Previous Article | Next Article 
Applied and Environmental Microbiology, January 2002, p. 53-58, Vol. 68, No. 1
0099-2240/02/$04.00+0 DOI: 10.1128/AEM.68.1.53-58.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Improvement of Cellulolytic Properties of Clostridium cellulolyticum by Metabolic Engineering
Emmanuel Guedon,
Mickaël Desvaux, and Henri Petitdemange*
Laboratoire de Biochimie des Bactéries Gram Positif, Faculté des Sciences, Université Henri Poincaré, 54506 Vand
uvre-lès-Nancy Cedex, France
Received 26 July 2001/
Accepted 2 October 2001

ABSTRACT
Cellulolytic clostridia have evolved to catabolize lignocellulosic
materials at a seasonal biorhythm, so their biotechnological
exploitation requires genetic improvements. As high carbon flux
leads to pyruvate accumulation, which is responsible for the
cessation of growth of
Clostridium cellulolyticum, this accumulation
is decreased by heterologous expression of pyruvate decarboxylase
and alcohol dehydrogenase from
Zymomonas mobilis. In comparison
with that of the wild strain, growth of the recombinant strain
at the same specific rate but for 145 h instead of 80 h led
to a 150% increase in cellulose consumption and a 180% increase
in cell dry weight. The fermentation pattern was shifted significantly:
lactate production decreased by 48%, whereas the concentrations
of acetate and ethanol increased by 93 and 53%, respectively.
This study demonstrates that the fermentation of cellulose,
the most abundant and renewable polymer on earth, can be greatly
improved by using genetically engineered
C. cellulolyticum.

INTRODUCTION
Cellulolytic microorganisms play an important role in the biosphere
by recycling cellulose, and cellulolytic clostridia are of cardinal
importance in anaerobic environments rich in plant materials
(
24). They are also important in some industrial fermentation
processes, particularly in anaerobic digesters fed with municipal
solid waste or agricultural raw materials containing a high
percentage of lignocellulosic compounds (
5). The most widely
used methods of waste matter treatment are dumping and incineration,
both of which contribute to the greenhouse gas effect. As an
alternative, anaerobic conversion into methane by bacterial
consortia is one of the most promising methods (
12). The production
of methane requires a trophic chain of at least three interacting
metabolic groups of strictly anaerobic microbes (
9): (i) the
fermentative group decomposes cellulose and other complex molecules
into volatile carboxylic acids (mainly acetate), CO
2, and H
2;
(ii) syntrophic bacteria further degrade the alcohols and fatty
acids into acetate, H
2, and CO
2; and (iii) acetate, H
2, and
CO
2 finally serve as substrates for the methanoarchaea. At present,
the process relies on naturally occurring bacteria, but the
efficiency conceivably could be improved by using better strains,
particularly for cellulolysis, the limiting step of the process.
Indeed, cellulolytic clostridia show analogous growth properties:
they use small quantities of carbohydrates due to early inhibition
of metabolism and growth (
10).
Recent metabolic investigations with Clostridium cellulolyticum ATCC 35319, the best-understood cellulolytic mesophilic bacterium, indicated better control of carbohydrate catabolism on mineral salt media than on complex media (13, 14, 16, 24, 26). Indeed, natural ecosystems, where cellulolytic microbes proliferate, rarely contain all nutrients in saturating quantities, and complex media with high concentrations of substrates are unfavorable to C. cellulolyticum, which is unable to deal with a surfeit of substrates. Under these conditions, the nutrients or products of its metabolism accumulate intracellularly to toxic levels, such as has been demonstrated for NADH and pyruvate (1316). It is reasonable to suppose that during the course of evolution, these bacteria have evolved to optimize the catabolism of few available carbon sources over a time scale of months. In natural lignocellulosic compounds, cell walls can be regarded as a giant macromolecular composite of cellulose fibers embedded in a covalently joined matrix of pectin, lignin, and hemicellulose, which may hinder cellulolysis and hence reduce carbon availability. Thus, there is no need for cells to regulate the entry of high carbon flow. When C. cellulolyticum was grown on easily metabolizable substrates, such as cellobiose (a disaccharide of two ß-1,4 linked d-glucose units) or even pure cellulose, high carbon flux was attained, leading to pyruvate excretion (6, 7, 13, 14, 16). The pyruvate overflow suggested that the carbon flux through glycolysis was higher than the rate of processing of pyruvate-ferredoxin oxidoreductase (PFO) and lactate dehydrogenase (LDH) (the acetyl coenzyme A and the lactate branches, respectively) (Fig. 1). As a result, such catabolic overflow leads to an accumulation of intracellular inhibitory compounds that are directly responsible for the early cessation of growth of C. cellulolyticum (7, 13, 14).
