Previous Article | Next Article 
Applied and Environmental Microbiology, September 2001, p. 4166-4176, Vol. 67, No. 9
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.9.4166-4176.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Role of an Essential Acyl Coenzyme A Carboxylase in the Primary
and Secondary Metabolism of Streptomyces
coelicolor A3(2)
E.
Rodríguez,1
C.
Banchio,1
L.
Diacovich,1
M. J.
Bibb,2 and
H.
Gramajo1,*
Instituto de Biología Molecular y Celular de
Rosario (IBR-CONICET) and Departamento de Microbiología,
Facultad de Ciencias Bioquímicas y Farmacéuticas,
Universidad Nacional de Rosario, Suipacha 531, 2000-Rosario,
Argentina,1 and Department of
Molecular Microbiology, John Innes Centre, Colney Lane, Norwich NR4
7UH, United Kingdom2
Received 5 March 2001/Accepted 27 June 2001
 |
ABSTRACT |
Two genes, accB and accE, that form
part of the same operon, were cloned from Streptomyces
coelicolor A3(2). AccB is homologous to the carboxyl
transferase domain of several propionyl coezyme A (CoA) carboxylases
and acyl-CoA carboxylases (ACCases) of actinomycete origin, while AccE
shows no significant homology to any known protein. Expression of
accB and accE in Escherichia
coli and subsequent in vitro reconstitution of enzyme activity
in the presence of the biotinylated protein AccA1 or AccA2 confirmed
that AccB was the carboxyl transferase subunit of an ACCase.
The additional presence of AccE considerably enhanced the activity of
the enzyme complex, suggesting that this small polypeptide is a
functional component of the ACCase. The impossibility of
obtaining an accB null mutant and the thiostrepton
growth dependency of a tipAp accB conditional mutant
confirmed that AccB is essential for S. coelicolor
viability. Normal growth phenotype in the absence of the inducer was
restored in the conditional mutant by the addition of exogenous
long-chain fatty acids in the medium, indicating that the
inducer-dependent phenotype was specifically related to a conditional
block in fatty acid biosynthesis. Thus, AccB, together with AccA2,
which is also an essential protein (E. Rodriguez and H. Gramajo,
Microbiology 143:3109-3119, 1999), are the most likely components of
an ACCase whose main physiological role is the synthesis of
malonyl-CoA, the first committed step of fatty acid synthesis. Although
normal growth of the conditional mutant was restored by fatty acids,
the cultures did not produce actinorhodin or undecylprodigiosin,
suggesting a direct participation of this enzyme complex in the supply
of malonyl-CoA for the synthesis of these secondary metabolites.
 |
INTRODUCTION |
Malonyl coenzyme A (CoA) is
an essential metabolite in most living organisms. It is a substrate for
fatty acid synthases (4, 16), for polyketide synthases in
plants, fungi, and bacteria (19), and for fatty acid chain
elongation systems (37). It also plays a role as a
modulator of the activity of some proteins (8). Since
malonyl-CoA is used in the production of many of the pharmaceutically
important polyketides made by streptomycetes (19), there
is considerable interest in understanding the pathway(s) that leads to
its synthesis. Thus, knowledge of the enzyme(s) involved in the supply
of this key metabolite will not only provide a better understanding of
primary metabolism in streptomycetes but will potentially allow for the
development of more rational approaches for improving the level of
production of many useful secondary metabolites.
Biosynthesis of malonyl-CoA occurs in most species through
ATP-dependent carboxylation of acetyl-CoA by an acetyl-CoA carboxylase (45). The reaction catalyzed by this enzyme is a two-step
process that involves ATP-dependent formation of carboxybiotin,
followed by transfer of the carboxyl moiety to acetyl-CoA. Acetyl-CoA
carboxylase expression is essential for the normal growth of bacteria
(27, 28, 32), yeasts (17), and isolated
animal cells in culture (33), reflecting the importance of
this biosynthetic pathway.
Several complexes with acyl-CoA carboxylase (ACCase) activity
have been purified from a number of actinomycetes. These complexes also
possess the ability to carboxylate other substrates, including propionyl- and butyryl-CoA (12, 18, 20). Consequently,
these enzymes are referred to as ACCases, and all of them
consist of two subunits, a larger one (the
chain) with the ability
to carboxylate its covalently bound biotin group and a smaller one (the
chain) bearing the carboxyl transferase activity. Little is known
about the physiological role of these enzymes.
The pathway for the biosynthesis of malonyl-CoA in
Streptomyces coelicolor has not been established yet.
However, acetyl-CoA carboxylase activity has been readily
measured in crude extracts of S. coelicolor (7,
36), confirming the presence of this enzyme activity in this
microorganism. Attempts to purify a complex with acetyl-CoA carboxylase
activity from streptomycetes have been unsuccessful, probably
reflecting its high instability in vitro (7). An
alternative pathway for the biosynthesis of malonyl-CoA was described
in Streptomyces aureofaciens (2, 25) and
involved the anaplerotic enzymes phosphoenolpyruvate carboxylase and
oxaloacetate dehydrogenase. However, oxaloacetate dehydrogenase could
not be detected in S. coelicolor A3(2) (6),
where malonyl-CoA synthesis appears to occur exclusively through the
acetyl-CoA carboxylase complex.
Attempts to identify enzymes with carboxylase activity in S. coelicolor led to the characterization of two complexes exhibiting exclusively propionyl-CoA carboxylase (PCCase) activity. The
PCCase purified by Bramwell et al. (7) consisted
of a biotinylated protein, PccA, of 88 kDa and a nonbiotinylated
component, the carboxyl transferase, of 66 kDa. More recently, we
characterized, genetically and biochemically, the components of a
second PCCase in this bacterium. In vitro reconstitution
experiments showed that an active complex could be obtained by mixing a
carboxyl transferase component of 65 kDa, PccB, with either of the two almost identical biotinylated components, AccA1 and AccA2
(36).
Here we present a detailed genetic and biochemical characterization of
an essential ACCase from S. coelicolor. The
enzyme complex possesses unique characteristics and appears to be the main pathway for malonyl-CoA synthesis in this microorganism.
 |
MATERIALS AND METHODS |
Bacterial strains, culture, and transformation conditions.
S. coelicolor strain M145 (SCP1
SCP2
) was manipulated as described by Hopwood
et al. (19). The strain was grown on SFM, R2, and R5 agar
media and in 50 ml of SMM or YEME liquid medium. Escherichia
coli strain DH5
was used for routine subcloning and was
transformed according to the method of Hanahan (15).
Transformants were selected on media supplemented with the appropriate
antibiotics at the following concentrations: ampicillin, 100 µg ml
1; apramycin (APR), 100 µg
ml
1; chloramphenicol, 25 µg
ml
1; and kanamycin, 30 µg
ml
1. Strain BL21(DE3) is an E. coli
B strain lysogenized with
DE3, a prophage that expresses the T7 RNA
polymerase from the
isopropyl-
-D-thiogalactopyranoside (IPTG)-inducible lacUV5 promoter (43).
ET12567/pUZ8002 (a gift from M. Paget, John Innes Centre, Norwich,
United Kingdom) was used for E. coli-S. coelicolor
conjugation experiments (3). For selection of
Streptomyces transformants and exconjugants, media were
overlaid with thiostrepton (TH) (300 µg per plate), hygromycin (HYG)
(1 mg per plate), or APR (1 mg per plate), respectively. Strains and
recombinant plasmids are listed in Table
1. Fatty acid supplementation studies
were performed in SMM containing APR (10 µg
ml
1) and 0.075% (vol/vol) Brij 58. The
different fatty acids were added at a final concentration of 100 µg
ml
1.
Growth conditions, protein production, and preparation of cell
extracts.
