0.43) × 104 CFU. (Data are means ± standard errors;
n = 11). These data were within the range reported for
other bacteria in which gene replacement has been successful (3,
23, 24, 29).

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 1.
Stability of IncQ and pBBR1 vectors in G.
sulfurreducens. (A) Purification of IncQ plasmids from
G. sulfurreducens transformants. Plasmid DNA was
purified from G. sulfurreducens transformed with pJRD215
(lane 1), pJRC2 (lane 2), and pCD342 (lane 3) by alkaline lysis
(26). Following purification, plasmid DNA was digested
with the restriction enzymes BglII and
HindIII. The sizes of the expected restriction fragments
for the three plasmids are as follows: 9.1 and 1.2 kb for pJRD215; 10.4 kb for pJRC2 (23); and 8.0 and 1.7 kb for pCD342
(10). (B) Stability of pJRD215 and pBBR1MCS-2 in G.
sulfurreducens under nonselective conditions. Assessment of the
stability of these plasmids in the absence of antibiotic selection is
described in detail in Materials and Methods. Data are means ± standard errors of four independent experiments. (C) Expression of
green fluorescent protein from an IncQ expression vector in G.
sulfurreducens. Green fluorescent protein expression was
visualized by Nomarski microscopy using a fluorescein isothiocyanate
filter. Panel i, DL1, wild-type G. sulfurreducens. Panel
ii, DL1/pCD354, G. sulfurreducens transformed with
pCD354 (10).
|
|
As shown in Table 2, transformation
efficiency increased to (2.96 ± 1.08) × 107 transformants/µg (mean ± standard
error; n = 3) when pJRD215 DNA was purified from
G. sulfurreducens. This 100-fold increase in transformation
efficiency suggests that G. sulfurreducens may possess a
robust restriction system.
Identification of potential "suicide" and expression
vectors.
A variety of plasmids were tested for the ability to
replicate in and confer antibiotic resistance upon G. sulfurreducens (Table 2). In addition to pJRD215, two other IncQ
plasmids, pJRC2 and pCD342 (Table 1), were evaluated. The plasmid pJRC2
is identical to pJRD215 except that it confers resistance to
chloramphenicol. pCD342 is an expression vector containing a polylinker
which is preceded by the hybrid tac-lac promoter
(tac and lacUV5 promoters in tandem) and followed
by the rrnB transcriptional terminator (1, 20).
Electroporation of G. sulfurreducens with all three IncQ
plasmids resulted in the growth of numerous antibiotic-resistant transformants (Table 2), indicating that all of these plasmids were
capable of replication in G. sulfurreducens. In addition, all three of the IncQ plasmids could be purified from cultures of
G. sulfurreducens in sufficient quantity to be identified by digestion with restriction enzymes (Fig. 1A), suggesting that IncQ
plasmids are stable in this organism. In fact, pJRD215 has a half-life
of ~60 generations in G. sulfurreducens in the absence of
antibiotic selection (Table 2; Fig. 1B). Similarly, we were able to
purify pCD342 from G. sulfurreducens (Fig. 1A, lane 3) after
culturing a transformant for approximately 30 generations in the
absence of antibiotic selection.
To determine whether pCD342 could serve as an expression vector
for G. sulfurreducens, cells were transformed with
pCD354 (10), a green fluorescent protein expression
vector derived from pCD342. The green fluorescent protein was detected
in the resulting transformants (Fig. 1C), indicating that pCD342 is
indeed a suitable expression vector for G. sulfurreducens.
Due to their large size (
10 kb) and low copy number, IncQ vectors
are difficult to manipulate (8, 10). The pBBR1MCS series
of broad-host-range expression vectors (12), in contrast, are fairly small (~5.3 kb) and have a higher copy number. In
addition, they contain a variety of antibiotic resistance cassettes and possess an extensive multicloning site located within the
lacZ alpha peptide (12). Kanamycin-resistant
transformants were isolated following electroporation of G. sulfurreducens with pBBR1MCS-2 (Table 2), indicating that this
class of plasmids is capable of replication in G. sulfurreducens. However, pBBR1MCS-2 was found to be unstable in
G. sulfurreducens (Fig. 1B). Despite the rigorous maintenance of selective pressure during propagation of pBBR1MCS-2 in
liquid culture, only 15% of the CFU in these cultures were able to
grow on solid medium containing kanamycin. Furthermore, in the absence
of continued selection, kanamycin resistance was lost within 12 generations. Thus, despite the fact that pBBR1MCS vectors can replicate
in G. sulfurreducens, their instability renders them
unsuitable for use as expression vectors.
