Applied and Environmental Microbiology, September 2001, p. 3888-3896, Vol. 67, No. 9
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.9.3888-3896.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
School of Molecular and Cellular Biosciences, University of Natal, Pietermaritzburg, Scottsville 3209, South Africa
Received 30 January 2001/Accepted 8 June 2001
| |
ABSTRACT |
|---|
|
|
|---|
Streptococcus milleri NMSCC 061 produces an endopeptidase, millericin B, which hydrolyzes the peptide moiety of susceptible cell wall peptidoglycan. The nucleotide sequence of a 4.9-kb chromosomal region showed three open reading frames (ORFs) and a putative tRNALeu sequence. The three ORFs encode a millericin B preprotein (MilB), a putative immunity protein (MilF), and a putative transporter protein (MilT). The milB gene encodes a 277-amino-acid preprotein with an 18-amino-acid signal peptide with a consensus IIGG cleavage motif. The predicted protein encoded by milT is homologous to ABC (ATP-binding cassette) transporters of several bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. These similarities strongly suggest that the milT gene product is involved in the translocation of millericin B. The gene milF encodes a protein of 302 amino acids that shows similarities to the FemA and FemB proteins of Staphylococcus aureus, which are involved in the addition of glycine to a pentapeptide peptidoglycan precursor. Comparisons of the cell wall mucopeptide of S. milleri NMSCC 061(resistant to lysis by millericin B) and S. milleri NMSCC 051(sensitive) showed a single amino acid difference. Serial growth of S. milleri NMSCC 051 in a cell wall minimal medium containing an increased concentration of leucine resulted in the in vivo substitution of leucine for threonine in the mucopeptide of the cell wall. A cell wall variant of S. milleri NMSCC 051 (sensitive) that contained an amino acid substitution (leucine for threonine) within its peptidoglycan cross bridge showed partial susceptibility to millericin B. The putative tRNALeu sequence located upstream of milB may be a cell wall-specific tRNA and could together with the milF protein, play a potential role in the addition of leucine to the pentapeptide peptidoglycan precursor and thereby, contributing to self-protection to millericin B in the producer strain.
| |
INTRODUCTION |
|---|
|
|
|---|
Several bacterial species produce peptidoglycan hydrolases that lyse target cells (4, 8, 10, 33, 43). The physiological functions of these enzymes remain largely unknown. The suggestion that bacteria use them to gain a competitive advantage in environments where nutrients are limited has been made previously (49). They may also allow producer organisms to establish an ecological niche within a competitive environment (49).
Millericin B, a peptidoglycan hydrolase produced by Streptococcus milleri NMSCC061, was purified and partially characterized as an endopeptidase that cleaves the interpeptide cross bridge and the stem peptide of susceptible peptidoglycan (6). This suggests that millericin B has activity similar to that of lysostaphin and ALE-1, both of which are glycylglycine endopeptidases that are produced by Staphylococcus simulans bv. staphylolyticus and Staphylococcus capitis EPK1, respectively (43, 47), as well as zoocin A, an endopeptidase produced by Streptococcus equi subsp. zooepidemicus 4881 (4).
Molecular cloning of the ale-1 gene showed that the primary structure of the mature ALE-1 is very similar to that of the proenzyme form of lysostaphin. The genes for lysostaphin (end) in S. simulans bv. staphylolyticus and for ALE-1 (ale-1) in S. capitis EPK1 were found to be located on large plasmids (20, 22, 35). This was in contrast to a previous finding where the gene for lysostaphin was found to be located on the chromosome of S. simulans bv. staphylolyticus (24).
S. simulans bv. staphylolyticus is resistant to lysis by lysostaphin (37), and this resistance is conferred by modifying the amino acid composition of interpeptide chains in cell wall peptidoglycan by increasing the serine content and decreasing the glycine content (11). The genetic elements for production and self-protection (immunity) of both lysostaphin and ALE-1 have been characterized (11, 22, 47, 50). The gene involved in the modification of peptidoglycan (epr, for endopeptidase resistance) was shown to be located on a large plasmid, pACK1, together with the gene (end) which encodes the endopeptidase (22). Staphylococcus aureus cells transformed with a plasmid containing the 8.4-kb DNA fragment from pACK1 produced lysostaphin and were resistant to lysis by lysostaphin, which indicated that the DNA fragment contained both epr and end (11).
The objective of this study was to determine whether the genes for millericin B and millericin B host immunity in S. milleri NMSCC 061 are similar in organization to the genes for lysostaphin and lysostaphin host immunity in S. simulans bv. staphylolyticus and the genes for ALE-1 and ALE-1 host immunity in S. capitis EPK1 (46, 47, 50). Here we describe the sequencing of the millericin B gene (milB) and the identification and sequencing of three additional genes in S. milleri NMSCC 061 that appear to be associated with millericin B host self- protection and its export. One of these genes (milF, for millericin B immunity factor), which is similar in sequence to genes that have been implicated in the synthesis of peptidoglycan cross bridges in staphylococci and streptococci (5, 12, 45, 47, 50), appears to specify the incorporation of a leucine in place of a threonine residue in the cross bridge of S. milleri NMSCC 061. A second gene is a putative tRNAleu gene, which is presumably involved in the incorporation of the leucine in the cross bridges of the peptidoglycan. The product of the third gene (milT) is homologous to a class of ATP-dependent transport proteins and may be necessary for the export of millericin B.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Bacterial strains and culture conditions.