S. coelicolor M145 was grown at 30°C
in shake flasks in YEME medium for 24 to 48 h. When necessary, 10 µg of APR ml
1 or 5 µg of TH
ml
1 was added to the medium. Mycelia were
harvested by centrifugation at 5,000 × g for 10 min at
4°C, washed in 100 mM potassium phosphate buffer, pH 8, containing
0.1 mM dithiothreitol (DTT), 1 mM EDTA, 1 mM phenylmethylsulfonyl
fluoride, and 10% glycerol (buffer A) and resuspended in 1 ml of the
same buffer. The cells were disrupted by sonic treatment (4- or 5-s
bursts) using a VibraCell Ultrasonic Processor (Sonics & Materials,
Inc.). Cell debris was removed by centrifugation, and the supernatant
was used as cell extract. For the expression of heterologous proteins,
E. coli strains harboring the appropriate plasmids were
grown at 37°C in shake flasks in Luria-Bertani medium in the presence
of 25 µg of chloramphenicol ml
1 or 100 µg
of ampicillin ml
1 for plasmid maintenance. In
order to improve the biotinylation of AccA1 and AccA2 in E. coli, the strains containing pCL1 or pTR204 were also transformed
with pBA11 (1), which overexpresses the E. coli
biotin ligase; 10 µM D-biotin was
also added to the medium. Overnight cultures were diluted 1:10 in fresh
medium and grown to an A600 of 0.4 to
0.5 before the addition of IPTG to a final concentration of 0.1 mM.
Induction was allowed to proceed for 4 h. The cells were
harvested, washed, and resuspended in 1 ml of buffer A. Cell extracts
were prepared as described above.
Protein methods.
Cell extracts were analyzed by denaturing
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
(26) using a Bio-Rad minigel apparatus. The final
acrylamide monomer concentration was 12% (wt/vol) for the separating
gel and 5% for the stacking gel. Coomassie brilliant blue was used to
stain protein bands. Protein contents were determined by the method of
Bradford (5) with bovine serum albumin as the standard.
The relative concentration of soluble AccB and AccA2 overexpressed in
E. coli was determined by densitometric scanning of the
polyacrylamide-SDS gels.
Acetyl-CoA carboxylase and PCCase assay.
Acetyl-CoA carboxylase and PCCase activities in cell extracts
were measured following the incorporation of
HCO3
into acid nonvolatile
material (7, 20). The reaction mixture contained 100 mM
potassium phosphate (pH 8.0), 300 µg of bovine serum albumin, 3 mM
ATP, 5 mM MgCl2, 50 mM
NaH14CO3 (specific
activity, 200 µCi mmol
1 [740 kBq
mmol
1]), 1 mM substrate (acetyl-CoA or
propionyl-CoA), and 100 µg of cell-free protein extract in a total
reaction volume of 100 µl. The reaction was initiated by the addition
of NaH14CO3, allowed to
proceed at 30°C for 15 min, and stopped with 200 µl of 6 M HCl. The
contents of the tubes were then evaporated to dryness at 95°C. The
residue was resuspended in 100 µl of water, 1 ml of Optiphase
scintillation liquid (Wallac Oy) was added, and the
14C radioactivity was determined in a Beckman
liquid scintillation counter. Nonspecific CO2
fixation by crude extracts was assayed in the absence of substrate. One
unit of enzyme activity catalyzed the incorporation of 1 µmol of
14C into acid-stable products per min. To confirm
that the products of the reactions were malonyl- or methylmalonyl-CoA,
samples were analyzed by high-performance liquid chromatography
(24).
DNA manipulations.
Isolation of chromosomal and plasmid DNA,
restriction enzyme digestion, and agarose gel electrophoresis were
carried out by conventional methods (22, 38). Southern
analyses were performed by using 32P-labeled
probes made by random oligonucleotide priming (Prime-a-gene kit; Promega).
Gene cloning and plasmid construction.
The synthetic
oligonucleotides TC1 (5'-CAGAATTCAAGCAGCACGCCAAGGGCAAG) and
TC2 (5'-CAGAATTCGATGCCGTCGTGCTCCTGGTC) were used to amplify
an internal fragment of the S. coelicolor pccB gene. The reaction mixture contained 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1 mM
MgCl2, 6% glycerol, 25 µM each deoxynucleoside
triphosphate, 2 ± 5 U of Taq or Pfu DNA
polymerase, 20 pmol of each primer, and 50 ng of S. coelicolor chromosomal DNA in a final volume of 100 µl. Samples
were subjected to 30 cycles of denaturation (95°C, 30 s),
annealing (65°C, 30 s), and extension (72°C, 1 min). A 1-kb
PCR fragment was used as a 32P-labeled probe to
screen a size-enriched library. A 2.7-kb BamHI fragment
containing an incomplete accB gene was cloned in
BamHI-cleaved pBluescript SK(+), yielding pTR62. The
synthetic oligonucleotides TC16
(5'-TATTCTAGACATATGACCGTTTTGGATGAGG), used to
introduce an NdeI site at the translational start codon of
the S. coelicolor accB gene, and TC17
(5'-ACCTCTAGACAACGCTCGTGGACC) were used
to amplify an internal fragment of the S. coelicolor
accB gene. The reaction mixture was the same as the one indicated
above. Samples were subjected to 35 cycles of denaturation (95°C,
30 s), annealing (65°C, 30 s), and extension (72°C, 1 min). The PCR product was digested with XbaI and cloned in
XbaI-cleaved pBluescript SK(
) in E. coli
DH5
, yielding pTR82. This plasmid was digested with BstEII and SacI, ligated with a
BstEII-SacI fragment cleaved from pMR08, and
introduced by transformation into E. coli DH5
, yielding pTR87. An NdeI-SacI fragment from pTR87 was
cloned in NdeI-SacI-cleaved pET22b(+) (Novagen)
(pTR88), thus placing the accBE operon under the control of
the powerful T7 promoter and ribosome-binding sequences. Expression of
accB was achieved by eliminating part of the coding sequence
of accE in pTR88. For this, pTR88 was digested with
NotI and the large fragment was religated to obtain pTR90.
The synthetic oligonucleotides NaccE
(5'-TTATCTAGACATATGTCCCCTGCCGAC), used to introduce an
NdeI site at the translational start codon of the
S. coelicolor accE gene, and CaccE
(5'-ATGAATTCTATGCATCGGGTCAGCGCCAGCTG) were used to amplify
accE. The reaction mixture was the same as the one indicated
above. Samples were subjected to 35 cycles of denaturation (95°C,
30 s), annealing (65°C, 30 s), and extension (72°C,
30 s). The PCR product was cloned using the pGEM-T easy vector
(Promega) in E. coli DH5
, yielding pTR106. An
NdeI-EcoRI fragment from pTR106 was cloned in
NdeI-EcoRI-cleaved pET22b(+), yielding pTR107,
thus placing the accE gene under the control of the T7
promoter and ribosome-binding sequences. To generate an accE
His tag fusion gene (full-length accE fused to six His codons at its N terminus), the NdeI-EcoRI
fragment from pTR107 was cloned in
NdeI-EcoRI-cleaved pET28a(+), yielding pTR237.
For the production of high levels of AccA2, we constructed pTR204. For
that the synthetic oligonucleotides accANd (5'-
CATATGCGAAAGGTGCTCATCGCCAATC) and accABa
(5'-AAAGCGTTCTCCGAGAGGAATCCGTAGC) were used to amplify the N
terminus of accA2 and to introduce an NdeI site
at the translational start codon of the gene. The PCR fragment was
cloned into PCR-Blunt (Invitrogen) to yield pTR200. A
BamHI-KpnI fragment from pTR45 (36)
was cloned into the BamHI-KpnI-digested pTR200,
yielding pTR202 with a full-length accA2 gene. Finally, the
NdeI-HindIII fragment from pTR202 was cloned
into the NdeI-HindIII-digested pET21a(+), to
yield pTR204.
