Previous Article | Next Article 
Applied and Environmental Microbiology, August 2001, p. 3665-3670, Vol. 67, No. 8
Geo-Centers, Inc., Lanham, Maryland
207061; Department of Microbiology,
University of Alabama at Birmingham, Birmingham, Alabama
352942; and Research and Technology Directorate,
U.S. Army Edgewood Chemical Biological Center, Aberdeen Proving
Ground, Maryland 210103
Received 12 January 2001/Accepted 25 May 2001
Detection of biological weapons is a primary concern in
force protection, treaty verification, and safeguarding
civilian populations against domestic terrorism. One great concern is
the detection of Bacillus anthracis, the causative agent of
anthrax. Assays for detection in the laboratory often employ
inactivated preparations of spores or nonpathogenic simulants. This
study uses several common biodetection platforms to detect B. anthracis spores that have been inactivated by two methods and
compares those data to detection of spores that have not been
inactivated. The data demonstrate that inactivation methods can affect
the sensitivity of nucleic acid- and antibody-based assays for the
detection of B. anthracis spores. These effects should be
taken into consideration when comparing laboratory results to data
collected and assayed during field deployment.
Bacillus anthracis, the
causative agent of anthrax, is an important zoonotic disease of
domestic livestock. It is also associated with the waste from certain
processing industries such as tanneries and can be found in the
effluent from water processing plants (1). Cutaneous
anthrax is associated with the handling of contaminated animal products
and has a mortality rate of 5 to 20% when untreated. Inhalation of
B. anthracis spores causes pneumonic anthrax that has a
mortality rate approaching 100%. Antibiotic treatment is largely
unsuccessful after the appearance of symptoms (11). From a
military standpoint, B. anthracis has been described as the
ultimate biological weapon because of its virulence and persistence on
a battlefield when it is disseminated as a desiccated spore (13). Endospores are dormant forms of bacteria that
are stable for great lengths of time and are resistant to inactivation
from radiation and heat. Bacillus spores are so resistant
and hardy that they have been revived from the abdominal cavity of
an extinct bee entombed within Dominican amber 25 to 40 million years
ago (2) and isolated from a brine inclusion dated at
250 million years old (14).
Driven by the desire to develop and optimize detection devices to
monitor and track the spores of B. anthracis,
researchers face the need to handle moderate amounts of spore
antigens. However, biosafety containment and occupational exposure are
of great concern and necessitate inactivating the spores by gamma
irradiation with a cobalt source or by thermal treatment such as
autoclaving. B. anthracis has two major virulence factors
encoded by plasmids pX01 (77 kb) and pX02 (95 kb). The plasmid pX01
codes for the lethal factor, the edema factor, and protective antigen
that together form a tripartite protein exotoxin (4, 7, 9,
12). Plasmid pX02 codes for the spore capsule (3).
Laboratory detection assays often use inactivated spore preparations or
nonpathogenic simulants to conduct development and testing of
biosensors (6). The optimization of biodetection assays
can necessitate handling moderate quantities of dangerous pathogens.
Federal regulations limit the movement of pathogens and regulate safety
controls that must be employed to protect laboratory personnel.
Commonly, biodetection assays can be conducted with inactivated
preparations of the pathogens so that parameters can be optimized prior
to final testing of viable and virulent targets such as B. anthracis spores.
In this study, data are presented comparing the reactivity of
inactivated spore preparations versus that of viable spore preparations in biodetection assays. We demonstrate the effects of inactivation on
populations of Bacillus spores detected by assays such as
enzyme-linked immunosorbent assay (ELISA), PCR, and
fluorescence-activated cell sorting.
Growth and processing of Bacillus cultures.
Inactivation and biodetection protocols were conducted using B. anthracis NNR1 (pX01+ pX02
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.8.3665-3670.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Bacillus Spore Inactivation Methods
Affect Detection Assays
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
), B. anthracis 
Ames (pX01 pX02+), B. anthracis Sterne (plasmid free), and two negative controls, Bacillus subtilis strain 1031 and Bacillus
thuringiensis subsp. kurstaki.