The millericin B
producer strain S. milleri NMSCC 061 and the nonproducer
S. milleri NMSCC 051 were grown in tryptone soy broth or
tryptone soy agar plates containing 1.4% agar per liter. All working
cultures were subcultured every second week and stored at 4°C until
needed. Stock cultures were maintained in tryptone soy broth with 30%
glycerol at
70°C.
Purification of peptidoglycan. A 100-ml culture (using a 1% inoculum from a culture maintained on cell wall minimal medium [28.5 mM glucose, 1 mM DL-glutamic acid, 0.75 mM alanine, 0.2 mM lysine, 0.17 mM uracil, 0.125 mM glycerol, 1 mM MgCl2, 0.1 mM MnCl2, 3 µM thiamine, and 8.2 µM nicotinamide in 80 mM potassium phosphate buffer, pH 6.8, filter sterilized.]) of either S. milleri NMSCC 061 or S. milleri NMSCC 051 was grown in cell wall minimal medium overnight or until the optical density at 600 nm reached 1.0. After centrifugation (2,000 × g, 4°C) cells were washed twice with saline, once with water, and three times with acetone. The sediment was dried at 37°C, and 2.5 g of the dried powder was suspended in 25 ml of ice-cold distilled water and mixed with 25 ml of 0.1- to 0.15-mm-diameter glass beads in a Virsonic Sonicator until total disruption of cells was achieved (5 to 15 min). The glass beads and unbroken cells were removed after centrifugation for 10 min at 1,500 × g followed by a second centrifugation at 6,500 × g to sediment the cell walls. The pellet was washed three times with distilled water. Hydrolysis of the cellular macromolecules trapped in the cell wall was achieved by incubation with RNase A (100 µg/ml) and DNase (50 µg/ml; Roche Biochemicals) for 18 h at 37°C followed by trypsin (200 µg/ml; Sigma) for another 18 h at 37°C with buffer conditions according to the manufacturer's instructions. The walls were collected after centrifugation at 6,500 × g for 30 min and washed four times with water. Teichoic acids were extracted twice using 250 ml of 5% trichloroacetic acid for 18 h at 22°C. Peptidoglycan was collected by centrifugation at 6,500 × g for 30 min, washed three times with distilled water and three times with acetone, dried, and stored frozen until needed.
Amino acid analysis of peptidoglycan. Amino acid analysis was performed by conventional reverse-phase chromatography and O-phthaldialdehyde (OPA) derivatization. The OPA reagent was kept as a stock solution of 56 mg of OPA dissolved in 1 ml of methanol and 10 µl of 2-mercaptoethanol. This stock solution was stored at 4°C and diluted 1:10 with sample buffer (0.4 M Na3BO3 [pH 9.5]) for use. This dilution was freshly prepared daily. Standard amino acids were dissolved in 0.1 N HCl and peptidoglycan hydrolysates in sample buffer. Portions containing 20 pmol of each amino acid were subjected to derivatization by mixing 1:9 (vol/vol) with OPA reagent. A 20-µl portion was injected onto an Microsorb C18-RF column (particle size, 5 µm; Rainin Instruments Co., Inc., Woburn, Mass.) after a 60-s derivatization period. OPA-derivatized amino acids were separated on a Perkin-Elmer gradient system with a methanol-3% tetrahydrofuran (by volume) gradient in 50 mM Na2PO4 (pH 6.5) (40). The flow rate was kept at 1 ml/min.
Bactericidal action of millericin B on S. milleri NMSCC 051 and cell wall variants of S. milleri NMSCC 051 cells. A suspension of log-phase cells of S. milleri NMSCC 051 or the S. milleri NMSCC 051 Thr-to-Leu mutant was centrifuged, washed twice and resuspended in 20 mM phosphate buffer (pH 7.0) to an optical density at 600 nm of 0.5. Aliquots (0.1 ml) taken at 10-min intervals of suitable 10-fold dilutions were plated on tryptone soy agar plates, and the number of CFU was recorded after 18 h of growth.
Production of cell wall cross bridge variant. To change the amino acid composition of the interpeptide cross bridges of S. milleri NMSCC 051, cells were grown for 20 successive subcultures in 10-ml cultures of cell wall minimal medium (54). Leucine was added to a concentration of 1 mM. The peptidoglycan composition of cells was checked by analyzing the amino acids present in the peptide moiety using OPA derivatization.
Cleavage of peptidoglycan and liberation of free amino groups. Peptidoglycan (1 mg/ml) was incubated with millericin B (10 µg/ml) and aliquots (10 to 50 nmol, estimated from a standard curve) taken at different time intervals to determine the liberation of free amino groups (6). Flourodinitrobenzene (FDNB) reagent (130 µl in 10 ml of 100% ethanol) was added to each aliquot, mixed, and incubated at 60°C for 30 min. After acidification with concentrated HCl (50 µl) the DNP derivatives were detected by spectrophotometric adsorption at 405 nm. Reactions containing enzyme and FDNB reagent and those containing peptidoglycan and FDNB reagent, respectively, were used as controls.