To provide an additional copy of
accB, pIJ8600 was digested
with
BglII and
EcoRI and the fragment containing
oriT from RK2,
ori from pUC18, the
attP site and
int of

C31, and the
aac(3)IV
(Am
r) gene was ligated with a
linker containing sites for the following
restriction enzymes to yield
pTR141 (Mike Butler, personal communication):
BglII,
AseI,
EcoRI,
BglII,
NdeI,
KpnI,
XbaI,
PstI,
HindIII,
BamHI,
SstI, and
NotI. A 4.0-kb
KpnI fragment containing
the complete
accBE operon from pRM08 was cloned into
KpnI-cleaved pTR141, yielding
pTR149. To place the
chromosomal copy of
accBE under the control
of the
TH-inducible
tipA promoter, the synthetic oligonucleotides
TC16 (5'-ATTCTAGACATATGACCGTTTTGGATGAGG), used to introduce
an
NdeI site at the translational start codon of the
S. coelicolor accB gene, and TC17
(5'-ACCTCTAGACAACGCTCGTGGACC) were used to
amplify an
internal fragment of
S. coelicolor accB. The reaction
mixture contained 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1 mM
MgCl
2,
6% glycerol, 25 µM (each)
deoxynucleoside triphosphate, 2 to 5
U of
Taq DNA
polymerase, 20 pmol of each primer, and 50 ng of
S. coelicolor chromosomal DNA in a final volume of 100 µl. Samples
were subjected to 30 cycles of denaturation (95°C, 30 s),
annealing
(65°C, 30 s), and extension (72°C, 1 min). The 1-kb
PCR product
was digested with
XbaI (these sites were
introduced by the 5'
end of the oligonucleotides TC16 and TC17) and
cloned in
XbaI-cleaved
pBluescript SK(+), yielding pTR82. An
NdeI-
XbaI fragment from
the plasmid pTR82 was
cloned in
NdeI-
XbaI-cleaved pIJ8600, yielding
pTR93. In order to place the chromosomal copy of the
accBE
operon
under the
tipA promoter we removed from pTR93 a
HindIII fragment
containing the
int gene and
att of

C31, yielding
pTR94.
Protein purification protocols.
The
His6-tagged fusion protein H6AccE was purified
from cultures of RG12 [strain BL21(DE3) harboring pTR237] after the
addition of 0.1 mM IPTG to induce the DE3-encoded T7 RNA polymerase.
Cells were pelleted, resuspended in 50 mM phosphate buffer (pH
7.2)-300 mM NaCl-0.75 mM dithiothreitol-10% glycerol, and disrupted
by sonication. Cell debris was removed by centrifugation, and the supernatant was passed through a
Ni2+-nitrilotriacetic acid-agarose
affinity column equilibrated with the same buffer. The H6AccE protein
was recovered by elution with 100 mM imidazole and dialyzed against a
solution containing 100 mM sodium phosphate (pH 7.2), 1 mM
dithiothreitol, 1 mM EDTA, and 20% glycerol.
Nucleotide sequencing.
The sequence of the SstI
fragment containing accB was determined by subcloning
ApaI fragments from pRM08 in pSKBluescript SK(+). Synthetic
oligonucleotides were used where needed to complete the sequence.
Dideoxy sequencing (39) was carried out using the Promega
TaqTrack sequencing kit and double-stranded DNA templates.
S1 nuclease mapping.
For each S1 nuclease reaction, 30 µg
of RNA was hybridized in trichloroacetic acid-sodium salt
(NaTCA) buffer (solid NaTCA [Aldrich] was dissolved to 3 M in
50 mM PIPES, 5 mM EDTA, pH 7.0) to about 0.002 pmol (approximately
104 cpm) of the following probes. For
accA2, the oligonucleotide 5'-GCTTTGAGGACCTTGGCGATG
(accA2down) corresponding to a sequence within the coding region
of accA2 was uniquely labeled at the 5' end with
[32P]ATP using T4 polynucleotide kinase and
then used in PCR with the unlabeled oligonucleotide
5'-GAAGTACAGGCCGAAGACCAC (accA2up), which
corresponds to a sequence upstream of the accA2 promoter region, to generate a 766-bp probe. For accA1, the
oligonucleotide 5'-GCGATTTCGCCACGATTGGCG (accA1down)
corresponding to a sequence within the coding region of
accA1 was uniquely labeled at the 5' end and used in a PCR
with the unlabeled oligonucleotide 5'-CCGATATCAGCCCCTGATGAC (accA1down), which corresponds to a sequence upstream of the
accA1 promoter, to generate a 563-bp probe. For
accB, the oligonucleotide 5'-CGTCAGCTTGCCCTTGGCGTG
(accBdown) corresponding to a sequence within the coding region
of accB was labeled at the 5' end and then used in a PCR
with the unlabeled oligonucleotide 5'-CTACGCTCCGGGTGAGCGAAC (accBup), which corresponds to a sequence upstream of the
accB promoter, to generate a 483-bp probe. For
accBE, the oligonucleotide 5'-GGAGGGCCGTGATGGCGGCGACTTCCTCGGG (accBEdown) corresponding
to a sequence within the coding region of accE was labeled
at the 5' end and used in a PCR with the unlabeled oligonucleotide
5'-GAGGAACTGGTACGCGCGGGCG[GTACAAGCAAGCT] (accBEup)
corresponding to a sequence in the coding region of accB
(bracketed oligonucleotides constitute a tail added to the probe to
differentiate probe reannealing from full-length protection) to
generate a 563-bp probe. Subsequent steps were performed as described
by Strauch et al. (41).
Nucleotide sequence accession number.
The accB
and accE genes were identified in cosmid SC1C2
(S. coelicolor genome project
[http://www.sanger.ac.uk/Projects/S_coelicolor/]; nucleotide
accession number AL031124).
 |
RESULTS |
Cloning the accBE genes.
Since pccB
mutants of S. coelicolor produce wild-type levels of
acetyl-CoA carboxylase (36), we foresaw that a second gene encoding a different carboxyl transferase
subunit capable of recognizing acetyl-CoA as a substrate should exist in this organism. Based on the high level of sequence homology shown by genes encoding putative carboxyl transferases in the same species (e.g., in
Mycobacterium tuberculosis [10]), we
attempted to clone this alternative
subunit gene using
pccB as a hybridization probe. When a BamHI digest of S. coelicolor DNA was probed with
pccB under conditions of low stringency, a second poorly
hybridizing band was readily detected (data not shown). This
hybridizing sequence was cloned from a size-enriched library as a
2.5-kb BamHI fragment. Sequencing revealed the presence of
an incomplete open reading frame (ORF) with high homology to
pccB; the complete gene was subsequently cloned on a 6-kb
SstI fragment, yielding pRM08 (Fig.
1). Sequencing of this fragment revealed
a putative protein with end-to-end similarity to a likely decarboxylase
of Streptomyces cyanogenus (76% identity [46]), to PccB from S. coelicolor (57%
identity [36]), and to the
subunit (PccB) of the
Saccharopolyspora erythraea PCCase (56%
identity [11]). The gene encoding this new putative
carboxyl transferase was called accB.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 1.
Organization of the region of the S.
coelicolor M145 chromosome containing the accB
and accE genes. (A) Genetic and physical map of the
6.2-kb insert in pRM08. The secondary structure downstream of
accE may represent a factor-independent transcriptional
terminator. Probes 1 and 2 were generated by PCR using the
oligonucleotides accBup-accBdown and accBEup-accBEdown, respectively,
uniquely labeled at the 5' end (*) and were used in transcriptional
analysis of the accBE operon. (B) Map of the DNA
fragments cloned in pET22b that were used for expression of
accB and/or accE in E.
coli. Only relevant restriction sites are shown: B,
BamHI; Bc, BclI; E, EcoRI;
K, KpnI; Nd, NdeI; N,
NotI; S, SpHI.
|
|
The sequence also revealed the presence of a small ORF,
accE, whose start codon was only 17 bp downstream of the
termination
codon of
accB. A 17-nucleotide (nt) inverted
repeat which could
function as a factor-independent bidirectional
transcriptional
terminator separates
accE from three
convergent ORFs with homology
to putative proteins of
M. tuberculosis of unknown function. The
putative
AccE protein has a deduced molecular mass of 7.5 kDa
and does not
resemble any other known protein. The region upstream
of
accB encodes a putative protein which is highly homologous
to several known
hyaluronidases.