In view of these considerations, it can be argued that
C. cellulolyticum is not adapted to use a carbon source in excess and that the
biotechnological exploitation of this microorganism requires
genetic improvements. Since the efficiency of cellulose hydrolysis
correlates with the population of cellulolytic clostridia, we
focus on the reduction of the accumulation of pyruvate identified
previously as one of the inhibitory compounds of bacterial growth
(
14). Using a metabolic engineering strategy, we demonstrate
in this report that the removal of pyruvate accumulation can
be successfully achieved and, as a consequence, the fermentation
of cellulose by
C. cellulolyticum can be improved significantly.
Such an engineered microorganism offers potential biotechnological
applications, one of them being the improvement of biogas production.

MATERIALS AND METHODS
Bacterial strains, plasmids, and culture conditions.
Table
1 lists all the bacterial strains and plasmids used in
this study.
Escherichia coli XL1Blue was used for plasmid construction,
and
C.
cellulolyticum strain H10 (ATCC 35319) (
27) was used
as the recipient strain. Recombinant
E. coli strains were grown
at 37°C in Luria-Bertani medium (
28) supplemented with ampicillin
(100 mg per liter).
C. cellulolyticum was grown in a synthetic
medium with cellulose as the sole carbon and energy source (
7,
14) and supplemented with erythromycin (20 mg per liter) only
for the recombinant strains.
Vector construction.
The expression shuttle vector (pMG8) harboring the prototype
operon (pyruvate decarboxylase [PDC]-alcohol dehydrogenase [ADH])
was constructed by cloning into plasmid pMTL500F (
25) (expression
shuttle vector) two products obtained by PCR-mediated overlap
extension (
18) by using plasmid pLOI295 (carrying the
pdc and
adhII genes from
Zymomonas mobilis CP4; GenBank accession no.
M15393 and
M15394, respectively) (
20) as the template. The
pdc gene was amplified by using primers GC
TCTAGAA
GGAGGTTAAGCAATGAAGTTATACTGCTGC
(forward) and TTT
AGATCTCTAAGAGGAGCTTGTTAACAG (reverse) so that
the 1,731-bp product contained a 5'
XbaI site (underlining in
the forward primer) followed by a ribosome binding site (RBS)
(double underlining) from the
C.
cellulolyticum scaffolding
gene (
cipC; GenBank accession no.
U40345) located six nucleotides
upstream from the initiation codon and a 3'
BglII site (underlining
in the reverse primer). The
adhII gene was amplified by using
primers TTT
AGATCTA
GGAGGATAGCTATGGCTTCTTCAACTT (forward) and
AAT
CTGCAGTGACGGTAGGCTTAATAGCCTGT (reverse) so that the 1,327-bp
amplifica contained a 5'
BglII site (underlining in the forward
primer) followed by an RBS (double underlining) from the
C.
cellulolyticum cipC gene located six nucleotides upstream from
the initiation codon and a 3'
PstI site (underlining in the
reverse primer). After double restriction digestion with
XbaI
and
BglII and with
BglII and
PstI, the two amplifica were successively
ligated into similarly digested vector pMTL500F, resulting in
plasmid pMG8 (9.76 kb). The
Z.
mobilis pdc and
adhII genes were
cloned under the control of a strong constitutive
Clostridium pasteurianum ferredoxin promoter (
11) carried by expression
shuttle vector pMTL500F (
25).
Transformation of C. cellulolyticum.