In addition to the two types of broad-host-range plasmids mentioned
above, one plasmid with limited host specificity, pBMK7 (23), was evaluated for the ability to replicate in
G. sulfurreducens. The plasmid pBMK7 is a shuttle vector
that contains two replicons: the pBM1 replicon, which functions in
E. coli, and the pBG1 replicon, which functions in
Desulfovibrio species. Members of the genus Desulfovibrio, like those of the Geobacter genus,
are obligate anaerobes belonging to the delta subdivision of the
Proteobacteria. However, electrotransformation of G. sulfurreducens with pBMK7 repeatedly failed to yield
kanamycin-resistant transformants (Table 2). Thus, even though
Geobacter and Desulfovibrio species are closely
related, the pBG1 replicon did not appear to function in G. sulfurreducens. Furthermore, these results indicated that plasmids containing the pBG1 or pBM1 replicons acted as suicide vectors
in G. sulfurreducens and could, therefore, be used to introduce mutations into its chromosome.
Mutagenesis of the G. sulfurreducens chromosome by
gene replacement.
The next step in the development of a genetic
system for G. sulfurreducens was to determine whether the
function of a specific gene could be eliminated by placing a mutation
in the G. sulfurreducens chromosome. A gene suspected of
being involved in nitrogen fixation by G. sulfurreducens was
selected as the first target, because, as noted above, it is important
to conclusively demonstrate that G. sulfurreducens has the
capacity to fix nitrogen. In other microorganisms, nitrogen reduction
is catalyzed by the nitrogenase enzyme complex, which is encoded by the
highly conserved nifH, nifD, and nifK genes (9, 30). Because the nitrogenase complex functions specifically in the nitrogen fixation pathway, inactivation of the
genes for any of its components yields a predictable and easily characterized phenotype, an inability to grow in medium lacking fixed
nitrogen (9). By using the nifD genes of other
organisms to probe the partial sequence of the G. sulfurreducens genome, a potential G. sulfurreducens
nifHDK operon was identified. Studies were initiated to determine
whether disruption of the putative nifD gene of G. sulfurreducens by the single-step gene replacement method
(25) would affect the ability of G. sulfurreducens to grow in a medium devoid of fixed nitrogen.
In order to disrupt the putative G. sulfurreducens nifD
gene, we constructed the suicide vector
pBRnif::kan (Table 1; Fig. 2B), which contained a fragment of the
nifD coding sequence disrupted by a kanamycin resistance
cassette. To ensure that incorporation of the disrupted nifD
coding sequence into the chromosome occurred via a double recombination
event, the suicide vector was linearized with NruI and
ScaI prior to electroporation. The recovery period following
electroporation was extended to ~18 h to allow ample time for
recombination and expression of kanamycin resistance. This procedure
resulted in the growth of 2.77 × 105
kanamycin-resistant colonies per µg of linear DNA. Eight of these kanamycin-resistant colonies were screened for the presence of the
disrupted nifD (nifD1::kan) coding
sequence by PCR, and all eight were found to contain the
nifD1::kan insertion mutation (data not shown).
These results indicated that recombination between linear DNA fragments
and the G. sulfurreducens chromosome was a highly efficient
process.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 2.
Confirmation of nifD gene disruption by
Southern blot analysis. (A) Restriction map of the G.
sulfurreducens nifHDK operon. (B) Restriction map of
pBRnif::kan. The vector pBR322 is indicated by
thick dotted lines. (C) Restriction map of G.
sulfurreducens nifHDK operon containing the
nifD1::kan insertion mutation. (D)
Southern blot of genomic DNA prepared from wild-type (lane 1) and
nifD1::kan strains (lanes 2 to 5) of G.
sulfurreducens. Genomic DNA was digested with the restriction
enzyme EcoRV and probed with a
BglII/EcoRV restriction fragment of the
kanamycin resistance cassette of
pBRnif::kan. Expected radiolabeled bands
are as follows: lane 1, none; lanes 2 to 5, 2.3 kb. (E) Southern blot
of genomic DNA prepared from wild-type (lane 1) and
nifD1::kan (lanes 2 to 5) strains of G.
sulfurreducens. Genomic DNA was digested with the restriction
enzyme EcoRV, blotted, and then probed with a
BamHI/EcoRI restriction fragment of
pBRnif::kan. Expected radiolabeled bands
are as follows: lane 1, 1.1 and >2.3 kb; lanes 2 to 5, 2.3 and >2.3
kb. All restriction maps were based on sequence data obtained from
http://www.tigr.org.
|
|
As shown in Fig. 2, Southern blot analysis confirmed both the presence
and placement of the kanamycin resistance cassette within the 5' end of
the nifD gene in four of the eight
nifD1::kan mutants described above, strains DL2A
to -D. All four of these genetically identical mutants were unable to
completely reduce the available Fe(III) in FWAFC medium lacking a
source of fixed nitrogen (data not shown). This result suggested that
disruption of the nifD gene had resulted in the expected
phenotype, an inability to grow in the absence of exogenous fixed
nitrogen. One of the four mutants, DL2D, was selected for a more
detailed characterization of its phenotype (Fig.