Heterologous expression of accB,
accE, and in vitro reconstitution of an ACCase
complex.
Recently, we achieved reconstitution of a
PCCase complex activity by mixing E. coli cell
extracts containing PccB (the carboxyl transferase) with cell extracts
containing the biotinylated subunits AccA1 and AccA2 (36).
To assess whether AccB and AccE were components of a previously
uncharacterized carboxylase complex, we attempted similar in vitro
reconstitution experiments with crude extracts containing these
proteins. Since E. coli does not contain PCCase and acetyl-CoA carboxylase activity cannot be assayed directly by
carboxylation of acetyl-CoA (34), the acetyl-CoA
carboxylase activity measured in these crude extracts represents the
activity of heterologous complexes reconstituted in vitro.
Overexpression of
accB and
accE in
E. coli was attempted with strain RG8, a BL21(DE3) strain containing
pTR88 (Fig.
1). SDS-PAGE
of crude extracts of RG8, prepared from
IPTG-induced cultures,
revealed overexpression of a 57-kDa
protein, corresponding to
the predicted size of AccB. In the same
electrophoretic analysis
no clearly identifiable AccE band was
observed. In vitro reconstitution
of ACCase activity was then
obtained by mixing a crude extract
prepared from an IPTG-induced
culture of RG8 with a cell extract
of
E. coli strain RG11,
which overproduces the biotinylated protein
AccA2 and the
E. coli biotin ligase BirA, harbored in plasmids
pTR204 and pBA11,
respectively. After incubation for 1 h at 4°C,
the mixture was
assayed for acetyl-CoA carboxylase and PCCase
activities. As
shown in Table
2, an enzyme complex with
both
acetyl-CoA carboxylase and PCCase activities was readily
detected,
confirming that AccB was the carboxyl transferase component
of
an ACCase complex. Similar results were obtained when the
reconstitution
experiments were performed using cell extracts of strain
RG7,
a BL21(DE3) strain containing pCL1 that provides AccA1 instead
of
AccA2 as the biotinylated component of the ACCase. The lower
levels of both acetyl-CoA carboxylase and PCCase activity are
due to the lower level of expression of
accA1 by pCL1
(
36).
These results confirmed that either AccA1 or AccA2
could be used
efficiently, at least in vitro, as the

subunit of the
enzyme
complex (Table
2).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Heterologous expression of ACCase components in
cell extracts of E. coli and in vitro reconstitution of
enzyme activity
|
|
Is AccE a functional component of the ACCase
complex?
The genetic organization of accB and
accE as members of the same transcription unit suggested
that AccE could also be a functional component of the ACCase
complex. To investigate this hypothesis we assayed acetyl-CoA
carboxylase and PCCase activities in a mixture of cell
extracts that contained AccB [strain RG9, a BL21(DE3) strain
containing pTR90] and AccA2 [strain RG11, a BL21(DE3) strain containing pTR204] but not AccE. Although ACCase activity
was readily detected in this mixture, indicating that AccE is not catalytically necessary for the successful reconstitution of an active
complex in vitro, the levels of acetyl-CoA carboxylase and
PCCase activities were considerably lower (approximately
30%) than those obtained with cell extracts that contained AccB and AccE (Fig. 2, compare mixes 1 and 2).
Since the levels of AccB in the cell extracts of RG8 and RG9 were
essentially the same, we inferred from these experiments that AccE was
necessary to obtain a fully active ACCase complex. To confirm
that the absence of AccE was responsible for the lower ACCase
activity observed, we studied the effect that the addition of cell
extracts containing high levels of soluble AccE [strain RG10, a
BL21(DE3) strain containing pTR107] had on the ACCase
activity present in a mix of crude extracts containing AccB and AccA2.
As shown in Fig. 2 (mixes 2 and 3) the specific activities of both
acetyl-CoA carboxylase and PCCase were almost 3.5 times
higher in the presence of AccE than in the control experiment that
lacked this protein and resembled those values obtained by mixing RG8
(AccBE) and RG11 (AccA2) cell extracts. Similar results were obtained
when purified H6AccE was added to the AccB-AccA2 mix (Fig. 2, mixes 4 to 9). The addition of different amounts of H6AccE (from values ranging
from 0.1 to 10 µg of pure protein) increased the levels of acetyl-CoA
carboxylase activity, reaching saturation when more than 2 µg of AccE
was present in the reaction mix. The fact that the maximum level of
enzyme activity was obtained at high concentrations of AccE proposed a
direct participation of this protein in the activation of the complex formed by AccB and AccA2. Although the results presented in this section suggest that AccE increases the rate of the ACCase
reaction, kinetic analysis using purified components will be necessary
to understand the precise role played in enzyme activity by this small
polypeptide.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
Effect of AccE on the catalytic activity of the
ACCase complex. In mixes 1, 2, and 3, acetyl-CoA carboxylase
and PCCase activities were measured after mixing equal
amounts of proteins from cell extracts from each of the strains
indicated. In mixes 4 to 9, ACCase activity was determined
using a mix of RG9 and RG11 cell extracts containing different amounts
of purified H6AccE. Results are the means of three determinations. When
ACCase activity was measured in individual cell extracts, the
amount of 14C fixed into acid-stable products was not
significantly higher than background levels (10 cpm, equivalent to 0.02 mU).
|
|
accB is an essential gene in S.
coelicolor
To study the role of AccB in vivo, we
attempted to construct an accB mutant by gene
replacement (Fig. 3A). A HYG resistance cassette was cloned in the unique BamHI site present in
the coding sequence of accB contained in pTR80.
After an intermediate cloning step in pIJ2925, a
BglII fragment containing the mutated allele was
inserted in the conjugative E. coli vector pSET151. The
resulting plasmid, pTR124, was introduced into the E.
coli donor strain ET12567/pUZ8002 and transferred by
conjugation into M145. Thr Hygr exconjugants
were selected in which the plasmid had integrated into the chromosome
at the accB locus by a single crossover. One of the
exconjugants, T124, was taken through four rounds of sporulation on SFM
medium with HYG to allow for a second crossover and replacement of the wild-type accB with the mutant allele.
Although several thousand colonies were screened for TH
sensitivity (which would have reflected successful gene replacement),
none were obtained, suggesting that accB could be an
essential gene in S. coelicolor. If this were true,
the presence of a second copy of accB in the chromosome
of T124 ought to permit a second crossover event, leading to the
replacement of the wild-type accB gene by the
Hygr mutant allele. To confirm this hypothesis, we first
integrated pTR149 (see Materials and Methods; Fig. 3B) containing
accBE and the native promoter into the
C31
attB site of T124 (the presence of accE
in this construct would also cater for any polar effect on the
expression of accE caused by disruption of the native
copy of accB). The resulting strain, T149
(Hygr Thr Amr), was subjected to
three rounds of sporulation on SFM agar containing HYG and APR, and
after screening approximately 500 colonies, 20 were found to be
Amr Hygr Ths; one of these was
designated T149A. Disruption of accB, but only in the
presence of an additional copy of the gene (i.e., in strain T149A), was confirmed by Southern analysis using an internal
fragment of accB as a hybridization probe. These
results confirmed the essentialness of AccB for S.
coelicolor viability.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 3.
Attempted disruption of accB. (A) Diagram
showing integration of pTR124 through one of the accBE
flanking regions and resolution of the cointegrate by a second
crossover event. The × on top of the arrow indicates the
inability to obtain the replacement of the wild-type
accB by the Hygr mutant allele. (B)
Integration of a second copy of accBE at the C31
att site of T124 (to yield strain T149) allowed
replacement of the wild-type accB by the mutant
allele.
|
|
Construction and characterization of an accBE
conditional mutant.
In order to regulate the expression of the
putative accBE operon and study its effect on the physiology
of S. coelicolor, we constructed a conditional mutant
strain in which the expression of these genes was under the control of
the TH-inducible tipA promoter (30). For this,
pTR94 was transformed into the E. coli strain
ET12567/pUZ8002 and conjugated into the S. coelicolor
strain M145. Integration of pTR94 by Campbell recombination through the accBE homologous sequences left the accBE operon
under tipAp. The strain obtained was named M94 and the
genetic modification introduced was confirmed by Southern blot
experiments (data not shown).