Well diffusion assay. Purified peptidoglycan (1%) was incorporated into agar, and an aliquot of 10 µl of a 5-mg/ml solution of millericin B was added to the wells in the agar. Plates were incubated at 37°C for 18 h and checked for zones of clearing.
Purification of chromosomal DNA. Genomic DNA was isolated from overnight cultures of S. milleri NMSCC 061 using the NucleoSpin C + T DNA extraction Kit (Macherey-Nagel, Düren, Germany) with modifications. The buffer used to lyse the cells contained lysozyme (4 mg/ml), 20 mM Tris-Cl, 2 mM EDTA, and 1% Triton, pH 8.0. Cells were incubated for 1 h with lysis buffer at 37°C to ensure complete lysis. Purified genomic DNA was eluted from the NucleoSpin column with 10 mM Tris-HCl, pH 8.5, and used directly for amplification or for other enzymatic reactions.
Generation of internal protein fragments for amino acid sequencing. Purified millericin B was cleaved with cyanogen bromide to generate internal fragments. Millericin B (5 mg/ml) was solubilized in 50 µl of 70% formic acid. A crystal of cyanogen bromide was added, and the reaction tube was flushed with nitrogen upon closing. After 12 h of incubation at room temperature in the dark, the formic acid was evaporated under a vacuum. The digest was solubilized in a solution containing 6 M guanidine-HCl, 0.1 M Tris (pH 8.5), and 0.1 M dithiothreitol and resolved using reverse-phase high-performance liquid chromatography. Peaks were collected separately, and N-terminal amino acid sequence was obtained using an API 491 Procise automated sequencer (Applied Biosystems, Perkin-Elmer).
Construction and design of primers for PCR and DNA sequencing. Primers were constructed using reverse genetics from the amino acid sequences obtained from purified millericin B (6). The forward primer, 5'GAAAATGATTTTAGTCTAGCAATG3' (Mill-1), was designed from the N-terminal amino acid sequence of purified millericin B (6). The reverse primer, 5'CTATTTACAGCCGTAAGGGCC3' (Mill-2), was designed from the amino acid sequence obtained from an internal protein fragment (6). A third primer, Mill-3, was designed from the sequence generated with Mill-2 and Mill-1. Primers Mill-1 and Mill-2 were synthesized by the Department of Biochemistry, University of Cape Town. Primer Mill-3 used for sequencing was synthesized by Sequiserve, Verstetten, Germany. DNA sequence was determined by the dideoxy chain-termination method (42) with Thermo Sequenase (Amersham International, Little Chalfont, United Kingdom) by using an automated DNA sequencing system (ALFred; Pharmacia) at Sequiserve. Both strands were sequenced by using the PCR primers Mill-1 and Mill-2. Primer Mill-3 was used to sequence the internal region of the 1.8-kb fragment. The 3.2-kb fragment was sequenced using the pUC universal forward and Mill-2 primers. Internal sequence was generated by using primer walking.
PCR. Fragments of genomic DNA were amplified with standard reagents from Roche Biochemicals (Mannheim, Germany), using a GeneAmp System 2400 thermocycler (Perkin-Elmer). For the generation of an internal 1.8-kb fragment (see Fig. 4) the initial amplification was carried out under low-stringency conditions followed by higher-stringency conditions according to the following profile: (i) 95°C for 5 min, 37°C for 3 min, 70°C for 3 min (3 cycles); (ii) 94°C for 1 min, 45°C for 1 min, 72°C for 3 min (30 cycles); and (iii) 72°C for 7 min. A concentration of 3.5 mM magnesium chloride (MgCl2) yielded the brightest bands. In order to generate PCR fragments that would provide information on the sequence upstream of the millericin structural gene, genomic DNA from S. milleri NMSCC 061 partially digested with EcoRI was ligated into the EcoRI site of pUC 118. The ligation mixture was used as the template in a PCR, according to standard procedures, with Mill-2 and the pUC universal forward primers (see Fig. 4). The amplified fragments of interest were purified using either the agarase treatment method (Roche Biochemicals) or the NucleoSpin Extract Kit (Macherey-Nagel) as per manufacturers' instructions. PCR-amplified products were electrophoresed on 1.5% agarose (Whitehead Scientific, S.A.) gels. The amplified fragments were excised from low-melting-point agarose gels (Whitehead Scientific, S.A.). Gel pieces were treated with agarase (Roche Biochemicals, Germany), or gel fragments were purified directly using a NucleoSpin extraction kit (Macherey-Nagel). For agarase treatment gel pieces were incubated at 65°C for 15 min and cooled to 45°C. Typically 1 U of agarase was added for every 100 mg of agarose and incubated at 45°C for 1 to 2 h. Precipitation of the DNA was done using conventional methods (41). The purified fragments were dissolved in sterile distilled water for further use.