3).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 3.
Nitrogen fixation by wild-type (DL1) and
nifD1::kan (DL2D) G.
sulfurreducens. FWAFC cultures of strains DL1 and DL2D were
washed three times with FWAFC medium lacking both N2 and
NH4Cl (N2 replaced by Ar) in order to obtain
cell suspensions containing as little N2 and
NH4Cl as possible. At time zero, the washed cells were
inoculated into three types of FWAFC media: (i) FWAFC, (ii)
ammonium-free FWAFC, and (iii) FWAFC lacking both N2 and
NH4Cl at a final concentration of ~6 × 106 cells/ml. Fe(II) concentration (in millimolars) and
cell density (in cells/milliliter) were determined on 0.1-ml samples as
previously described (18, 19). Fe(II) concentrations are
means ± standard deviations of measurements obtained from three
independent cultures, whereas cell densities were determined from one
representative culture.
|
|
When strain DL2D and the wild-type strain DL1 were inoculated into
FWAFC medium, they grew and reduced Fe(III) at similar rates (Fig. 3).
When ammonium, the source of fixed nitrogen in the medium, was omitted,
the wild-type strain exhibited a longer lag but eventually grew and
reduced Fe(III) to levels comparable to those observed in
ammonium-containing medium. The extended lag period most probably
reflected the time required to induce the expression of nitrogen
fixation genes. In contrast to the wild-type strain, the mutant strain
DL2D failed to grow significantly in ammonium-free FWAFC medium and
reduced only a small amount of the available Fe(III). In fact, the
amount of growth and Fe(III) reduction by the mutant strain in
ammonium-free medium was comparable to that in medium lacking both
N2 and ammonium.
The small amount of cell growth observed in medium devoid of both
N2 and ammonium (Fig. 3) can be attributed to the
fact that residual ammonium may have been present in the washed starter cultures and that any cell lysis that occurred during washing would
have resulted in the release of additional fixed nitrogen. The
sustained low rate of Fe(III) reduction seen in this medium at the end
of the experiment is probably due to the fact that G. sulfurreducens is still capable of reducing Fe(III) even
when it is not actively growing.
Complementation of the nifD1::kan
phenotype by in trans expression of the
nifD gene.
In order to demonstrate that the
phenotype of mutant DL2D was in fact due to disruption of the
nifD gene and not to an unexpected secondary mutation or to
an unanticipated effect on downstream gene expression, the
nifD expression vector pCDSnifD was introduced into DL2D by electroporation. To determine if expression of the nifD gene in trans complemented the
nifD1::kan phenotype, the ability of
DL2D/pCDSnifD to grow in the absence of fixed nitrogen was
evaluated (Fig. 4). The extent of cell
growth and iron reduction by both DL2D/pCDSnifD and the
wild-type strain (DL1) was similar under all three conditions tested
(Fig. 4): (i) in the presence of both gaseous and fixed nitrogen, (ii)
in the presence of gaseous nitrogen alone, and (iii) in the absence of
both gaseous and fixed nitrogen. Thus, expression of the
nifD gene in trans restored the ability of the
nifD1::kan mutant DL2D to grow in the absence of
exogenous fixed nitrogen. In fact, DL2D/pCDSnifD can be
routinely cultured in ammonium-free FWAFC medium (data not shown).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 4.
Complementation of nifD1::kan
phenotype by expression of nifD gene in
trans. In order to select for the maintenance of
pCDSnifD, strain DL2D/pCDSnifD was
maintained in FWAFC medium containing 400 mg of streptomycin/ml until
the beginning of the experiments. To obtain cell suspensions containing
as little N2, NH4Cl, and streptomycin as
possible, FWAFC cultures of strains DL1 (wild type) and
DL2D/pCDSnifD were washed three times with FWAFC medium
without both N2 and NH4Cl (N2
replaced by Ar). At time zero, washed cells were inoculated into three
types of FWAFC media: (i) FWAFC, (ii) ammonium-free FWAFC, and (iii)
FWAFC lacking both N2 and NH4Cl at a final
concentration of ~3.6 × 106 cells/ml. Fe(II)
concentration and cell density were determined on 0.1-ml samples as
previously described (18, 19). Fe(II) concentrations are
the means ± standard deviations of measurements obtained from
three independent cultures, whereas cell densities were determined from
one representative culture.
|
|
Although antibiotics, which constitute potential sources of fixed
nitrogen, could not be used to select for the maintenance of
pCDSnifD and the nifD1::kan mutation
over the course of this experiment, PCR screening confirmed the
presence of both the nifD1::kan mutation and
pCDSnifD in strain DL2D/pCDSnifD at the end of
the experiment (data not shown).