Bacillus cultures were generously provided by Alvin Fox
(University of South Carolina Medical School) and Bruce Harper (Dugway
Proving Grounds, Utah). Frozen glycerol stock cultures were streaked
for isolation onto Trypticase soy agar (TSA) plus 5% sheep blood (BD
Biosciences, Cockeysville, Md.). Isolated colonies were streaked again
for isolation onto TSA + 5% sheep blood and incubated at 37°C
for approximately 6 h or until visible growth was evident. Growth in
nutrient broth was suspended, and 1 ml was spread plated onto nutrient
sporulation medium (containing, per liter, 3 g of yeast extract,
3 g of tryptone, 2 g of Bacto Agar, 23 g of Lab Lemco
agar, and 1 ml of 1% MnCl2) sporulation agar. These plates
were incubated at 37°C and monitored for spore formation by
phase-contrast microscopy with the criteria that vegetative cells are
dark and rod shaped and often present as chains of cells, while spores
are highly refractile and appear as smaller, bright ovals either inside
of vegetative cells or free floating. Cultures were harvested when the
ratio of vegetative cells to spores became static. For all strains used
in this study, cultures reached >90% spore content as determined by
microscopic visual approximation.
Irradiation kill curve.
Fresh spore preparations of B. anthracis Ames were diluted in cold, sterile water to a
concentration of 108 CFU/ml. Six 3-ml aliquots in 4-ml
Cryule vials were irradiated for time intervals of 30, 45, 60, 75, 90, and 105 min in a model 109 cobalt 60 irradiator (J. L. Shepherd & Associates). These aliquots, plus a nonirradiated control aliquot, were
plated (10% of total volume spread plated onto TSA plus 5% sheep
blood agar) and incubated for 48 h at 37°C. Because no bacterial
growth was evident from 60 to 105 min of irradiation, all subsequent
test aliquots were batch irradiated for 75 min (2.5 to 2.8 megarads). The control aliquot for the irradiation kill curve was
plate counted and contained 1.1 × 108 CFU/ml. To
determine whether or not soluble antigen contributed to the ELISA
response, the irradiated spore preparations were centrifuged to pellet
the spores, and ELISAs were also performed on the supernatants.
Autoclave kill curve.
The 108-CFU/ml suspension
of B. anthracis Ames was aliquoted into five 30-ml
centrifuge tubes with 10 ml of spore suspension in each tube. The tubes
were autoclaved for intervals of 10, 20, 30, 40, and 50 min in a Tomy
SS-325 autoclave at 212°C, 15 lb/in2. Autoclaved aliquots
plus a nonautoclaved control aliquot were plated onto TSA plus 5%
sheep blood agar and incubated for 48 h at 37°C to confirm
sterility. No growth was evident on plates from samples autoclaved from
20 to 50 min. All test aliquots were subsequently autoclaved for 20 min. The control aliquot for the autoclave kill curve was plate counted
and contained 1.1 × 108 CFU/ml. One set of spores was
stored in distilled water at 4°C without treatment. To determine
whether or not soluble antigen contributed to the ELISA
response, the autoclaved spore preparations were centrifuged to
pellet the spores, and ELISAs were performed on the supernatants.
ELISA. Untreated, autoclaved, and irradiated spore preparations were diluted in PBS (pH 7.4) (catalog no. 1000-3; Sigma Chemical Co., St. Louis, Mo.) to concentrations ranging from 107 to 105 CFU/ml, and 100 µl of each concentration was applied in quadruplicate to Maxisorp ELISA plates. After overnight incubation at 4°C, the coated wells were washed once with ELISA wash buffer (PBS [pH 7.4], 0.1% Tween 20, 0.001% thimerosal) using a Skatron plate washer (Molecular Devices, Chantilly, Va.). The plates were treated with rabbit anti-anthracis (Tetracore, Gaithersburg, Md.) or goat anti-anthracis (Antibodies, Inc., Davis, Calif.) polyclonal antibodies (PAb) or mouse anti-anthracis monoclonal antibodies (MAb).