Nucleotide sequence accession number. The nucleotide sequence data identified in this study appears in the DDBJ, EMBL, and GenBank nucleotide sequence database under accession number AF243359.
| |
RESULTS |
|---|
|
|
|---|
Amino acid analysis of S. milleri NMSCC 061 (producer, resistant to lysis by millericin B) and S. milleri NMSCC 051 (sensitive). The cell wall composition of S. milleri strain NMSCC 051 was analyzed and compared to that of the millericin B producer strain S. milleri NMSCC 061. Both strains contained the usual O-acetylated N-acetylmuramic acid and N-acetylglucosamine sugar moieties in their peptidoglycan backbone. The two strains differed in the amino acid composition of their peptide moieties as determined by OPA derivatization. The resistant producer strain (NMSCC 061) had a leucine in its interpeptide cross bridge, whereas the sensitive strain (NMSCC 051) had a threonine residue in the same position.
Production of a cell wall variant.
A cell wall variant of
S. milleri NMSCC 051 (sensitive strain) was created in which
40 to 50% of the threonine residues were substituted with leucine
residues (Fig. 1). The molar masses of each amino compound were normalized with respect to glutamic acid. The
variant was less sensitive to millericin B (Fig.
2). The substitution of leucine for
threonine in the cell wall variant was not able to confer total
resistance to millericin B. Only 50% as many free amino groups were
liberated during millericin B digestion of the peptidoglycan of the
cell wall variant as were released during digestion of the
peptidoglycan of the wild-type organism (Fig. 3).
|
|
|
Generation of PCR fragments for sequencing.
The millericin B
operon (Fig. 4) nucleotide sequence (Fig.
5) was
determined. The strategy focused on generating PCR fragments using
reverse genetics from known amino acid sequences of purified millericin
B (6). A 1.8-kb fragment was generated from primers Mill-1
and Mill-2 and sequenced. A third primer, Mill-3, derived from the DNA
sequence generated with Mill-1 and Mill-2, was used to complete the
region flanking the Mill-1- and Mill-2-generated sequences. A second
PCR strategy using Mill-2 and the pUC universal forward primer was used
(Fig. 4A). Genomic DNA from S. milleri NMSCC 061 partially
digested with EcoRI was ligated into the EcoRI site of pUC 118. The ligation mixture was used as the template in a
PCR, according to standard procedures, with Mill-2 and the pUC
universal forward being the amplification primers.
|
|
Nucleotide sequence analysis.
Analysis of the nucleotide
sequence (Fig. 5) revealed a polycistronic operon containing four open
reading frames (ORFs). The second ORF (nucleotides 3066 to 3905)
corresponds to a translation product of 277 amino acids. This predicted
amino acid sequence includes a region identical to that shown to be
present at the NH2 terminus of purified
millericin B (6) and indicates that the corresponding
nucleotide sequence is the millericin B gene, designated
milB. An NH2-terminal extension of 18 amino acid residues contains a cluster of four positively charged
residues followed by an uncharged largely hydrophobic sequence and,
therefore, has the properties characteristic of a signal peptide
(23). In the NH2-terminal extension
there is a GG cleavage motif at position
2 and
1, which is common
to bacteriocin leader sequences. A putative promoter sequence was
identified upstream of the first ORF. The sequences TTTCACA
(position 231 to 237) and TATTATT (position 253 to
259) at
35 and
10, as well as their spacing (16 nucleotides), correspond closely to the sequences and spacing found in other (gram-positive) constitutive promoters (53). Protein
homology searches (Blast, Swiss Prot, and EMBL databases) revealed that the deduced amino acid sequence of millericin B has striking homology with lysostaphin and ALE-1, which are glycylglycine endopeptidases produced by S. simulans bv. staphylolyticus and S. capitis, respectively. Millericin B was found to have 58%
similarity to ALE-1 and 62% similarity to lysostaphin (Table
1). The N-terminal region of millericin B
also shows strong homology (82%) to the N-terminal region of ALE-1 and
lysostaphin.
|
Putative transporter gene. ORF 1 (milT) encodes a predicted protein consisting of 724 amino acid residues with a TAG stop codon (Fig. 5). Searching the protein sequence databases revealed strong similarities between the milT protein and several other proteins. The most similar proteins were members of the ATP-dependent transport proteins (13, 26), with several bacteriocin ATP-dependent transporters (19) having the greatest similarity.
The millericin B immunity factor. A gene (ORF 3) that codes for a putative millericin B host immunity factor was identified downstream from the millericin B structural gene (Fig. 4B). Figure 5 shows the nucleotide sequence of the PCR fragments sequenced. The millericin B host immunity factor (milF) starts with an ATG codon at nucleotide 3972 and ends with a TTA codon at nucleotide 4886. A Shine-Dalgarno sequence, AGAATGA, which is similar to those of streptococci (29) was observed 6 nucleotides upstream of the putative start codon. The ORF codes for a 302-amino-acid protein with a predicted molecular mass of 35.932 kDa.