Transformation of C. cellulolyticum was carried out as recently published (21) with some modifications. In brief, cells were grown in a synthetic medium (40 ml) until mid-log phase, washed with ice-cold electrotransformation buffer (270 mM sucrose, 5 mM K2HPO4 [pH 6.5]), and resuspended in 1.5 ml of the same buffer. A 0.5-ml sample of the cell suspension was transferred to a 0.4-cm electroporation cuvette containing 5 µl (0.5 to 1.0 µg) of DNA methylated with MspI methylase (1 U per µg, 37°C, 3 h). After a pulse with a Bio-Rad gene pulser apparatus (2.0 kV, 1,000
, 25 µF), the cell suspension was immediately incubated anaerobically in 5 ml of prewarmed (34°C) synthetic medium for 6 h. Then, the cells were spread on selective plates (synthetic medium supplemented with 15 g of agar per liter and 20 mg of erythromycin per liter) and incubated anaerobically for 3 to 5 days at 34°C.
Bioreactor experiments.
Bacteria were cultured aseptically in a 2-liter bioreactor (LSL Biolafitte, St. Germain en Laye, France) with a 1.5-liter working volume. The temperature was maintained at 34°C, and the pH was controlled at 7.2 by the automatic addition of 3 M NaOH. Agitation was kept constant at 50 rpm. The inoculum, from an exponentially growing culture, was 10% by volume. The cellulose bioreactor was connected to a gasometer filled with a saturated NaCl-water solution and acidified to pH 1.0 with H2SO4 to prevent gas dissolution as described previously (7). All tubing was made of Viton to preserve the anoxic conditions of the cell culture, and anaerobiosis was controlled in the presence of resazurin as described previously (16).
Analytical procedures.
Biomass was estimated by bacterial protein measurement by use of the Bradford dye method (4) as modified by Desvaux et al. (7). The cellulose concentration was determined as described by Huang and Forsberg (19). Residual cellulose was washed with acetic acid-nitric acid reagent and water to achieve the removal of noncellulosic materials as described by Updegraff (30). Cellulose was then quantified by use of the phenol-sulfuric acid method (8) with glucose as the standard. Anhydroglucose equivalents were used for the calculation.
Culture supernatants (10,000 x g, 15 min, 4°C) were stored at 80°C until they were analyzed. Acetate, ethanol, and lactate levels were determined by using the appropriate enzyme kits (Boehringer Mannheim, Meylan, France). Extracellular pyruvate was assayed enzymatically by fluorimetric detection of NADH as previously described (14). YATP values (energetic yield of biomass) were calculated as previously established (7).
Preparation of cell extracts and enzyme assays.
Cell extracts were obtained as described previously (6). PDC was assayed essentially as described by Hoppner and Doelle (17) by monitoring of the pyruvate-dependent reduction of NAD+ with ADH as a coupling enzyme. ADH activity was determined by monitoring of NADH-dependent acetaldehyde reduction at 340 nm as described previously (23). One unit of enzyme activity represents the conversion of 1 µmol of substrate per min into specific products.
Western blot analysis.
The protein extracts prepared for the enzyme activity assays were used in a Western blot analysis performed by standard procedures (28). PDC was probed with a goat antiserum directed against Z. mobilis PDC protein, and ADH was detected with a rabbit antiserum raised against Z. mobilis ADH II protein (1). Binding of the primary antibody was carried out by incubating the preparation with a peroxidase-conjugated secondary immunoglobulin G antibody and detected by using an enhanced chemiluminescence detection system (Amersham Pharmacia Biotech). Relative quantifications of blot signals were carried out by using the Gel Doc system (Bio-Rad).

RESULTS AND DISCUSSION
Construction of recombinant strains of C. cellulolyticum.
To achieve the cessation of excessive pyruvate production, metabolic
engineering constitutes the most promising and efficient approach,
particularly through the expression of a new heterologous pathway
branched directly on the target (i.e., pyruvate) (Fig.
1). Hence,
we chose to express in
C. cellulolyticum the
Z. mobilis (strain
CP4) genes coding for active PDC and ADH through an artificial
operon (
20). Although genetic transfer in clostridia is largely
recognized as a difficult process, this strategy was clearly
realistic, since the propagation of replicons was recently achieved
in
C. cellulolyticum(
21).