The results described above confirm that G. sulfurreducens
has the ability to fix nitrogen. In addition, these results demonstrate that it is possible to complement mutations in G. sulfurreducens, a genetic technique required for properly
evaluating the function of genes in this organism.
Concluding remarks.
In summary, this study has demonstrated
that G. sulfurreducens is a genetically tractable
microorganism. It is now possible to introduce foreign DNA into
G. sulfurreducens by electroporation, to place mutations at
specific locations within its chromosome, and to express proteins from
extrachromosomal elements. These novel genetic techniques coupled with
the availability of the sequence of the G. sulfurreducens
genome will enable the rapid study of the physiological function of
multiple G. sulfurreducens genes. The finding that the
physiology of G. sulfurreducens can be studied by genetic
techniques is significant, because microorganisms closely related to
G. sulfurreducens are prominent members of a variety of
Fe(III)-reducing microbial communities (22, 28). Thus,
studies on the physiology of G. sulfurreducens, using the techniques outlined here, are likely to provide insights into microbial
processes occurring in the Fe(III) reduction zone of subsurface
environments. Studies similar to those described here but focusing on
mechanisms for the reduction of Fe(III) and contaminant metals by
G. sulfurreducens are currently in progress.
 |
ACKNOWLEDGMENTS |
This work was supported by the U.S. Department of Energy (grants
DE-FG02-98ER20306 and DE-FG02-97ER-62475-A005).
All G. sulfurreducens sequence data used in this report
were obtained from The Institute for Genomic Research website at
http://www.tigr.org. We thank Judy Wall, Christoph Dehio, and
Michael Kovach for sending us plasmids. We also acknowledge Betsy
Harris for her guidance and assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology, 203 Morrill Science Center IVN, University of
Massachusetts at Amherst, Amherst, MA 01003. Phone: (413) 545-9651. Fax: (413) 545-1578. E-mail: dlovley{at}microbio.umass.edu.
 |
REFERENCES |
| 1.
|
Amann, E.,
J. Brosius, and M. Ptashne.
1983.
Vectors bearing a hybrid trp-lac promoter useful for regulated expression of cloned genes in Escherichia coli.
Gene
25:167-178[CrossRef][Medline].
|
| 2.
|
Antoine, R., and C. Locht.
1992.
Isolation and molecular characterization of a novel broad-host-range plasmid from Bordetella bronchiseptica with sequence similarities to plasmids from Gram-positive organisms.
Mol. Microbiol.
6:1785-1799[CrossRef][Medline].
|
| 3.
|
Battisti, J. M., and M. F. Minnick.
1999.
Development of a system for genetic manipulation of Bartonella bacilliformis.
Appl. Environ. Microbiol.
65:3441-3448[Abstract/Free Full Text].
|
| 4.
|
Bazylinski, D. A.,
A. J. Dean,
D. Schüler,
E. J. Phillips, and D. R. Lovley.
2000.
N2-dependent growth and nitrogenase activity in the metal-metabolizing bacteria. Geobacter and Magnetospirillum species.
Environ. Microbiol.
2:266-273[CrossRef][Medline].
|
| 5.
|
Bethesda Research Laboratories.
1986.
BRL pUC host: E. coli DH5 TM competent cells.
Bethesda Res. Lab. Focus
8:9.
|
| 6.
|
Bolivar, F.
1978.
Characterization of new cloning vehicles.
Gene
4:121-136[CrossRef][Medline].
|
| 7.
|
Caccavo, F. J.,
D. J. Lonergan,
D. R. Lovley,
M. Davis,
J. F. Stolz, and M. J. McInerney.
1994.
Geobacter sulfurreducens sp. nov., a hydrogen- and acetate-oxidizing dissimilatory metal-reducing microorganism.
Appl. Environ. Microbiol.
60:3752-3759[Abstract/Free Full Text].
|
| 8.
|
Davison, J.,
M. Heusterspreute,
N. Chevalier,
V. Ha-Thi, and F. Brunel.
1987.