When the nucleotide and deduced amino acid sequences of milF were compared with known sequences in databases of the BLAST and FASTA network search service (DDBJ database), a strong similarity (68%) was found with the amino acid sequences of the protein products of femA and femB of S. aureus (5), lif of S. simulans bv. staphylolyticus (50), and epr of S. capitis (47) (Table 1).Putative cell-wall-specific tRNA. A region of the nucleotide sequence located downstream of the putative milT gene codes for a putative tRNA species that shows great similarity to the tRNALeu sequence of streptococci and E. coli (3). This putative leucyl-tRNA could be a cell-wall-specific tRNA involved in leucine incorporation, in the interpeptide bridge during peptidoglycan synthesis. This could be equivalent to the cell wall-specific glycyl-tRNAs and seryl-tRNAs of S. aureus and S. epidermidis (27, 36, 44).
| |
DISCUSSION |
|---|
|
|
|---|
Results of this study demonstrate that the cell wall composition of S. milleri is not static but one which can be altered by the composition of the medium in which the bacteria are grown. Serial growth of the organism in a cell wall minimal medium containing an increased concentration of leucine resulted in the increased in vitro incorporation of leucine into the mucopeptide of the cell wall. As a result of leucine incorporation the variant organism S. milleri NMSCC 051 Leu-to-Thr mutant became more resistant to millericin B.
Several mechanisms have been proposed for the resistance of cell wall peptidoglycan to peptidoglycan hydrolases. For example, O-acetylation or unacetylation of amino sugars in peptidoglycan makes the cells resistant to lysozyme and other peptidoglycan hydrolases (1, 21, 31, 32, 39, 48, 51). Accessory cell wall polymers, such as lipoteichoic acid (7, 9, 16, 25, 28) teichoic acid (18, 50, 52), and teichuronic acid (38), are implicated as endogenous inhibitors of peptidoglycan hydrolases and are suggested to protect peptidoglycan.
Previous investigators reported that the amount of serine incorporated into the cross bridge of S. epidermidis is dependent on the ratio of glycyl- and seryl-tRNAs in an in vitro synthesizing system (44). A species of glycyl-tRNA (36, 44) and a species of seryl-tRNA (34) have been reported which participate in staphylococcal peptidoglycan synthesis but not in protein synthesis. Located within the millericin B operon we found a sequence that codes for a leucyl-tRNA species (Fig. 5). This species could play a role in the incorporation of leucine into the peptide cross bridge during peptidoglycan synthesis. In S. simulans bv. staphylolyticus, modification of the amino acid composition in peptidoglycan interpeptide cross bridges, as specified by the gene for lysostaphin resistance (epr or lif), was found to confer resistance to lysostaphin in these organisms (11, 50). Possibilities of involvement of additional polymers, such as teichoic acid or lipoteichoic acid, and acetyl moieties of the amino sugars in lysostaphin resistance were excluded (50).
A protein homology search revealed that the deduced amino acid sequence of the milF gene of S. milleri NMSCC 061 is similar to that of femAB of S. aureus (31, 45). milF also shares significant homology to murM (56%) and murN (48%), two proteins from Streptococcus pneumoniae responsible for interpeptide bridge formation in penicillin-resistant strains of pneumococci (15).
Detailed analysis of the peptidoglycan structure of a femA mutant revealed an accumulation of mono-glycyl-substituted muropeptide and several species of muropeptides with substitution by serine in the second or fourth positions of the interpeptide chains (12). These results suggest that the biosynthetic block in the femA mutant occurs after the addition of the first glycine residue to the interpeptide chain. Further studies suggested that femA is involved in the addition of the second and third glycines to the first glycine and that femB is involved in the addition of the fourth and fifth glycines of the interpeptide pentaglycine chain of the peptidoglycan precursor (31, 45). Our results suggest that the milF gene product is involved in adding leucine to the interpeptide cross bridge of the peptidoglycan in S. milleri NMSCC 061 and that this gene belongs to a family of genes that includes femAB, the epr genes in S. simulans bv. staphylolyticus and S. capitis EPK1, the zif (zoocin immunity factor) gene in S. equi subsp. zooepidemicus, and murMN (15) that are involved in the biosynthesis of peptidoglycan cross bridges in gram-positive cocci. Furthermore, in vivo incorporation of a leucine residue into the peptide cross bridge of S. milleri NMSCC 051 made its peptidoglycan more resistant to millericin B cleavage. Considering that the producer strain S. milleri NMSCC 061 differs from the susceptible strain, S. milleri NMSCC 051, by only a leucine residue in its peptide cross bridge, we suggest that the alteration of the amino acid composition in peptidoglycan interpeptide chains of S. milleri NMSCC 061 confers some resistance to millericin B.
The milT gene showed homology to several bacteriocin ABC
transporters as well as a group of eucaryotic proteins involved in multidrug resistance. The predicted milT protein consists of
an N-terminal half which is largely hydrophobic in character, while the
C-terminal half is mainly hydrophobic. The similarity of MilT to
members of the ATP-binding transport family (26) strongly suggests that its function includes a specific transport activity. The
comparisons showed most similarity to HlyB, an E. coli
membrane protein for the export of hemolysin, and competence factor
ComA from S. pneumoniae (14, 29). On the basis
of homology to the ComA and HlyB proteins, six potential
membrane-spanning segments (30), clustered in the
N-terminal half of the sequence, were identified in the predicted MilT
protein (Fig. 6). In the C-terminal part
of the protein, an ATP-binding motif (GMSGSGKTT) at position 519 to 527 and a region unique to proteins of the active transport group are highly conserved (Fig. 6) (12, 23). In addition, a proteolytic domain is observed in many of the ABC exporters that is
responsible for cleavage of the leader peptide during export
(19).