During the construction of the artificial operon as described in Materials and Methods, we introduced a new RBS upstream of the pdc and adh genes and based on that of the cipC gene (GenBank accession no. U40345), encoding the scaffolding protein of C. cellulolyticum. The resulting expression vector (pMG8) (Fig. 2) was introduced into C. cellulolyticum ATCC 35319 by electrotransformation, and tranformants appeared after 3 to 4 days on agar synthetic medium supplemented with erythromycin.
Characterization of recombinant strains of C. cellulolyticum.
Enzymatic analyses of strain CC-pMG8 grown in a synthetic medium
with cellulose as the sole carbon and energy source demonstrated
the presence of PDC (0.58 U/mg) and ADH II (0.77 U/mg) activities.
PDC activity was undetectable in the parent strain and in the
control strain, CC-500F, which contained the shuttle vector
alone, whereas 0.45 U of endogenous ADH/mg was found in the
parent and control strains. The heterologous expression of PDC
and ADH II was further confirmed by Western blot analysis (data
not shown).
E. coli transformed with pLOI295 was used as a positive
control, whereas
E. coli(pUC18) and CC-500F were used as negative
controls. In the protein extracts obtained from CC-pMG8, analyses
revealed two bands at 60 and 40 kDa, corresponding to the molecular
masses expected for PDC and ADH II, respectively. No immunologically
cross-reacting materials were detected in extracts from negative
controls. Despite the presence of one rarely used codon in the
pdc gene in
C. cellulolyticum (<0.01%), i.e., the CGG arginine
codon (frequencies of codon utilization are available at
http:www.kazuka.or.jp/codon),
PDC and ADH II were efficiently expressed in CC-pMG8 cells,
as generally found with foreign genes cloned in
Clostridium species (
29) and in contrast to clostridial proteins poorly
produced in
E. coli (
31). The results were confirmed by the
quantification of Western blot signals, which revealed only
3- and 1.5-fold better production of PDC and ADH II in
E. coli than in
C. cellulolyticum.
Growth and fermentation pattern of C. cellulolyticum strain CC-pMG8.
Recombinant strain CC-pMG8 was capable of growth in cellulose-containing synthetic medium, with a specific growth rate (0.049 h1) comparable to that of strain CC-500F and to that of the parent strain (0.044 h1); however, the growth period was prolonged: 145 h for the recombinant strain instead of 80 h for the parent strain (Fig. 3). The result was an increased biomass of CC-pMG8, which reached 1,500 mg per liter, compared to 500 mg per liter for CC-500F. This growth improvement for CC-pMG8 was the direct result of the expression of the pdc-adh operon decreasing pyruvic acid production by 60%, as shown in Fig. 3. These results indicated that the introduction of Z. mobilis PDC and ADH II activities may significantly relieve this overflow and have a great impact on cell growth and on the fermentation pattern (Fig. 3).
In comparison with the characteristics of strain CC-500 F, in
strain CC-pMG8 cell density was increased by 180% and cellulose
consumption was increased by 150% (Fig.
3 and
4). The fermentation
pattern of strain CC-pMG8 was shifted significantly with respect
to that of strain CC-500 F and the parent strain, indicating
a strong influence of PDC and ADH II activities on general carbon
catabolism. Thus, the concentrations of acetate and ethanol
increased by 93 and 53%, respectively, while that of lactate
decreased by 48%. These data show that the partitioning of the
carbon flux at the pyruvate node through the PFO is the dominant
branch, compared to the flux channeled by LDH and PDC, despite
the fact that PFO and PDC have similar
Kms for pyruvate (0.5
and 0.4 mM for PFO and PDC, respectively, compared to 4.5 mM
for LDH) (
14,
20). Hence, the excess pyruvate was redirected
toward ethanol production by the PDC and ADH II activities,
to the detriment of lactate production and intracellular pyruvate
accumulation; nevertheless, the PDC-ADH II pathway cannot process
pyruvate as rapidly as it is formed. The PDC and ADH II activities
also have an effect on partitioning at the acetyl coenzyme A
node, since strain CC-pMG8 produced more acetate than ethanol,
whereas strain CC-500F produced less acetate than ethanol. From
an NAD
+-NADH balance viewpoint, it is speculated that increased
NAD
+ cycling through the new ethanol branch (PDC-ADH) may favor
the acetate pathway (extra ATP-producing pathway) and, in return,
contribute to increasing the biomass. This notion is confirmed
by the
YATP values for both strains (CC-500F and CC-pGM8), for
which no significant difference was found (13.7 g of cells/mol
of ATP and 13.5 g of cells/mol of ATP, respectively), meaning
that the energetic cost of the engineered metabolic pathway
is largely compensated for by the benefit obtained from higher
acetate production.