Vectors with restriction site banks. V. pJRD215, a wide-host-range cosmid vector with multiple cloning sites.
Gene
51:275-280[CrossRef][Medline].
|
| 9.
|
Dean, D. R., and M. R. Jacobson.
1992.
Biochemical genetics of nitrogenase, p. 763-864.
In
G. Stacey, R. H. Burris, and H. J. Evans (ed.), Biological nitrogen fixation. Chapman & Hall, New York, N.Y.
|
| 10.
|
Dehio, M.,
A. Knorre,
C. Lanz, and C. Dehio.
1998.
Construction of versatile high-level expression vectors for Bartonella henselae and the use of green fluorescent protein as a new expression marker.
Gene
215:223-229[CrossRef][Medline].
|
| 11.
|
Hanahan, D.
1983.
Studies on transformation of Escherichia coli with plasmids.
J. Mol. Biol.
166:557-580[Medline].
|
| 12.
|
Kovach, M. E.,
P. H. Elzer,
D. S. Hill,
G. T. Robertson,
M. A. Farris,
R. M. I. Roop, and K. M. Peterson.
1995.
Four new derivatives of the broad-host-range cloning vector pBBR1MCS carrying different antibiotic-resistance cassettes.
Gene
166:175-176[CrossRef][Medline].
|
| 13.
|
Lovley, D. R.
1991.
Dissimilatory Fe(III) and Mn(IV) reduction.
Microbiol. Rev.
55:259-287[Abstract/Free Full Text].
|
| 14.
|
Lovley, D. R.
2000.
Fe(III) and Mn(IV) reduction, p. 3-30.
In
D. R. Lovley (ed.), Environmental microbe-metal interactions. ASM Press, Washington, D.C.
|
| 15.
|
Lovley, D. R.
2000.
Fe(III)- and Mn(IV)-reducing prokaryotes.
In
M. Dworkin, S. Falkow, E. Rosenberg, K.-H. Schleifer, and E. Stackebrandt (ed.), The prokaryotes, in press. Springer-Verlag, Inc., New York, N.Y.
|
| 16.
|
Lovley, D. R.,
J. L. Fraga,
J. D. Coates, and E. L. Blunt-Harris.
1999.
Humics as an electron donor for anaerobic respiration.
Environ. Microbiol.
1:89-98[CrossRef][Medline].
|
| 17.
|
Lovley, D. R.,
R. C. Greening, and J. G. Ferry.
1984.
Rapidly growing rumen methanogenic organism that synthesizes coenzyme M and has a high affinity for formate.
Appl. Environ. Microbiol.
48:81-87[Abstract/Free Full Text].
|
| 18.
|
Lovley, D. R., and E. J. P. Phillips.
1986.
Availability of ferric iron for microbial reduction in bottom sediments of the freshwater tidal Potomac River.
Appl. Environ. Microbiol.
52:751-757[Abstract/Free Full Text].
|
| 19.
|
Lovley, D. R., and E. J. P. Phillips.
1988.
Novel mode of microbial energy metabolism: organic carbon oxidation coupled to dissimilatory reduction of iron or manganese.
Appl. Environ. Microbiol.
54:1472-1480[Abstract/Free Full Text].
|
| 20.
|
Morales, V. M.,
A. Backman, and M. Bagdasarian.
1991.
A series of wide-host-range low-copy-number vectors that allow direct screening for recombinants.
Gene
97:39-47[CrossRef][Medline].
|
| 21.
|
Nickoloff, J. A. (ed.).
1995.
Methods in molecular biology series, vol. 47. Electroporation protocols for microorganisms.
Humana Press, Totowa, N.J.
|
| 22.
|
Rooney-Varga, J. N.,
R. T. Anderson,
J. L. Fraga,
D. Ringelberg, and D. R. Lovley.
1999.
Microbial communities associated with anaerobic benzene mineralization in a petroleum-contaminated aquifer.
Appl. Environ. Microbiol.
65:3056-3063[Abstract/Free Full Text].
|
| 23.
|
Rousset, M.,
L. Casalot,
B. J. Rapp-Giles,
Z. Dermoun,
P. De Philip,
J. P. Bélaich, and J. D. Wall.
1998.
New shuttle vectors for the introduction of cloned DNA in Desulfovibrio.
Plasmid
39:114-122[CrossRef][Medline].
|
| 24.
|
Rousset, M.,
Z. Dermoun,
M. Chippaux, and J. P. Bélaich.
1991.
Marker exchange mutagenesis of the hydN genes in Desulfovibrio fructosovorans.
Mol. Microbiol.
5:1735-1740[CrossRef][Medline].
|
| 25.
|
Russell, C. B.,
D. S. Thaler, and F. W. Dahlquist.
1989.