Normal growth of strain M94 on SMM depended on the presence of 5 µg
of TH/ml, which derepresses the expression of the
accBE operon. In the absence of TH growth was strongly affected, and
the low
growth levels observed were probably due to a leakiness
of the control
system (Fig.
4) (E. Takano and M. Bibb,
unpublished
data); no antibiotic production was observed in these
cultures.
To determine the effect of TH on the acetyl-CoA carboxylase
and
PCCase enzyme levels, both activities were measured in
38-h cultures
grown in SMM with or without the addition of 5 µg of
TH/ml. We
used this time point because both cultures were still in
their
exponential phase and we expected, at least for the acetyl-CoA
carboxylase activity, its maximal levels. As observed in Table
3, the acetyl-CoA carboxylase activity
present in crude extracts
prepared from the uninduced cultures was
almost 10 times lower
than that found in the TH-induced cultures. This
difference was
not observed in the levels of PCCase, a result
that was expected
considering that the ACCase containing AccB
as a

subunit is
only one of the three known complexes with
PCCase activity in
S. coelicolor (
7,
36). These results correlate the growth
deficiency of the M94
conditional mutant with the low levels of
acetyl-CoA carboxylase
activity in the absence of the inducer
and strongly support the
hypothesis that AccB is an essential
protein for
S. coelicolor viability.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 4.
Effects of TH and various fatty acids on growth of
S. coelicolor M94 bearing the
tipAp-accBE fusion. Cultures of strain M94 were grown in
SMM medium containing 10 mg of APR ml 1 ( ) or the same
medium supplemented with TH (5 µg/ml) ( ) or with the following
fatty acids at 0.01%: octanoic acid ( ), palmitic acid ( ), and
oleic acid ( ).
|
|
Since acetyl-CoA carboxylase catalyzes the synthesis of malonyl-CoA,
the primer for the elongation step of fatty acids, we
investigated
whether the growth defect showed by M94 could be
corrected by growing
it in the presence of different fatty acids.
M94 grew very poorly
in SMM (Fig.
4); however, when the SMM medium
was supplemented with
oleic acid, a straight-chain unsaturated
fatty acid, growth was
restored to normal levels (Fig.
4). The
growth of the mutant was
not stimulated by the straight-chain
octanoic acid or palmitic acid,
indicating that these saturated
fatty acids are not incorporated
efficiently into
S. coelicolor membrane phospholipids
or that the resulting membranes are not
functional. Similar results
were also described for an
accBC conditional
mutant of
Bacillus subtilis (
32). Interestingly, although
growth
was restored in oleate-supplemented medium, the cultures were
still impaired in antibiotic production and the levels of acetyl-CoA
carboxylase activity were the same as those found in the absence
of the
inducer (Table
3). All these results strongly suggest
that AccB is the
carboxyl transferase component of an essential
ACCase complex
whose main physiological role appears to be the
supply of malonyl-CoA
for both fatty acid and polyketide
biosynthesis.
Transcriptional analysis of accBE,
accA1, and accA2
Biosynthesis of
malonyl-CoA in S. coelicolor should occur not only
during exponential phase, when the synthesis of fatty acids is
essential, but also during transition and stationary phase to provide
the elongation units for the synthesis of actinorhodin and
undecylprodigiosin. Genetics and biochemical data propose that AccB
forms part of the main ACCase of S.
coelicolor involved in the biosynthesis of malonyl-CoA and that
either AccA2 or AccA1 could function as the biotinylated components of
this enzyme complex. In order to study the levels of transcription of
the enzyme components and hopefully gain more information into the
subunit composition of the complex throughout growth we performed
transcriptional studies of the accBE,
accA1, and accA2 genes.
S. coelicolor A3(2) strain M145 was grown in SMM medium
and RNA was extracted during the exponential, transition, and
stationary
phases of growth. S1 nuclease protection analysis of
accB mRNA
was performed using a 483-bp PCR product, uniquely
labeled at
the 5' end of the downstream oligonucleotide. Transcription
of
accB occurred primarily during active growth (exponential
and
transition phases) and then declined significantly upon entry
into
stationary phase (Fig.
5A). The
transcripts of the major
and essential sigma factor gene of
S. coelicolor,
hrdB, and of
the
pathway-specific activator gene for actinorhodin
biosynthesis,
actII-ORF4, were monitored as controls.
As expected from previous
work,
hrdB was expressed
throughout growth (
9), while the
actII-ORF4
transcript peaked during transition phase
and disappeared in stationary
phase (
13).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 5.
Growth phase-dependent expression and transcription
start site of the accBE operon. (A) S1 nuclease mapping
of accB, actII-ORF4, and
hrdB, using RNA isolated from a liquid-grown culture of
S. coelicolor M145. Exp, Trans, and Stat indicate
the exponential, transition, and stationary phases of growth,
respectively. (B) The nucleotide sequence of both strands of the
accB promoter region is shown. The arrow indicates the
most likely transcription start point for the accBE
promoter, as determined by S1 nuclease mapping. Potential 10 and 35
regions for accBEp are underlined. (C) S1 nuclease
mapping of the accB-accE intergenic region using a
563-nt probe. FLP, full-length protection of the probe reflecting
transcription across the intergenic region.
|
|
The RNA-protected fragment identified for
accB corresponds
to a transcript that would start 1 bp upstream of or at the adenine
of
the most likely translation start codon of
accB.
Putative

10
and

35 promoter regions similar to those likely to be
recognized
by
hrdB (
42) are
located upstream of the transcription initiation site
(Fig.
5B).
To determine if
accB and
accE were cotranscribed,
a 563-bp probe was generated by PCR that spanned the intergenic region.
For this we used a 5' oligonucleotide corresponding to a sequence
within the coding region of
accB and a 3' oligonucleotide
corresponding
to a sequence within
accE. The addition of a
13-nt tail to the
5' oligonucleotide allowed for facile discrimination
of full-length
protection (reflecting cotranscription) of the probe
from probe
reannealing. The results clearly showed that
accB
and
accE were
part of the same transcript (Fig.
5C). The
pattern of transcription
of
accBE during the different
growth phases corresponded well
to the profile observed with the
accB probe.
The transcripts of
accA2 present during exponential phase
were studied by high-resolution S1 mapping. The probe used was a
766-bp
PCR-generated DNA fragment uniquely labeled at the 5' end
of the
oligonucleotide corresponding to a sequence within
accA2.
The experimental data revealed the presence of two RNA protected
fragments, consistent with transcripts initiated 25 bp (from
accA2p1)
and 153 bp (from
accA2p2) upstream of
the putative translation
start site of
accA2 (Fig.
6A and C). The putative

10 and

35
regions of these promoters also show some similarity to the consensus
sequence of promoters that are likely to be recognized by
hrdB. The growth phase-dependent expression
of
accA2 from these two
putative promoters closely resembled
that observed for the
accBE operon; i.e., there was a
constant and high level of expression
during the exponential and
transition phases of growth that declined
markedly upon entry into
stationary phase (Fig.
7A). However,
a
new RNA protected fragment of 185 bp was also detected during
transition phase. Since the nucleotide sequences of
accA1
and
accA2 are identical from nt

2 to nt +200 with respect
to the
coding sequence (
36), 185 bp of this probe should
also be protected
by the
accA1 mRNA. Thus, although the
existence of a third promoter
for
accA2 that is regulated in
a different manner cannot be ruled
out, this transcript could also
correspond to
accA1.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 6.
Mapping of the accA2 and
accA1 transcription start points. (A and B)
High-resolution S1 nuclease mapping of the 5' end of
accA2 transcripts. Lanes 1, RNA protected products of
the S1 nuclease protection assay; lanes 2 to 5, A, C, G, and T lanes of
a dideoxy sequencing ladder using the same oligonucleotide that was
used to make the S1 probe (accA2down for accA2 and
accA1down for accA1). *, uniquely labeled with
32P at the 5' end. (C) Sequence of the
accA2 and accA1 upstream regions,
indicating the most likely transcription start point(s) for the
accA1 and accA2 promoters (bent arrows).