MAb AB2 and BF1 were made by immunizing BALB/cJ mice withAmes
spores irradiated with 40 Gy of gamma irradiation. They were tested
extensively against panels of spores including Bacillus cereus and B. thuringiensis and were found
to be specific for strains of B. anthracis (data not shown).
The epitopes detected by these antibodies have not yet been identified.
BF1 and BD8 MAb [immunoglobulin G2a(
) IgG2a()] were purified
from culture supernatants by affinity chromatography from protein
G-Sepharose columns (Pharmacia). For assays in which the MAb was used
as the primary antibody, the MAb was diluted to 20 µg/ml in ELISA
dilution buffer (PBS [pH 7.4], 5% dry skim milk, 0.001% thimerosal)
and applied to every well. The plates were incubated at 37°C at 400 rpm with an iEMS Incubator/Shaker (Thermo Labsystems, Helsinki, Finland) for 1 h. All plates were washed with ELISA wash buffer six times. The secondary antibody, KPL (Kirkegaard and Perry
Laboratories, Gaithersburg, Md.) goat anti-mouse horseradish peroxidase
(HRP) conjugate, was diluted 1:2,000 in ELISA dilution buffer from a stock concentration of 0.5 mg/ml, and 100 µl was added to every well.
Plates were incubated at 37°C at 400 rpm for 1 h and then washed as
previously described. To detect the enzyme label, KPL 2,2'-azinobis-(3-ethylbenzthiazolinesulfonic acid) (ABTS) substrate was
prepared according to the manufacturer's instructions, and 100 µl
was added to every well. Plates were read at 405 nm after incubation at
room temperature for 15 min with a microtiter plate reader (Dynex,
Chantilly, Va.).
Both goat (Antibodies, Inc.) and rabbit (Tetracore) anti-anthracis PAb
used as primary antibodies were diluted in ELISA dilution buffer to a
working concentration of 5 µg/ml. Washes and incubations were
identical to those described above. Secondary HRP-labeled antibodies
were KPL rabbit anti-goat and KPL goat anti-rabbit HRP conjugate,
respectively. Each was diluted 1:2,000 and incubated as previously
described. Detection of enzyme label and readings were conducted as for
the monoclonal ELISA previously described.
Supernatants of centrifuged spore preparations were analyzed by ELISA
in a manner identical to that for the treated and untreated spore suspensions.
Flow cytometry.
All antibodies were labeled with Alexa 488 dye (Molecular Probes, Eugene, Oreg.) according to the manufacturer's
specifications. Ames or NNR1 spores were stained by incubating
106 washed spores in 5 µg of Alexa 488-labeled mouse
anti-B. anthracis spore MAb. BF1 and AB2/ml for 30 min in
PBS at 4°C. Another aliquot was stained with purified goat anti-spore
PAb and developed by Alexa 488-labeled donkey anti-goat antibody. Alexa
488-labeled IgG1 (not directed against B. anthracis) was
used as a control in conjunction with MAb BF1 and AB2. Protein
G-purified normal rabbit or goat IgG was used as a control for the PAb.
Binding of the antibodies was quantitated by flow cytometry using a
FACSCalibur (Becton Dickinson, Mountain View, Calif.) with forward- and
side-scatter setting optimized to detect spores. Results were displayed
as histograms with overlays of control antibody staining.