Chromosomal transformation of Escherichia coli recD strains with linearized plasmids.
J. Bacteriol.
171:2609-2613[Abstract/Free Full Text].
|
| 26.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 27.
|
Smith, J. C.
1995.
Genetic transformation of Bacteroides spp. using electroporation, p. 161-169.
In
J. A. Nickoloff (ed.), Methods in molecular biology series, vol. 47. Electroporation protocols for microorganisms. Humana Press, Totowa, N.J.
|
| 28.
|
Snoeyenbos-West, O. L.,
K. P. Nevin,
R. T. Anderson, and D. R. Lovley.
2000.
Enrichment of Geobacter species in response to stimulation of Fe(III) reduction in sandy aquifer sediments.
Microb. Ecol.
39:153-167[CrossRef][Medline].
|
| 29.
|
Toyama, H.,
C. Anthony, and M. E. Lidstrom.
1998.
Construction of insertion and deletion mxa mutants of Methylobacterium extorquens AM1 by electroporation.
FEMS Microbiol. Lett.
166:1-7[CrossRef][Medline].
|
| 30.
|
Ueda, T.,
Y. Suga,
N. Yahiro, and T. Matsuguchi.
1995.
Genetic diversity of N2-fixing bacteria associated with rice roots by molecular evolutionary analysis of a nifD library.
Can. J. Microbiol.
41:235-240[Medline].
|
| 31.
|
Yanisch-Perron, C.,
J. Vieira, and J. Messing.
1985.
Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.
Gene
33:103-119[CrossRef][Medline].
|
Applied and Environmental Microbiology, July 2001, p. 3180-3187, Vol. 67, No. 7
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.7.3180-3187.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Risso, C., Methe, B. A., Elifantz, H., Holmes, D. E., Lovley, D. R.
(2008). Highly conserved genes in Geobacter species with expression patterns indicative of acetate limitation. Microbiology
154: 2589-2599
[Abstract]
[Full Text]
-
Stukalov, O., Korenevsky, A., Beveridge, T. J., Dutcher, J. R.
(2008). Use of Atomic Force Microscopy and Transmission Electron Microscopy for Correlative Studies of Bacterial Capsules. Appl. Environ. Microbiol.
74: 5457-5465
[Abstract]
[Full Text]
-
Holmes, D. E., Mester, T., O'Neil, R. A., Perpetua, L. A., Larrahondo, M. J., Glaven, R., Sharma, M. L., Ward, J. E., Nevin, K. P., Lovley, D. R.
(2008). Genes for two multicopper proteins required for Fe(III) oxide reduction in Geobacter sulfurreducens have different expression patterns both in the subsurface and on energy-harvesting electrodes. Microbiology
154: 1422-1435
[Abstract]
[Full Text]
-
Risso, C., Van Dien, S. J., Orloff, A., Lovley, D. R., Coppi, M. V.
(2008). Elucidation of an Alternate Isoleucine Biosynthesis Pathway in Geobacter sulfurreducens. J. Bacteriol.
190: 2266-2274
[Abstract]
[Full Text]
-
Coppi, M. V., O'Neil, R. A., Leang, C., Kaufmann, F., Methe, B. A., Nevin, K. P., Woodard, T. L., Liu, A., Lovley, D. R.
(2007). Involvement of Geobacter sulfurreducens SfrAB in acetate metabolism rather than intracellular, respiration-linked Fe(III) citrate reduction. Microbiology
153: 3572-3585
[Abstract]
[Full Text]
-
Richter, H., Lanthier, M., Nevin, K. P., Lovley, D. R.
(2007). Lack of Electricity Production by Pelobacter carbinolicus Indicates that the Capacity for Fe(III) Oxide Reduction Does Not Necessarily Confer Electron Transfer Ability to Fuel Cell Anodes. Appl. Environ. Microbiol.
73: 5347-5353
[Abstract]
[Full Text]
-
Steyert, S. R., Pineiro, S. A.
(2007). Development of a Novel Genetic System To Create Markerless Deletion Mutants of Bdellovibrio bacteriovorus. Appl. Environ. Microbiol.
73: 4717-4724
[Abstract]
[Full Text]
-
Letain, T. E., Kane, S. R., Legler, T. C., Salazar, E. P., Agron, P. G., Beller, H. R.
(2007). Development of a Genetic System for the Chemolithoautotrophic Bacterium Thiobacillus denitrificans. Appl. Environ. Microbiol.
73: 3265-3271
[Abstract]
[Full Text]
-
Ueki, T., Lovley, D. R.