Figure
4 shows the advantages of strain CC-pMG8 with respect
to strain CC-500 F: (i) the removal of growth inhibition leads
to an increase in the population of cellulolytic bacteria and
hence the efficiency of cellulose hydrolysis, since cellulasic
activities are cell associated via the cellulosome; and (ii)
efficient fermentation of cellulose increases CO
2, H
2, and acetate
production, these compounds being the substrates of the methanoarchaea,
whereas increased production of ethanol will be reduced by degradation
by syntrophic bacteria into acetate, H
2, and CO
2. Hence, strain
CC-pMG8 is well adapted for improving cellulose degradation
and biogas production.
Improvement of strains has traditionally relied on random mutagenesis followed by screening for mutants exhibiting enhanced properties of interest. Now, the opportunity to introduce heterologous genes and regulatory elements distinguishes metabolic engineering from traditional genetic approaches (3, 22). In the present work, the use of a straightforward metabolic engineering strategy consisting of the expression of an artificial operon (PDC-ADH) to eliminate excess intracellular pyruvate led to the conversion of C. cellulolyticum from a weakly to a highly active fermentative bacterium. We can attribute the success of this strategy to previous detailed studies of carbon and electron flux (6, 7, 1315) that revealed the catabolic behavior of C. cellulolyticum with cellulosic substrates. Cellulolytic microorganisms are regarded as having one of the most promising biotechnological potentials, yet to our knowledge, this is the first report of such an engineered cellulolytic microorganism (both procarya and eucarya). Thus, our laboratory has focused on the genetic engineering of C. cellulolyticum, which has led to improving the efficiency of cellulose fermentation into acetate, CO2, and H2 instead of ethanol.
According to the results reported here, an efficient redirection of glycolytic flux to ethanol requires deletion of the acetate kinase-phosphotransacetylase pathway, which affects the ATP yield and hence the growth rate and the final dry cell weight. Practically, the fermentation of cellulose into acetate, CO2, and H2 has several advantages. (i) The feasibility of producing ethanol from molasses, sugar cane, or grains has been demonstrated, whereas many biotechnological bottlenecks must be solved for ethanol production from lignocellulosic materials. (ii) Over the past decade, the total cost of ethanol production by fermentation (determined principally by the cost of sugar) has dropped from more than $1.00 per liter to
$0.30 to 0.5 0 per liter, with a projected cost of less than $0.25 per liter in the near future (2), so the production of ethanol from lignocellulose is thus becoming less and less competitive. (iii) Methanogenesis is also an important process, and strain CC-pMG8, which has a higher biomass, uses a high level of cellulose (Fig. 4) and provides a safe and economic alternative for eliminating lignocellulosic materials in sewage digesters, anaerobic digesters, and waste streams from paper mills.

ACKNOWLEDGMENTS
We thank E. McRae for correcting the English in the manuscript;
L. O. Ingram, Department of Microbiology and Cell Science, University
of Florida (Gainesville), for providing plasmid pLOI295 and
antibodies raised against
Z. mobilis PDC and ADH II; and N.
Minton, C.A.M.R. (Porton Down, Salisbury, United Kingdom), for
providing plasmid pMTL500F.
This project was funded by the Commission of European Communities FAIR program (contract 95-0191 [DG 12 SSMA]) and the French Agency for the Environment and Energy Resources (ADEME, program AGRICE, no. 97.01.041).

FOOTNOTES
* Corresponding author. Mailing address: Laboratoire de Biochimie des Bactéries Gram Positif, Domaine Scientifique Victor Grignard, Université Henri Poincaré, Faculté des Sciences, BP 239, 54506 Vand

uvre-lès-Nancy Cedex, France. Phone: 33 3 83 91 20 53. Fax: 33 3 83 91 25 50. E-mail:
hpetitde{at}lcb.uhp-nancy.fr.