|
This study presented data on the genetic determinants of millericin B production and putative self-protection (immunity) of the producer strain. The arrangement of the millericin operon resembles that of bacteriocin systems in gram-positive bacteria. The genes required for production, secretion, and immunity are all located in the same transcription polarity. We show that unlike lysostaphin and ALE-1, millericin B appears to have a dedicated transporter (MilT) for secretion into the supernatant. This to our knowledge is the first report of a dedicated transporter for a cell wall hydrolase. Although millericin B and lysostaphin are functionally related there are several structural differences. The N-terminal tandem repeats observed in the preprolysostaphin molecule are absent in millericin B. Millericin B has a broader target specificity than lysostaphin. It has been suggested that the tandem repeats in lysostaphin allow the enzyme to interact with sites on the staphylococcal cell walls (50), and this property might contribute to its narrow spectrum of activity. Furthermore, millericin B cleaves two separate bonds within the peptide moiety of susceptible peptidoglycans, whereas lysostaphin only cleaves bonds within the peptide cross bridges.
The PCR fragments and their nucleotide sequences analyzed did not appear to contain any transcriptional stop signals. We acknowledge that while a single change in the cross bridges is quite likely necessary for resistance it may not be the only factor required for complete resistance. There may thus be other genes involved that have not yet been identified.
| |
ACKNOWLEDGMENTS |
|---|
We thank Willi Metzger from Sequiserve for the DNA sequencing.
This research was partly funded by the University Research Fund, University of Natal, and the National Research Foundation of South Africa.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biochemistry, University of Stellenbosch, Private Bag X1, Matieland, 7602, South Africa. Phone: 27 21 808-5872. Fax: 27 21 808-5863. E-mail: jhastings{at}worldonline.co.za.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Araki, Y.,
T. Nakatani,
K. Wakayama, and E. Ito.
1972.
Occurrence of N-nonsubstituted glucosamine residues in peptidoglycan of lysozyme resistant cell walls of Bacillus cereus.
J. Biol. Chem.
247:6312-6322 |
| 2. |
Axelsson, L., and A. Holck.
1995.
The genes involved in production of and immunity to sakacin A, a bacteriocin from Lactobacillus sake Lb706.
J. Bacteriol.
177:2125-2137 |
| 3. |
Bacot, C. M., and R. H. Reeves.
1991.
Novel tRNA gene organization in the 16S-23S intergenic spacer of the Streptococcus pneumoniae rRNA gene cluster.
J. Bacteriol.
173:4234-4236 |
| 4. | Beatson, S. A., G. L. Sloan, and R. S. Simmonds. 1998. Zoocin A immunity factor: a femA-like gene found in a group C streptococcus. FEMS Microbiol. Lett. 163:73-77[CrossRef][Medline]. |
| 5. | Berger-Bächi, B., L. Barberis-Maino, A. Strässle, and F. H. Kayser. 1989. FemA, a host-mediated factor essential for methicillin resistance in Staphylococcus aureus: molecular cloning and characterization. Mol. Gen. Genet. 219:263-269[CrossRef][Medline]. |
| 6. |
Beukes, M.,
G. Bierbaum,
H.-G. Sahl, and J. W. Hastings.
2000.
Purification and partial characterization of a murein hydrolase, millericin B, produced by Streptococcus milleri NMSCC 061.
Appl. Environ. Microbiol.
66:23-28 |
| 7. |
Bierbaum, G., and H.-G. Sahl.
1987.
Autolytic system of Staphylococcus simulans 22: influence of cationic peptides on activity of N-acetylmuramoyl-L-alanine amidase.
J. Bacteriol.
169:5452-5458 |
| 8. |
Burke, M. E., and P. A. Pattee.
1967.
Purification and characterization of a staphylolytic enzyme from Pseudomonas aeruginosa.
J. Bacteriol.
93:860-865 |
| 9. | Cleveland, R. F., J.-V. Höltje, A. J. Wicken, A. Tomasz, L. Daneo-Moore, and J. D. Shockman. 1975. Inhibition of bacterial wall lysins by lipoteichoic acids and related compounds. Biochem. Biophys. Res. Commun. 67:1128-1135[CrossRef][Medline]. |
| 10. | Coles, N. W., C. M. Gilbo, and A. T. Broad. 1969. Purification, properties and mechanism of action of a staphylolytic enzyme produced by Aeromonas hydrophila. Biochem. J. 111:7-15[Medline]. |
| 11. | DeHart, H. P., H. E. Heath, L. S. Heath, P. A. LeBlanc, and G. L. Sloan. 1995. The lysostaphin endopeptidase resistance gene (epr) specifies modification of peptidoglycan cross bridges in Staphylococcus simulans and Staphylococcus aureus. Appl. Environ. Microbiol. 61:1475-1479[Abstract]. |
| 12. |
De Jonge, B. L. M.,
T. Sidow,
Y.-S. Chang,
H. Labischinski,
B. Berger-Bächi,
D. A. Gage, and Tomasz.
1993.
Altered muropeptide composition in Staphylococcus aureus strains with an inactivated femA locus.