Potential 10 and 35 regions are underlined. Potential ribosomal
binding sites (rbs) are in bold. The 17-nt direct repeats found
upstream of the transcription start point of accA1p1 are
indicated with straight arrows.
|
|

View larger version (74K):
[in this window]
[in a new window]
|
FIG. 7.
Growth phase-dependent expression of
accA2 and accA1. S1 nuclease mapping of
accA2 (A) and accA1 (B), using RNA
isolated from a liquid-grown culture of S.
coelicolor M145 harvested at different stages of growth, is
shown. Exp, Trans, and Stat indicate the exponential, transition, and
stationary phases of growth, respectively.
|
|
S1 nuclease protection analysis of
accA1 was performed using
a 563-bp PCR product uniquely labeled at the 5' end of the downstream
oligonucleotide corresponding to a sequence within
accA1.
Two
major RNA protected fragments were identified (as well as a faint
band designated
accA1p3 in Fig.
6B), with the most abundant
representing
a putative transcriptional start site located 88 bp
upstream of
the GTG initiation codon of AccA1. Putative

10
and

35 regions
resembling those likely to be recognized by
hrdB are again located upstream of each of
the two more prominent
start sites (Fig.
6B and C). Two direct repeat
sequences of 16
bp containing only two mismatches flank the putative

35 region
of
accA1p1 and the transcription start point of
accA1p2 and might
represent the binding sites of a putative
transcriptional regulator
(Fig.
6C). S1 nuclease protection experiments
with RNA from different
growth phases revealed
accA1
transcripts exclusively during transition
phase (Fig.
7B), showing a
completely different regulation than
accA2 and suggesting
that the smallest RNA protected fragment
detected for
accA2
during transition phase most probably reflects
transcription of
accA1.
 |
DISCUSSION |
In Streptomyces malonyl-CoA is not only an essential
metabolite used as the main elongation unit for fatty acid biosynthesis (4, 8) but also one of the most common building blocks
utilized in the synthesis of several pharmaceutically important
polyketide compounds (19). Therefore, the interest in
establishing the pathway(s) leading to the biosynthesis of this
metabolic intermediate in this microorganism has relevance not only
from a fundamental view but also from a more applied point of view.
In most species, malonyl-CoA is synthesized through carboxylation of
acetyl-CoA by an acetyl-CoA carboxylase (45), and this enzyme complex has been shown to be essential for many microorganisms, such as E. coli, B. subtilis, and
Saccharomyces cerevisiae (17, 28, 32). Based on
this knowledge and in an attempt to characterize the malonyl-CoA
biosynthetic pathway in S. coelicolor we searched for a
carboxyl tranferase component that could function as the
subunit of
an acetyl-CoA carboxylase complex. Thus, by using pccB
(36) as a hybridization probe we isolated the
accBE operon of S. coelicolor. Expression of
accB and accE in E. coli and
subsequent in vitro reconstitution of enzyme activity in the presence
of the biotinylated proteins AccA1 and AccA2 confirmed that AccB was
the carboxyl transferase subunit of an ACCase. The additional presence of AccE considerably enhanced the activity of the enzyme complex (Table 2), suggesting that this small polypeptide is a
functional component of the ACCase. Whether this protein
plays a role as an allosteric regulator of the enzyme or as a
structural component of the complex remains to be elucidated. All the
actinomycete ACCases studied so far contain three functional
domains located in two polypeptides (18, 20). Thus, AccE,
for which there are no known homologues, might be a distinctive feature
of ACCases from Streptomyces spp.
Based on these biochemical studies we decided to prove in vivo whether
AccB was the carboxyl transferase component of an essential ACCase. The impossibility of obtaining an accB
null mutant and the TH growth dependency of a tipAp-accB
conditional mutant (Fig. 3A and 4) confirmed that AccB is essential for
S. coelicolor viability. A normal growth phenotype in
the absence of the inducer was restored in the conditional mutant
by the addition of exogenous long-chain fatty acids in the medium
(Fig. 4), indicating that the inducer-dependent phenotype was
specifically related to a conditional block in fatty acid biosynthesis
and that the acetyl-CoA carboxylase activity of the ACCase
complex, containing AccB as the carboxyl transferase subunit, is the
main pathway of malonyl-CoA biosynthesis in S. coelicolor. Although normal growth was restored by unsaturated fatty acids in liquid SMM medium, we were unable to obtain an accB mutant of T124 in the presence of oleate after several
rounds of sporulation in SFM medium (41) supplemented with
oleate and APR. We suggest that de novo fatty acid synthesis may be
essential for an efficient sporulation of this microorganism, as was
shown in B. subtilis in which fatty acid synthesis is
essential to couple the activation of the mother cell transcription
factors with the formation of differentiating cells (40).
If this hypothesis was correct accB mutants would not be
able to sporulate, even in the presence of oleate, and would be lost in
the isolation procedure utilized.
Considering the essential role played by AccB and taking into account
the apparent inviability of accA2 mutants in S. coelicolor (36), we postulate that AccA2 and AccB are
the
and
components of an ACCase, whose main
physiological role is the synthesis of malonyl-CoA. Transcriptional
studies of accBE and accA2 showed that the
expression of these genes occurred principally during the exponential
and transition phases of growth (Fig. 5A and 6A), in agreement with
their essential role in this organism. Consistent with these results
the levels of acetyl-CoA carboxylase and PCCase activity
throughout growth were also found to be maximal during exponential
phase (data not shown).
In S. coelicolor, in addition to the need for
malonyl-CoA synthesis during vegetative growth, there is also a
requirement for this metabolite during transition and stationary phase.
At least two of the secondary metabolites produced by S. coelicolor, undecylprodigiosin and actinorhodin, are synthesized
during these growth phases and require malonyl-CoA for their synthesis.
If the essential ACCase characterized in this work is the
only enzyme capable of synthesizing malonyl-CoA, then it will also be
required during the production of these two antibiotics. In agreement
with this hypothesis fatty acid-supplemented cultures of the M94
conditional mutant, for which ACCase activity was barely
detectable, were unable to produce actinorhodin or undecylprodigiosin.
Based on the proposed composition of the enzyme complex and on the
transcriptional studies reported here, we suggest that the low level of
expression of accA2 and accBE that occurs during
stationary phase provides enough of the
and
components to
produce sufficient ACCase for secondary metabolism. If this
assumption is correct, the biosynthesis of polyketide antibiotics in
S. coelicolor should be improved by overproduction of
the ACCase components during stationary phase.
While the burst of accA1 transcription during transition
phase could provide a new biotinylated component for the
ACCase complex during stationary phase, mutation of
accA1 did not change the level of acetyl-CoA carboxylase or
PCCase throughout growth. Moreover, this mutation has no
deleterious effect on antibiotic production in S. coelicolor (36); consequently, the physiological role of AccA1 remains uncertain (although its location in cosmid AH10 [35] adjacent to a new putative PKS cluster might
suggest a role in the synthesis of a hitherto unknown polyketide).
For instance, a gene, jadJ, whose deduced amino acid
sequence showed a high degree of similarity with that of AccA1 (70%
identity) has been recently located in the gene cluster associated with
jadomycin B biosynthesis in Streptomyces venezuelae
(14). Disruption of jadJ had no effect on
growth or morphology of the organism, implying that the product of this
gene was not essential for fatty acid biosynthesis, but the mutant did
show a reduced production of jadomycin.