(2007). Heat-shock sigma factor RpoH from Geobacter sulfurreducens. Microbiology
153: 838-846
[Abstract]
[Full Text]
-
DiDonato, L. N., Sullivan, S. A., Methe, B. A., Nevin, K. P., England, R., Lovley, D. R.
(2006). Role of RelGsu in Stress Response and Fe(III) Reduction in Geobacter sulfurreducens. J. Bacteriol.
188: 8469-8478
[Abstract]
[Full Text]
-
Reguera, G., Nevin, K. P., Nicoll, J. S., Covalla, S. F., Woodard, T. L., Lovley, D. R.
(2006). Biofilm and Nanowire Production Leads to Increased Current in Geobacter sulfurreducens Fuel Cells. Appl. Environ. Microbiol.
72: 7345-7348
[Abstract]
[Full Text]
-
Haveman, S. A., Holmes, D. E., Ding, Y.-H. R., Ward, J. E., DiDonato, R. J. Jr., Lovley, D. R.
(2006). c-Type Cytochromes in Pelobacter carbinolicus. Appl. Environ. Microbiol.
72: 6980-6985
[Abstract]
[Full Text]
-
Mehta, T., Childers, S. E., Glaven, R., Lovley, D. R., Mester, T.
(2006). A putative multicopper protein secreted by an atypical type II secretion system involved in the reduction of insoluble electron acceptors in Geobacter sulfurreducens.. Microbiology
152: 2257-2264
[Abstract]
[Full Text]
-
Nunez, C., Esteve-Nunez, A., Giometti, C., Tollaksen, S., Khare, T., Lin, W., Lovley, D. R., Methe, B. A.
(2006). DNA Microarray and Proteomic Analyses of the RpoS Regulon in Geobacter sulfurreducens.. J. Bacteriol.
188: 2792-2800
[Abstract]
[Full Text]
-
Kim, B.-C., Qian, X., Leang, C., Coppi, M. V., Lovley, D. R.
(2006). Two Putative c-Type Multiheme Cytochromes Required for the Expression of OmcB, an Outer Membrane Protein Essential for Optimal Fe(III) Reduction in Geobacter sulfurreducens.. J. Bacteriol.
188: 3138-3142
[Abstract]
[Full Text]
-
Butler, J. E., Glaven, R. H., Esteve-Nunez, A., Nunez, C., Shelobolina, E. S., Bond, D. R., Lovley, D. R.
(2006). Genetic Characterization of a Single Bifunctional Enzyme for Fumarate Reduction and Succinate Oxidation in Geobacter sulfurreducens and Engineering of Fumarate Reduction in Geobacter metallireducens. J. Bacteriol.
188: 450-455
[Abstract]
[Full Text]
-
Mehta, T., Coppi, M. V., Childers, S. E., Lovley, D. R.
(2005). Outer Membrane c-Type Cytochromes Required for Fe(III) and Mn(IV) Oxide Reduction in Geobacter sulfurreducens. Appl. Environ. Microbiol.
71: 8634-8641
[Abstract]
[Full Text]
-
Islam, F. S., Pederick, R. L., Gault, A. G., Adams, L. K., Polya, D. A., Charnock, J. M., Lloyd, J. R.
(2005). Interactions between the Fe(III)-Reducing Bacterium Geobacter sulfurreducens and Arsenate, and Capture of the Metalloid by Biogenic Fe(II). Appl. Environ. Microbiol.
71: 8642-8648
[Abstract]
[Full Text]
-
Holmes, D. E., Nevin, K. P., O'Neil, R. A., Ward, J. E., Adams, L. A., Woodard, T. L., Vrionis, H. A., Lovley, D. R.
(2005). Potential for Quantifying Expression of the Geobacteraceae Citrate Synthase Gene To Assess the Activity of Geobacteraceae in the Subsurface and on Current-Harvesting Electrodes. Appl. Environ. Microbiol.
71: 6870-6877
[Abstract]
[Full Text]
-
Leang, C., Adams, L. A., Chin, K.-J., Nevin, K. P., Methe, B. A., Webster, J., Sharma, M. L., Lovley, D. R.
(2005). Adaptation to Disruption of the Electron Transfer Pathway for Fe(III) Reduction in Geobacter sulfurreducens. J. Bacteriol.
187: 5918-5926
[Abstract]
[Full Text]
-
Nevin, K. P., Holmes, D. E., Woodard, T. L., Hinlein, E. S., Ostendorf, D. W., Lovley, D. R.
(2005). Geobacter bemidjiensis sp. nov. and Geobacter psychrophilus sp. nov., two novel Fe(III)-reducing subsurface isolates. Int. J. Syst. Evol. Microbiol.