PCR. The TaqMan probe and primer sequences were designed with the software program Primer Express (Applied Biosystems, Foster City, Calif.) according to the manufacturer's instructions. TaqMan assays utilize the 5' nuclease activity of Taq DNA polymerase to cleave a nonextendible dually labeled hybridization probe during the extension phase of PCR (5). The increase in fluorescence as the reaction proceeds is interpreted by the machine and graphed as a change in the relative fluorescence versus the cycle number. The sequence of the probe was selected based on the following criteria: predicted cross-reactivity with currently available GenBank sequences, lack of predicted dimer formation with primers, self-annealing of the oligonucleotide, a 10°C-higher melting temperature of the probe than the primers, no stretches of identical nucleotides longer than four, and no guanine at the 5' end of the probe. The fluorescent reporter dye at the 5' end of the probe was 6-carboxy-fluorescein (FAM), and the quencher at the 3' end was 6-carboxy-tetramethyl-rhodamine (TAMRA). Capsule primers specifically amplified a 199-bp fragment of the capsule A (capA) gene (forward, GTGTTTGACCAAGGTGGACAA; reverse, TTACTCCATAGAGCACCCTTGGA; probe, FAM-CCAAAACCAGTTGCCAGTGCATTGG-TAMRA), and lethal factor gene (lef) primers amplified a 137-bp fragment of the lef gene (forward, GCTTAAGGAACATCCCACAGACTT; reverse, TCCGGTGCATAAAGCTGTAAAAC; probe, FAM-TTGCATATTATATCGAGCCACAGCATCGTG-TAMRA).
PCRs were carried out in 50-µl volumes with AmpliTaq Gold Master mixture, which contained AmpliTaq Gold DNA polymerase, AmpErase uracyl-N-glycosylase (UNG), deoxynucleoside triphosphates with dUTP, a passive reference, and optimized buffer components (Applied Biosystems; 400 nM each primer; 200 nM fluorogenic probe; 0.5 U of UNG; 0.125 U of AmpliTaq Gold DNA polymerase per reaction mixture; and 15 µl of treated or untreated spore preparations diluted to deliver 106 spores per reaction mixture. Reaction plates were incubated at 50°C for 5 min so that UNG could degrade any uracil from possible contaminating templates, followed by 2 min at 94°C to activate the AmpliTaq Gold. The reaction mixtures were then amplified by 45 cycles of 94 and 60°C. Amplification, data acquisition, and data analysis were carried out with a Perkin-Elmer 7700 sequence detection system (Applied Biosystems).| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Following repeated washes, the three B. anthracis spore preparations and the B. subtilis strain 1031 spore preparation approached 100% spore content with minimal cellular debris, while the B. cereus and B. thuringiensis subsp. kurstaki preparations were approximately 95% spores. Spore preparations that had been irradiated 60 min or more failed to grow when plated for viability following treatment. No growth was evident from spore preparations that had been autoclaved for 20 min or longer. All spore preparations were examined by phase-contrast microscopy. Spores inactivated by irradiation showed little visible change when compared to the untreated spore samples. However, autoclaved killed preparations showed an increase in the percentage of dark, nonrefractile spores.
Figure 1 depicts the results of a direct
ELISA using spores that have been inactivated by the methods described.
The ELISA response of B. anthracis Ames and NNR1 strains
was graphed at a single concentration (107 CFU/ml) of
spores, although serial dilutions were performed in quadruplicate
ranging from 108 to 105 CFU/ml (data not
shown). Irradiation of spore preparations resulted in a decreased ELISA
signal for all antibodies tested. Lower concentrations of spores showed
similar effects, although the proportions were different as the signal
approached background. Autoclave treatment resulted in a 83% decrease
in ELISA signal when Ames and NNR1 spores were probed with the mouse
MAb BF1. In contrast to the MAb, both of the PAb showed a >3-fold
increase in signal following autoclave treatment of Ames spores. A
48.9% increase in ELISA signal was observed when NNR1 spores were
probed with goat anti-anthracis PAb following thermal inactivation, and
a 12.8% increase in signal was observed when the spores were probed
with a rabbit anti-anthracis PAb.
|
In a direct ELISA, PAb response with spore supernatants indicates that
soluble antigens constitute a significant portion of the rabbit and
goat PAb-based activity (Fig. 2). Again,
the ELISA response increased in strength and proportion virtually
identically to that seen with spore suspensions. Interestingly, the
mouse MAb did not target an epitope in the supernatant whose signal increased in response to treatment.