Recently, a two-component acetyl-CoA carboxylase was partially
characterized in Myxococcus xanthus (23). The
biotinylated component of this enzyme complex, AccA, also contains the
BC domain, resembling the organization of the biotinylated
component of the ACCases. Interestingly, AccA of M. xanthus was not essential for the viability of this microorganism
and mutants in this subunit only affected the intracellular levels of
acetyl-CoA carboxylase but not of the PCCase activity,
showing a sharp difference with our findings.
 |
ACKNOWLEDGMENTS |
We are grateful to R. Cabrera for cloning the 5' end of
accB and E. Takano for assistance with the S1 mapping
experiments. We are also grateful to Diego de Mendoza and E. Ceccarelli
for helpful discussions and useful comments on the manuscript.
This work was supported by the National Research Council of
Argentina (CONICET), ANPCyT grants N:01-00078-01686 and
01-06622, the Universidad Nacional de Rosario, and the John
Innes Foundation.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: IBR,
Departamento de Microbiología, Facultad de Ciencias
Bioquímicas y Farmacéuticas, Universidad Nacional de
Rosario, Suipacha 531, 2000-Rosario, Argentina. Phone: 54-341-4350661. Fax: 54-341-4390465. E-mail: gramajo{at}infovia.com.ar.
 |
REFERENCES |
| 1.
|
Barker, D., and A. Campbell.
1981.
Genetic and biochemical characterization of the birA gene and its product: evidence for a direct role of biotin holoenzyme synthetase in repression of the biotin operon in Escherichia coli.
J. Mol. Biol.
146:89-102.
|
| 2.
|
Behal, V.,
V. Jechova,
Z. Vanek, and Z. Hostalek.
1977.
Alternative pathways of malonyl-CoA formation in Streptomyces aureofaciens.
Phytochemistry
16:347-350[CrossRef].
|
| 3.
|
Bierman, M.,
R. Logan,
K. O'Brien,
E. T. Seno,
R. N. Rao, and B. E. Schoner.
1992.
Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli and Streptomyces spp.
Gene
116:43-49[CrossRef][Medline].
|
| 4.
|
Bloch, K., and D. Vance.
1977.
Control mechanisms in the synthesis of saturated fatty acids.
Annu. Rev. Biochem.
46:263-298[CrossRef][Medline].
|
| 5.
|
Bradford, M.
1976.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem.
72:248-254[CrossRef][Medline].
|
| 6.
|
Bramwell, H.,
H. G. Nimmo,
I. S. Hunter, and J. R. Coggins.
1993.
Phosphoenolpyruvate carboxylase from Streptomyces coelicolor A3(2); purification of enzyme, cloning of the ppc gene and overexpression of the protein in a streptomycete.
Biochem. J.
293:131-136.
|
| 7.
|
Bramwell, H.,
I. S. Hunter,
J. R. Coggins, and H. G. Nimmo.
1996.
Propionyl-CoA carboxylase from Streptomyces coelicolor A3(2): cloning of the gene encoding the biotin-containing sub-unit.
Microbiology
142:649-655[Abstract/Free Full Text].
|
| 8.
|
Brownsey, R. W.,
R. Zhande, and A. N. Boone.
1997.
Isoforms of acetyl-CoA carboxylase: structures, regulatory properties and metabolic functions.
Biochem. Soc. Trans.
25:1232-1238[Medline].
|
| 9.
|
Buttner, M. J.,
K. F. Chater, and M. J. Bibb.
1990.
Cloning, disruption, and transcriptional analysis of three RNA polymerase sigma factor genes of Streptomyces coelicolor A3(2).
J. Bacteriol.
172:3367-3378[Abstract/Free Full Text].
|
| 10.
|
Cole, S. T.,
R. Brosch,
J. Parkhill,
T. Garnier,
C. Churcher,
D. Harris, et al.
1998.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
Nature
393:537-544[CrossRef][Medline].
|
| 11.
|
Donadio, S.,
M. Staver, and L. Katz.
1996.
Erythromycin production in Saccharopolyspora erythraea does not require a functional propionyl-CoA carboxylase.
Mol. Microbiol.
19:977-984[CrossRef][Medline].
|
| 12.
|
Erfle, J. D.
1973.
Acetyl-CoA and propionyl-CoA carboxylation by Mycobacterium phlei.
Biochim. Biophys. Acta
316:143-155[Medline].
|
| 13.
|
Gramajo, H. C.,
E. Takano, and M. J. Bibb.
1993.
Studies of the growth-phase dependent expression of genes for actinorhodin production in Streptomyces coelicolor.
Mol. Microbiol.
7:837-845[CrossRef][Medline].
|
| 14.
|
Han, L.,
K. Yang,
K. Kulowski,
E. Wendt-Pienkowski,
C. R. Hutchinson, and L. C. Vining.
1999.
An acyl-coenzyme A carboxylase encoding gene associated with jadomycin biosynthesis in Streptomyces venezuelae ISP5230.
Microbiology
146:903-910[Abstract/Free Full Text].
|
| 15.
|
Hanahan, D.
1983.
Studies of transformation of Escherichia coli with plasmids.
J. Mol. Biol.
166:557-580[Medline].
|
| 16.
|
Harwood, J. L.
1988.
Fatty acid metabolism.
Annu. Rev. Plant. Physiol. Plant Mol. Biol.
39:101-138[CrossRef].
|
| 17.
|
Hasselacher, M.,
A. S. Ivessa,
F. Paltauf, and S. D. Kohlwein.
1993.
Acetyl-CoA carboxylase from yeast is an essential enzyme and is regulated by factors that control phospholipid metabolism.
J. Biol. Chem.
268:10946-10952[Abstract/Free Full Text].
|
| 18.
|
Henrikson, K. P., and S. H. G. Allen.
1979.
Purification and sub-unit structure of propionyl coenzyme A carboxylase of Mycobacterium smegmatis.
J. Biol. Chem.
254:5888-5891[Abstract/Free Full Text].
|
| 19.
|
Hopwood, D. A., and D. H. Sherman.
1990.
Molecular genetics of polyketides and its comparison to fatty acid biosynthesis.
Annu. Rev. Genet.
24:37-66[CrossRef][Medline].
|
| 20.
|
Huanaiti, A. R., and P. E. Kolattukudy.
1982.
Isolation and characterization of an acyl-coenzyme A carboxylase from an erythromycin-producing Streptomyces erythraeus.
Arch. Biochem. Biophys.
216:362-371[CrossRef][Medline].
|
| 21.
|
Janssen, G. R., and M. J. Bibb.
1993.
Derivatives of pUC18 that have bglII sites flanking a modified multiple cloning site and that retain the ability to identify recombinant clones by visual screening of Escherichia coli colonies.
Gene
124:133-134[CrossRef][Medline].
|
| 22.
|
Kieser, T.,
M. J. Bibb,
M. J. Buttner,
K. F. Chater, and D. A. Hopwood.
2000.
Practical Streptomyces genetics.
The John Innes Foundation, Norwich, United Kingdom.
|
| 23.
|
Kimura, Y.,
R. Miyake,
Y. Tokumasu, and M. Sato.
2000.
Molecular cloning and characterization of two genes for the biotin carboxylase and carboxyltransferase sub-units of acetyl-coenzyme A carboxylase in Myxococcus xanthus.
J. Bacteriol.
182:5462-5469[Abstract/Free Full Text].
|
| 24.
|
King, M. T., and P. D. Reiss.
1985.
Separation and measurement of short-chain coenzyme-A compounds in rat liver by reverse-phase high-performance liquid chromatography.
Anal. Biochem.
146:173-179[CrossRef][Medline].
|
| 25.
|
Laakel, M.,
A. Lebrihi,
S. Khaoua,
F. Schneider,
G. Lefebvre, and P. Germain.
1994.
A link between primary and secondary metabolism: malonyl-CoA formation in Streptomyces ambofaciens growing on ammonium ions or valine.
Microbiology
140:1451-1456[Abstract/Free Full Text].
|
| 26.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[CrossRef][Medline].
|
| 27.
|
Li, S. J., and J. E. Cronan, Jr.
1992.
The gene encoding the biotin carboxylase subunit of Escherichia coli acetyl-CoA carboxylase.
J. Biol. Chem.
267:855-863[Abstract/Free Full Text].
|
| 28.
|
Li, S. J., and J. E. Cronan, Jr.