55: 1667-1674
[Abstract]
[Full Text]
-
Kim, B.-C., Leang, C., Ding, Y.-H. R., Glaven, R. H., Coppi, M. V., Lovley, D. R.
(2005). OmcF, a Putative c-Type Monoheme Outer Membrane Cytochrome Required for the Expression of Other Outer Membrane Cytochromes in Geobacter sulfurreducens. J. Bacteriol.
187: 4505-4513
[Abstract]
[Full Text]
-
Leang, C., Lovley, D. R.
(2005). Regulation of two highly similar genes, omcB and omcC, in a 10 kb chromosomal duplication in Geobacter sulfurreducens. Microbiology
151: 1761-1767
[Abstract]
[Full Text]
-
Methe, B. A., Webster, J., Nevin, K., Butler, J., Lovley, D. R.
(2005). DNA Microarray Analysis of Nitrogen Fixation and Fe(III) Reduction in Geobacter sulfurreducens. Appl. Environ. Microbiol.
71: 2530-2538
[Abstract]
[Full Text]
-
Coppi, M. V.
(2005). The hydrogenases of Geobacter sulfurreducens: a comparative genomic perspective. Microbiology
151: 1239-1254
[Abstract]
[Full Text]
-
Holmes, D. E., Nevin, K. P., Lovley, D. R.
(2004). In Situ Expression of nifD in Geobacteraceae in Subsurface Sediments. Appl. Environ. Microbiol.
70: 7251-7259
[Abstract]
[Full Text]
-
Holmes, D. E., Nevin, K. P., Lovley, D. R.
(2004). Comparison of 16S rRNA, nifD, recA, gyrB, rpoB and fusA genes within the family Geobacteraceae fam. nov.. Int. J. Syst. Evol. Microbiol.
54: 1591-1599
[Abstract]
[Full Text]
-
Nunez, C., Adams, L., Childers, S., Lovley, D. R.
(2004). The RpoS Sigma Factor in the Dissimilatory Fe(III)-Reducing Bacterium Geobacter sulfurreducens. J. Bacteriol.
186: 5543-5546
[Abstract]
[Full Text]
-
Butler, J. E., Kaufmann, F., Coppi, M. V., Nunez, C., Lovley, D. R.
(2004). MacA, a Diheme c-Type Cytochrome Involved in Fe(III) Reduction by Geobacter sulfurreducens. J. Bacteriol.
186: 4042-4045
[Abstract]
[Full Text]
-
McCool, J. D., Ford, C. C., Sandler, S. J.
(2004). A dnaT Mutant With Phenotypes Similar to Those of a priA2::kan Mutant in Escherichia coli K-12. Genetics
167: 569-578
[Abstract]
[Full Text]
-
Coppi, M. V., O'Neil, R. A., Lovley, D. R.
(2004). Identification of an Uptake Hydrogenase Required for Hydrogen-Dependent Reduction of Fe(III) and Other Electron Acceptors by Geobacter sulfurreducens. J. Bacteriol.
186: 3022-3028
[Abstract]
[Full Text]
-
Lin, W. C., Coppi, M. V., Lovley, D. R.
(2004). Geobacter sulfurreducens Can Grow with Oxygen as a Terminal Electron Acceptor. Appl. Environ. Microbiol.
70: 2525-2528
[Abstract]
[Full Text]
-
Saltikov, C. W., Cifuentes, A., Venkateswaran, K., Newman, D. K.
(2003). The ars Detoxification System Is Advantageous but Not Required for As(V) Respiration by the Genetically Tractable Shewanella Species Strain ANA-3. Appl. Environ. Microbiol.
69: 2800-2809
[Abstract]
[Full Text]
-
Leang, C., Coppi, M. V., Lovley, D. R.
(2003). OmcB, a c-Type Polyheme Cytochrome, Involved in Fe(III) Reduction in Geobacter sulfurreducens. J. Bacteriol.
185: 2096-2103
[Abstract]
[Full Text]
-
Bond, D. R., Lovley, D. R.
(2003). Electricity Production by Geobacter sulfurreducens Attached to Electrodes. Appl. Environ. Microbiol.
69: 1548-1555
[Abstract]
[Full Text]
-
Holmes, D. E., Finneran, K. T., O'Neil, R. A., Lovley, D. R.
(2002). Enrichment of Members of the Family Geobacteraceae Associated with Stimulation of Dissimilatory Metal Reduction in Uranium-Contaminated Aquifer Sediments. Appl. Environ. Microbiol.
68: 2300-2306
[Abstract]
[Full Text]