|
Flow cytometry analysis was performed using the same antibodies and
spore preparations (Fig. 3). The analysis
of inactivated spores showed that MAb BF1 and goat anti-spore
antibodies produced a shift in fluorescence. A biphasic peak was
observed with untreated NNR1 spores when the spores were probed with
the MAb BF1. For these reasons, a second MAb, AB2, was tested against
the same spore preparations by flow cytometry. Figure 3 shows that AB2 stained both strains in a similar manner with no resulting biphasic peak. Inactivation appeared to destroy the binding sites of NNR1 and
Ames spores, as evidenced by a decrease in signal shift when the
spores were probed with either MAb AB2 or BF1. However, when NNR1
spores were irradiated, probed with MAb AB2, and analyzed by flow
cytometry, a small peak remained (Fig. 3). This may be attributed to
B. anthracis strain variability. It is important to note
that the overall trend is toward an apparent destruction of the binding
site for the MAb.
|
In contrast, staining with goat antibodies still resulted in a strong signal after inactivation treatments. Rabbit PAb yielded results similar to those obtained with goat PAb (data not shown). These results agree with the ELISA results outlined above and indicate that the epitope detected by BF1 is sensitive to both methods of inactivation. Detection using the PAb, which would be expected to target multiple epitopes, showed minimal differences between treated and untreated spores.
To investigate the effects of spore inactivation on nucleic acid-based
detection, the spore preparations were subjected to PCR. Two different
PCR assays based on TaqMan chemistry were used, each one targeting a
different virulence gene within B. anthracis. The
lef and capA assays were tested against panels of
nearest-neighbor DNAs and unrelated environmental isolate DNAs and were
proved to be specific for only those samples containing gene segments for their respective genes. No adverse cross-reactions or
false-positive responses were observed (data not shown). Untreated and
treated spores were assayed using the capA and the
lef genes as targets, and the data were plotted as the
relative change in total fluorescence versus the cycle number (Fig.
4 and 5). A
comparison with untreated Ames spores reveals that treatment by
irradiation results in an average 32% decrease in total end point
fluorescence after 45 cycles for the capA gene assay and a
38% decrease for the lef gene assay. Autoclaved
samples show an average decrease in end point fluorescence of 40% for
capA assay and 38% for the lef gene assay when
compared to untreated samples. B. anthracis NNR1 does not
harbor the pX02 plasmid (pX01+ pX02)
containing the capA gene and was used as a negative control for the capA gene assay (data not shown). B. anthracis Ames (pX01 pX02+) has been
cured of pX01 and results in a negative PCR response when assayed for
the lef gene (Fig. 5D). No PCR response was seen for
negative control samples that included B. cereus 6E1,
B. thuringiensis subsp. kurstaki, and
B. subtilis 1031 (Fig. 4D to F and 5E to G).
|
|
Comparison of Ct values reveals that inactivation by either irradiation or autoclave treatment results in an increase in threshold value of four cycles using the capA assay. Ct value comparisons for the lef gene assay show that irradiation requires five additional cycles for detection of a positive sample and nine additional cycles for autoclaved samples compared with untreated spore samples. Assuming 100% efficiency, every additional cycle represents a doubling of the previous cycle's total molecules. Therefore, the five additional cycles needed for detection of a positive response in the irradiated sample correlates to a 32-fold-less-viable template, and nine additional cycles needed for detection of the autoclaved samples correlates to a 512-fold-less-viable template. Quantitative comparison of the total log reduction in target molecules is not meaningful due to wide variances in the endpoint efficiencies of TaqMan PCR.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
The data demonstrate that inactivation methods can affect the sensitivity of nucleic acid-based detection and immunoassays for the detection of Bacillus spores. We have observed a differential effect based on the type of assay employed. The need to avoid handling and testing large amounts of potentially harmful spore preparations dictates that we understand the effects of inactivation procedures. We have studied two common spore inactivation procedures and demonstrated how they affect three types of biodetection assays. These effects should be taken into consideration when comparing laboratory results to data collected and assayed during field deployment.