1993.
Growth-rate regulation of Escherichia coli acetyl coenzyme A carboxylase, which catalyzes the first committed step in lipid biosynthesis.
J. Bacteriol.
175:332-340[Abstract/Free Full Text].
|
| 29.
|
MacNiel, D. J.,
J. L. Occi,
K. M. Gewain,
T. MacNeil,
P. H. Gibbons,
C. L. Rudy, and S. J. Danis.
1992.
Complex organisation of the Streptomyces avermitilis genes encoding the avermectin polyketide synthase.
Gene
115:119-125[CrossRef][Medline].
|
| 30.
|
Murakami, T.,
T. Holt, and C. J. Thompson.
1989.
Thiostrepton-induced gene expression in Streptomyces lividans.
J. Bacteriol.
171:1459-1466[Abstract/Free Full Text].
|
| 31.
|
Paget, M. S.,
E. Leibovitz, and M. J. Buttner.
1999.
A putative two-component signal transduction system regulates sigmaE, a sigma factor required for normal cell wall integrity in Streptomyces coelicolor A3(2).
Mol. Microbiol.
3:97-107.
|
| 32.
|
Perez, C. A.,
P. Marini, and D. de Mendoza.
1998.
Effects on Bacillus subtilis of conditional expression of the accBC operon encoding sub-units of acetyl coenzyme A carboxylase, the first enzyme of fatty acid synthesis.
Microbiology
144:895-903[Abstract/Free Full Text].
|
| 33.
|
Pizer, E. S.,
C. Jackisoh,
F. D. Wood,
G. R. Paternack,
N. E. Davidson, and F. P. Kuhajda.
1996.
Inhibition of fatty acid synthesis induces programmed cell death in human breast cancer cells.
Cancer Res.
56:2745-2747[Abstract/Free Full Text].
|
| 34.
|
Polakis, S.,
R. Guchhait, and M. Lane.
1972.
On the possible involvement of a carbonyl phosphate group intermediate in the adenosine triphosphate-dependent carboxylation of biotin.
J. Biol. Chem.
247:1335-1337[Abstract/Free Full Text].
|
| 35.
|
Redenbach, M.,
M. Kieser,
D. Denapaite,
A. Eichner,
J. Cullum,
H. Kinashi, and D. Hopwood.
1996.
A set of ordered cosmids and a detailed genetic and physical map for the 8 Mb Streptomyces coelicolor A3(2).
Mol. Microbiol.
21:77-95[CrossRef][Medline].
|
| 36.
|
Rodríguez, E., and H. Gramajo.
1999.
Genetic and biochemical characterization of the and components of a propionyl-CoA carboxylase complex of Streptomyces coelicolor A3(2).
Microbiology
145:3109-3119[Abstract/Free Full Text].
|
| 37.
|
Saggerson, E. D.,
I. Ghadiminejad, and M. Awan.
1992.
Regulation of mitochondrial carnitine palmitoyl transferases from liver and extrahepatic tissues.
Adv. Enzyme Regul.
32:285-306[CrossRef][Medline].
|
| 38.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 39.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 40.
|
Shujman, G.,
R. Grau,
H. Gramajo,
L. Ornella, and D. de Mendoza.
1998.
De novo fatty acid synthesis is required for establishment of cell type specific gene transcription during sporulation in B. subtilis.
Mol. Microbiol.
29:1215-1224[CrossRef][Medline].
|
| 41.
|
Strauch, E.,
E. Takano,
H. A. Baylis, and M. J. Bibb.
1991.
The stringent response in Streptomyces coelicolor A(3)2.
Mol. Microbiol.
5:289-298[Medline].
|
| 42.
|
Strohl, W. R.
1992.
Compilation and analysis of DNA sequences associated with apparent streptomycete promoters.
Nucleic Acids Res.
20:961-974[Abstract/Free Full Text].
|
| 43.
|
Studier, F. W., and B. A. Moffatt.
1986.
Use of the bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes.
J. Mol. Biol.
189:113-130[CrossRef][Medline].
|
| 44.
|
Sun, J.,
G. H. Kelemen,
M. Fernandez-Abalos, and M. J. Bibb.
1999.
Green fluorescent protein as a reporter for spatial and temporal gene expression in Streptomyces coelicolor A3(2).
Microbiology
145:2221-2227[Abstract/Free Full Text].
|
| 45.
|
Toh, H.,
H. Kondo, and T. Tanabe.
1993.
Molecular evolution of biotin-dependent carboxylases.
Eur. J. Biochem.
215:687-696[Medline].
|
| 46.
|
Westrich, L.,
S. Domann,
B. Faust,
D. Bedford,
D. A. Hopwood, and A. Bechthold.
1999.
Cloning and characterization of a gene cluster from Streptomyces cyanogenus S136 probably involved in landomycin biosynthesis.
FEMS Microbiol. Lett.
170:381-387[CrossRef][Medline].
|
Applied and Environmental Microbiology, September 2001, p. 4166-4176, Vol. 67, No. 9
0099-2240/01/$04.00+0 DOI: 10.1128/AEM.67.9.4166-4176.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ryu, Y.-G., Butler, M. J., Chater, K. F., Lee, K. J.
(2006). Engineering of Primary Carbohydrate Metabolism for Increased Production of Actinorhodin in Streptomyces coelicolor. Appl. Environ. Microbiol.
72: 7132-7139
[Abstract]
[Full Text]
-
Arabolaza, A., Banchio, C., Gramajo, H.
(2006). Transcriptional regulation of the macs1-fadD1 operon encoding two acyl-CoA synthases involved in the physiological differentiation of Streptomyces coelicolor. Microbiology
152: 1427-1439
[Abstract]
[Full Text]
-
Lin, T.-W., Melgar, M. M., Kurth, D., Swamidass, S. J., Purdon, J., Tseng, T., Gago, G., Baldi, P., Gramajo, H., Tsai, S.-C.
(2006). Structure-based inhibitor design of AccD5, an essential acyl-CoA carboxylase carboxyltransferase domain of Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. USA
103: 3072-3077
[Abstract]
[Full Text]
-
Oh, T.-J., Daniel, J., Kim, H.-J., Sirakova, T. D., Kolattukudy, P. E.
(2006). Identification and Characterization of Rv3281 as a Novel Subunit of a Biotin-dependent Acyl-CoA Carboxylase in Mycobacterium tuberculosis H37Rv. J. Biol. Chem.
281: 3899-3908
[Abstract]
[Full Text]
-
Gago, G., Kurth, D., Diacovich, L., Tsai, S.-C., Gramajo, H.
(2006). Biochemical and Structural Characterization of an Essential Acyl Coenzyme A Carboxylase from Mycobacterium tuberculosis. J. Bacteriol.
188: 477-486
[Abstract]
[Full Text]
-
Dunn, M. F., Araiza, G., Mora, J.
(2004). Biochemical characterization of a Rhizobium etli monovalent cation-stimulated acyl-coenzyme A carboxylase with a high substrate specificity constant for propionyl-coenzyme A. Microbiology
150: 399-406
[Abstract]
[Full Text]
-
Chuakrut, S., Arai, H., Ishii, M., Igarashi, Y.
(2003). Characterization of a Bifunctional Archaeal Acyl Coenzyme A Carboxylase. J. Bacteriol.
185: 938-947
[Abstract]
[Full Text]
-
Banchio, C., Gramajo, H.
(2002). A Stationary-Phase Acyl-Coenzyme A Synthetase of Streptomyces coelicolor A3(2) Is Necessary for the Normal Onset of Antibiotic Production. Appl. Environ. Microbiol.
68: 4240-4246
[Abstract]
[Full Text]
-
Diacovich, L., Peiru, S., Kurth, D., Rodriguez, E., Podesta, F., Khosla, C., Gramajo, H.
(2002). Kinetic and Structural Analysis of a New Group of Acyl-CoA Carboxylases Found in Streptomyces coelicolor A3(2). J. Biol. Chem.
277: 31228-31236
[Abstract]
[Full Text]