J. Bacteriol.
175:2779-2782 |
| 13. | Doolittle, R. F., M. J. Johnson, I. Husain, B. van Houten, D. C. Thomas, and A. Sancar. 1986. Domainal evolution of a prokaryotic DNA repair protein and its relationship to active transport proteins. Nature (London) 323:451-453[CrossRef][Medline]. |
| 14. |
Felmlee, T.,
S. Pellett, and R. A. Welch.
1985.
Nucleotide sequence of an Escherichia coli chromosomal hemolysin.
J. Bacteriol.
163:94-105 |
| 15. |
Filipe, S. R.,
M. G. Pinho, and A. Tomasz.
2000.
Characterization of the murMN operon involved in the synthesis of branched peptidoglycan peptides in Streptococcus pneumoniae.
J. Biol. Chem.
275:27768-27774 |
| 16. |
Fischer, W.,
P. Rösel, and H. U. Koch.
1981.
Effect of alanine ester substitution and other structural features of lipoteichoic acids on their inhibitory activity against autolysins of Staphylococcus aureus.
J. Bacteriol.
146:467-475 |
| 17. | Fremaux, C., Y. Hechard, and Y. Cenatiempo. 1995. Mesentericin Y105 gene clusters in Leuconostoc mesenteroides Y105. Microbiology 141:1637-1645[Abstract]. |
| 18. |
Guidicelli, S., and A. Tomasz.
1984.
Attachment of pneumococcal autolysin to wall teichoic acids, an essential step in enzymatic wall degradation.
J. Bacteriol.
158:1188-1190 |
| 19. | Håverstein, L. S., D. B. Diep, and I. F. Nes. 1995. A family of bacteriocin ABC transporters carry out proteolytic processing of their substrate concomitant with export. Mol. Microbiol. 16:229-240[Medline]. |
| 20. |
Hayashi, H.,
Y. Araki, and E. Ito.
1973.
Occurrence of glucosamine residues with free amino groups in cell wall peptidoglycan from bacilli as a factor responsible for resistance to lysozyme.
J. Bacteriol.
113:592-598 |
| 21. | Heath, H. E., L. S. Heath, J. D. Nitterauer, K. E. Rose, and G. L. Sloan. 1989. Plasmid-encoded lysostaphin endopeptidase resistance of Staphylococcus simulans biovar staphylolyticus. Biochem. Biophys. Res. Commun. 160:1106-1109[CrossRef][Medline]. |
| 22. | Heath, L. S., H. E. Heath, and G. L. Sloan. 1987. Plasmid-encoded lysostaphin endopeptidase gene of Staphylococcus simulans biovar staphylolyticus. FEMS Microbiol. Lett. 44:129-133[CrossRef]. |
| 23. |
Heijne, G.
1986.
A new method for predicting signal sequence cleavage sites.
Nucleic Acids Res.
14:4683-4690 |
| 24. | Heinrich, P., R. Rosenstein, M. Bohmer, P. Sonner, and F. Götz. 1987. The molecular organization of the lysostaphin gene and its sequences repeated in tandem. Mol. Gen. Genet. 290:563-569. |
| 25. |
Herbold, D. R., and L. Glaser.
1975.
Interaction of N-acetylmuramic acid L-alanine amidase with cell wall polymers.
J. Biol. Chem.
250:7231-7283 |
| 26. | Higgins, C. F., I. D. Hiles, G. P. C. Salmond, D. R. Gill, J. A. Downie, I. J. Evans, I. B. Holland, L. Gray, S. D. Buckel, and A. W. Bell. 1986. A family of related ATP-binding subunits coupled to many distinct biological processes in bacteria. Nature (London) 323:448-450[CrossRef][Medline]. |
| 27. | Hilderman, R. H., and H. G. Riggs. 1973. Effect of glycyl-tRNA concentration on in vitro serine incorporation into the peptidoglycan of S. epidermidis. Biochem. Biophys. Res. Commun. 50:1095-1103[CrossRef][Medline]. |
| 28. |
Höltje, J. V., and A. Tomasz.
1975.
Lipoteichoic acid: a specific inhibitor of autolysin activity in Pneumococcus.
Proc. Natl. Acad. Sci. USA
72:1690-1694 |
| 29. |
Hui, F. M., and D. A. Morrison.
1991.
Genetic transformation in Streptococcus pneumoniae: nucleotide sequence analysis shows comA, a gene required for competence induction, to be a member of the bacterial ATP-dependent transport protein family.
J. Bacteriol.
173:372-381 |
| 30. | Klein, P, M. Kanehisa, and C. DeLisi. 1985. The detection and classification of membrane-spanning proteins. Biochem. Biophys. Acta 815:468-476[Medline]. |
| 31. | Kopp, U., M. Roos, J. Wecke, and H. Labischinski. 1996. Staphylococcal peptidoglycan interpeptide bridge biosynthesis: a novel antistaphylococcal target? Microb. Drug Res. 2:29-41. |
| 32. |
Losardt, I. M., and H. Y. Neujahr.
1975.
Lysis of modified walls from Lactobacillus fermentum.
J. Bacteriol.
124:73-77 |
| 33. | Nord, C. E., T. Wadström, K. Dornbusch, and B. Wretlind. 1975. Extracellular proteins in five clostridial species from human infections. Med. Microbiol. Immunol. 161:145-154[CrossRef][Medline]. |
| 34. |
Petit, J. F.,
J. L. Strominger, and D. Söll.
1968.