The increase in the number of dark nonrefractile spores in the autoclaved spore preparations observed under phase-contrast microscopy may indicate a change in the spore structure. There is an association between increased numbers of dark spores and loss of ELISA signal generated with MAb AB2 and BF1. This is likely due to destruction of the epitope recognized by AB2 and BF1 during thermal inactivation. The epitopes recognized by the MAb were not released into the supernatant. MAb very likely detect only one epitope on the spore surface, which in this case is susceptible to alteration by all forms of spore inactivation. In contrast, the PAb may react with multiple epitopes, some of which are not altered by spore inactivation. Heat treatment may also cause conformational changes in the antigen that make certain epitopes more accessible for binding of PAb. We believe this phenomenon occurred in the autoclaved spores probed with PAb because of the significantly stronger signal. It is also possible that the antigen(s) has become more soluble and detached from the spore coat, making more antigen available for binding of the PAb in the ELISA format. The results of the direct ELISA using spore-free supernatants probed with both of the PAb and the MAb strongly indicate that distinct differences exist between the epitopes targeted by the MAb and the PAb anti-anthracis preparations.
The flow cytometry data show that irradiation and autoclaving disrupted
the binding of MAb BF1 to B. anthracis epitopes. The reasons
for the biphasic peak are unclear, although it is possible that the
NNR1 preparation had a larger amount of nonrefractile dark spores.
Alternatively, the biphasic peak could be due to a unique
characteristic of the NNR1 strain, since it was not observed with the
Ames strain (Fig. 3).
Inactivation of spores resulted in a decrease in the total end point fluorescence using the PCR lef and the capA gene assays. Total endpoint fluorescence can be adversely affected by several factors, including limiting reagents and amplification efficiency, so threshold values (Ct) are often used to compare assay results (5). The thermocycler software interprets the threshold value (Ct) to be the point at which the ratio of the reporter (FAM) to the quencher (TAMRA) exceeds a set limit and the amplification reaction is considered to be statistically significant. The Ct is often 10 times the standard deviation of the baseline, or it can be set just slightly above the negative controls to compensate for degradation of the probe over the course of the run. The increase in Ct values seen in the inactivated PCR assays could translate into a loss of sensitivity at the lower end of detection, although absolute sensitivity would be determined by several factors including primer efficiency and sample preparation methodology. The alteration in threshold seen with the inactivated spore preparations would require additional thermal cycles, translating into longer cycling times in order to attain a positive response. If the increase in threshold was significant enough and extended beyond the testing window, it is possible that a false-negative response would be obtained for a sample that contained inactivated anthrax, although this has no implications for the false-positive responses.
Comparisons of inactivated and viable pathogen data suggest that although the use of inactivated preparations is clearly preferable to working with viable pathogens in many circumstances, there may be variations in the results depending on the inactivation methods employed. Data presented using inactivated B. anthracis spore preparations should take into account such effects as sensitivity limits when citing characteristics of biodetection assays. The variations in response of DNA and antibody-based detection systems strongly support final testing of the viable threat agent as a supplement to inactivated testing.
There is some evidence to suggest that polyclonal antispore preparations preferentially target soluble spore components and that these immunodominant targets leach out of the spore during prolonged storage (8). Immunoassays of supernatants devoid of spores support those data and suggest that a significant portion of the polyclonal response is directed towards these soluble antigens. Thermal inactivation by autoclaving may accelerate the leaching of these soluble antigens into the surrounding media that would account for the dramatic rise in signal seen with PAb-based ELISA. Inactivation by wet heat is not normally thought to target DNA (10), but the data show a stronger decrease in PCR response for autoclaved samples than is seen for irradiated samples. A decreased PCR response using autoclaved spores may be due to the release of inhibitors following autoclave treatment, or the difference between the two methods may not be statistically significant.
Irradiation should not physically disrupt the spores, but our ELISA results suggest that this treatment does destroy or inactivate some epitopes. The epitopes for the particular MAb used in this study are obviously affected by irradiation, but other MAb may not be affected by inactivation. By definition, a PAb consists of many antibodies recognizing multiple epitopes, and the binding of some antibodies within that population may be destroyed while others actually may bind their targets more efficiently. MAb are targeted to a specific epitope that, if denatured, can result in a loss of recognition with a corresponding loss of signal not compensated for by binding to other epitopes.
As the Chemical and Biological Treaty nears completion, these data have implications for the detection of weapons of mass destruction. The enforcement of any treaty relies upon the verification of compliance and the reliability of methods for determining if a facility has been or is engaged in the production of biological weapons. Our data show that inactivation can either diminish or enhance the ability to detect an agent of biological origin, depending on the assay or reagents employed. It should be noted that although inactivation of spores resulted in a reduction in detection signals for PCR-based assays, this technology is exquisitely sensitive and can detect as few as a single organism (9).
It is important to note that inactivation did not lead to false-positive signals. For issues surrounding treaty verification, this infers that decontamination of a facility makes the detection of the pathogen more difficult depending on the assay employed but that a positive reaction should be indicative of the presence of a biological agent. Additional work with biological agents that have been decontaminated by bactericidal agents such as bleach will contribute to our confidence in the current arsenal of biodetection options.
The inactivation of weapons of mass destruction has implications for laboratory-based research and development of field-based applications of the various detection technologies. Future work should be aimed at platform- and method-specific testing of biological agents and the effects of decontamination on sensitivity and cross-reactivity. These issues are likely to become increasingly important in the realm of global politics, and further study is warranted.
| |
ACKNOWLEDGMENTS |
|---|
We acknowledge the contribution of Peter Spaeth of SBCCOM for his technical assistance and expertise in sample irradiation, Patricia E. Anderson of Geo-Centers, Inc., for her technical consultation on flow cytometry, and Calvin Chue for his technical assistance with TaqMan PCR data.
This work was supported in part by DAAD 13-00-0-0015 (principal investigator, J. Kearney), MDA 972-96-K-003/P0003, and DAAD 19-00-1-0032.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Geo-Centers, Inc., Gunpowder Branch, P.O. Box 68, Aberdeen Proving Ground, MD 21010. Phone: (410) 436-8765. Fax: (410) 436-1912. E-mail: jessica.dang{at}sbccom.apgea.army.mil.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Beyer, W., P. Glöckner, J. Otto, and R. Böhm. 1995. A nested PCR method for the detection of Bacillus anthracis in environmental samples collected from former tannery sites. Microbiol. Res. 150:179-186[Medline]. |
| 2. |
Cano, R. J., and M. K. Borucki.
1995.
Revival and identification of bacterial spores in 25- to 40-million-year-old Dominican amber.
Science
268:1060-1063 |
| 3. |
Green, B. D.,
L. Battisti,
T. M. Koehler,
C. B. Thorne, and B. E. Ivins.
1985.
Demonstration of a capsule plasmid in Bacillus anthracis.
Infect. Immun.
49:291-297 |
| 4. | Hacker, J., G. Blum-Oehler, I. Mühldorfer, and H. Tschäpe. 1997. Pathogenicity islands of virulent bacteria: structure, function and impact on microbial evolution. Mol. Microbiol. 23:1089-1097[CrossRef][Medline]. |
| 5. |
Heid, C. A.,
J. Stevens,
K. J. Livak, and P. M. Williams.
1996.
Real time quantitative PCR.
Genome Res.