Biosynthesis of the peptidoglycan of bacterial cell walls. VII. Incorporation of serine and glycine into interpeptide bridges in Staphylococcus epidermidis.
J. Biol. Chem.
243:757-767 |
| 35. |
Recsei, P. A.,
A. D. Gruss, and R. P. Novick.
1987.
Cloning, sequence, and expression of the lysostaphin gene from Staphylococcus simulans.
Proc. Natl. Acad. Sci. USA
84:1127-1131 |
| 36. | Roberts, R. J. 1972. Structures of two glycyl-tRNAs from Staphylococcus epidermidis. Nature (London) 237:44-45[CrossRef]. |
| 37. | Robinson, J. M., J. K. Hardman, and G. L. Sloan. 1979. Relationship between lysostaphin endopeptidase production and cell wall composition in Staphylococcus staphylolyticus. J. Bacteriol. 129:1158-1164. |
| 38. |
Robson, R. L., and J. Baddiley.
1977.
Role of teichuronic acid in Bacillus licheniformis: defective autolysis due to deficiency of teichuronic acid in a novobiocin resistant mutant.
J. Bacteriol.
129:1051-1058 |
| 39. | Rosenthal, R. S., J. K. Blundell, and H. R. Perkins. 1982. Strain-related differences in lysozyme sensitivity and extent of O-acetylation of gonococcal peptidoglycan. Infect. Immun. 37:724-728. |
| 40. |
Sahl, H.-G.,
M. Grossgarten,
W. R. Widger,
W. A. Cramer, and H. Brandis.
1985.
Structural similarities of the staphylococcin-like peptide Pep-5 to the peptide antibiotic nisin.
Antimicrob. Agents Chemother.
27:836-840 |
| 41. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 42. |
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467 |
| 43. |
Schindler, C. A., and V. T. Schuhardt.
1964.
Lysostaphin: a new bacteriolytic agent for the Staphylococcus.
Proc. Natl. Acad. Sci. USA
51:414-421 |
| 44. | Stewart, T. S., R. J. Roberts, and J. L. Strominger. 1971. Novel species of tRNA. Nature (London) 230:36-38[CrossRef][Medline]. |
| 45. |
Stranden, A. M.,
K. Ehlert,
H. Labischinski, and B. Berger-Bächi.
1997.
Cell wall monoglycine cross-bridges and methicillin hypersusceptibility in a femAB null mutant of methicillin-resistant Staphylococcus aureus.
J. Bacteriol.
179:9-16 |
| 46. |
Sugai, M.,
T. Fujiwara,
T. Akiyama,
M. Ohara,
H. Komatsuzawa,
S. Inoue, and H. Suginaka.
1997.
Purification and molecular characterization of glycylglycine endopeptidase produced by Staphylococcus capitus EPK1.
J. Bacteriol.
179:1193-1202 |
| 47. |
Sugai, M.,
T. Fujiwara,
K. Ohta,
H. Komatsuzawa,
M. Ohara, and H. Suginaka.
1997.
Epr, which encodes glycylglycine endopeptidase resistance, is homologous to femAB and affects serine content of peptidoglycan cross bridges in Staphylococcus capitis and Staphylococcus aureus.
J. Bacteriol.
179:4311-4318 |
| 48. |
Swim, S. C.,
M. A. Gfell,
C. E. I. Wilde, and R. S. Rosenthal.
1983.
Strain distribution in extents of lysozyme resistance and O-acetylation of gonococcal peptidoglycan determined by high-performance liquid chromatography.
Infect. Immun.
42:446-452 |
| 49. |
Tagg, J. R.,
A. S. Dajani, and L. W. Wannamaker.
1976.
Bacteriocins of gram-positive bacteria.
Microbiol. Rev.
40:722-756 |
| 50. | Thumm, G., and F. Götz. 1997. Studies on prolysostaphin processing and characterization of the lysostaphin immunity factor (Lif) of Staphylococcus simulans biovar staphylolyticus. Mol. Microbiol. 23:1251-1265[CrossRef][Medline]. |
| 51. | Tipper, D. J. 1969. Structure of the cell wall peptidoglycans of Staphylococcus epidermidis Texas 26 and Staphylococcus aureus Copenhagen. II. Structure of neutral and basic peptides from hydrolysis with the Myxobacter al-1 peptidase. Biochemistry 8:2192-2202[CrossRef][Medline]. |
| 52. | Tomasz, A., M. Westphal, E. B. Briles, and P. Fletcher. 1975. On the physiological function of teichoic acids. J. Supramol. Struct. 3:1-16[CrossRef][Medline]. |
| 53. |
Van der Vossen, J. M. B. M.,
D van der Lelie, and G. Venema.
1987.
Isolation and characterization of Streptococcus cremoris Wg2-specific promoters.
Appl. Environ. Microbiol.
53:2452-2457 |
| 54. | Wicken, A. J., and J. Baddiley. 1963. Structure of the intracellular teichoic acids from group D streptococci. J. Biochem. 87:54-59. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | Microbiol. Mol. Biol. Rev. | Eukaryot. Cell | All ASM Journals |
|---|