6:986-994 |
| 6. | Horan, N. J., J. Parr, and P. J. Naylor. 1991. Evaluation of tracers for the determination of the mixing characteristics of activated sludge reactors. Environ. Technol. 12:603-608. |
| 7. | Lee, C. A. 1996. Pathogenicity islands and the evolution of bacterial pathogens. Infect. Agents Dis. 5:1-7[Medline]. |
| 8. | Lee, W. E., G. Thompson, and E. Kokko. 1998. The antigenicity of Bacillus globigii spores. DRES-SM-1500, p. 1-23. . |
| 9. |
Makino, S.-I.,
Y. Iinuma-Okada,
T. Maruyama,
T. Ezaki,
C. Sasakawa, and M. Yoshikawa.
1993.
Direct detection of Bacillus anthracis DNA in animals by polymerase chain reaction.
J. Clin. Microbiol.
31:547-551 |
| 10. |
Nicholson, W. L.,
N. Munkata,
G. Horneck,
H. J. Melosh, and P. Setlow.
2000.
Resistance of Bacillus endospores to extreme terrestrial and extraterrestrial environments.
Microbiol. Mol. Biol. Rev.
64:548-572 |
| 11. | Penn, C. C., and S. A. Klotz. 1997. Anthrax pneumonia. Semin. Respir. Infect. 12:28-30[Medline]. |
| 12. | Reilly, T. J., G. S. Baron, F. E. Nano, and M. S. Kuhlenschmidt. 1996. Characterization and sequencing of a respiratory burst-inhibiting acid phosphatase from Francisella tularensis. J. Biol. Chem. 271:10976-10983. |
| 13. | Sherman, L. 1995. A higher term of killing. Proc. U.S. Nav. Inst. 121:40-45. |
| 14. | Vreeland, R. H., W. D. Rosenzweig, and D. W. Powers. 2000. Isolation of a 250 million-year-old halotolerant bacterium from a primary salt crystal. Nature 407:897-900[CrossRef][Medline]. |
Applied and Environmental Microbiology, August 2001, p. 3665-3670, Vol. 67, No. 8
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.8.3665-3670.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Herzog, A. B., McLennan, S. D., Pandey, A. K., Gerba, C. P., Haas, C. N., Rose, J. B., Hashsham, S. A.
(2009). Implications of Limits of Detection of Various Methods for Bacillus anthracis in Computing Risks to Human Health. Appl. Environ. Microbiol.
75: 6331-6339
[Abstract] [Full Text] -
Dauphin, L. A., Newton, B. R., Rasmussen, M. V., Meyer, R. F., Bowen, M. D.
(2008). Gamma Irradiation Can Be Used To Inactivate Bacillus anthracis Spores without Compromising the Sensitivity of Diagnostic Assays. Appl. Environ. Microbiol.
74: 4427-4433
[Abstract] [Full Text] -
Helfinstine, S. L., Vargas-Aburto, C., Uribe, R. M., Woolverton, C. J.
(2005). Inactivation of Bacillus Endospores in Envelopes by Electron Beam Irradiation. Appl. Environ. Microbiol.
71: 7029-7032
[Abstract] [Full Text] -
Luna, V. A., King, D., Davis, C., Rycerz, T., Ewert, M., Cannons, A., Amuso, P., Cattani, J.
(2003). Novel Sample Preparation Method for Safe and Rapid Detection of Bacillus anthracis Spores in Environmental Powders and Nasal Swabs. J. Clin. Microbiol.
41: 1252-1255
[Abstract] [Full Text] -
Higgins, J. A., Cooper, M., Schroeder-Tucker, L., Black, S., Miller, D., Karns, J. S., Manthey, E., Breeze, R., Perdue, M. L.
(2003). A Field Investigation of Bacillus anthracis Contamination of U.S. Department of Agriculture and Other Washington, D.C., Buildings during the Anthrax Attack of October 2001. Appl. Environ. Microbiol.
69: 593-599
[Abstract] [Full Text] -
Zhou, B., Wirsching, P., Janda, K. D.
(2002). Human antibodies against spores of the genus Bacillus: A model study for detection of and protection against anthrax and the bioterrorist threat. Proc. Natl. Acad. Sci. USA
99: 5241-5246
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»