Present address: Department of Microbiology, Cornell University, Ithaca, NY 14853-8101. 

REFERENCES
1 - Aldrich, H. C., L. McDowell, M. F. Barbosa, L. P. Yomano, R. K. Scopes, and L. O. Ingram. 1992. Immunocytochemical localization of glycolytic and fermentative enzymes in Zymomonas mobilis. J. Bacteriol. 174:45044508.[Abstract/Free Full Text]
2 - Aristidou, A., and M. Penttilä. 2000. Metabolic engineering applications to renewable resource utilization. Curr. Opin. Biotechnol. 11:187198.[CrossRef][Medline]
3 - Bailey, J. E. 1991. Toward a science of metabolic engineering. Science 252:16681675.[Abstract/Free Full Text]
4 - Bradford, M. M. 1976. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principe of protein-dye binding. Anal. Biochem. 72:248254.[CrossRef][Medline]
5 - Cailliez, C., L. Benoit, E. Gelhaye, H. Petitdemange, and G. Raval. 1993. Solubilization of cellulose by mesophilic cellulolytic clostridia isolated from a municipal solid-waste digester. Bioresource Technol. 43:7783.[CrossRef]
6 - Desvaux, M., E. Guedon, and H. Petitdemange. 2001. Carbon flux distribution and kinetics of cellulose fermentation in steady-state continuous cultures of Clostridium cellulolyticum on a chemically defined medium. J. Bacteriol. 183:119130.[Abstract/Free Full Text]
7 - Desvaux, M., E. Guedon, and H. Petitdemange. 2000. Cellulose catabolism by Clostridium cellulolyticum growing in batch culture on defined medium. Appl. Environ. Microbiol. 66:24612470.[Abstract/Free Full Text]
8 - Dubois, M., K. Gilles, J. K. Hamilton, P. A. Rebers, and F. Smith. 1956. Colorimetric method for determination of sugars and related substances. Anal. Chem. 28:350356.[CrossRef]
9 - Ferry, J. G. 1997. Methane: small molecule, big impact. Science 278:14131414.[Abstract/Free Full Text]
10 - Giallo, J., C. Gaudin, J. P. Bélaïch, E. Petitdemange, and F. Caillet-Mangin. 1983. Metabolism of glucose and cellobiose by cellulolytic mesophilic Clostridium sp. strain H10. Appl. Environ. Microbiol. 45:843849.[Abstract/Free Full Text]
11 - Graves, M. C., and J. C. Rabinowitz. 1986. In vivo and in vitro transcription of the Clostridium pasteurianum ferredoxin gene. Evidence for "extended" promoter elements in gram-positive organisms. J. Biol. Chem. 261:1140911415.[Abstract/Free Full Text]
12 - Griffin, M. E., K. D. McMahon, R. I. Mackie, and L. Raskin. 1998. Methanogenic population dynamics during start-up of anaerobic digesters treating municipal solid waste and biosolids. Biotechnol. Bioeng. 57:342355.[CrossRef][Medline]
13 - Guedon, E., M. Desvaux, and H. Petitdemange. 2000. Kinetic analysis of Clostridium cellulolyticum carbohydrate metabolism: importance of glucose 1-phosphate and glucose 6-phosphate branch points for distribution of carbon fluxes inside and outside cells as revealed by steady-state continuous culture. J. Bacteriol. 182:20102017.[Abstract/Free Full Text]
14 - Guedon, E., M. Desvaux, S. Payot, and H. Petitdemange. 1999. Growth inhibition of Clostridium cellulolyticum by an inefficiently regulated carbon flow. Microbiology 145:18311838.[Abstract/Free Full Text]
15 - Guedon, E., S. Payot, M. Desvaux, and H. Petitdemange. 1999. Carbon and electron flow in Clostridium cellulolyticum grown in chemostat culture on synthetic medium. J. Bacteriol. 181:32623269.[Abstract/Free Full Text]
16 - Guedon, E., S. Payot, M. Desvaux, and H. Petitdemange. 2000. Relationships between cellobiose catabolism, enzyme levels, and metabolic intermediates in Clostridium cellulolyticum grown in a synthetic medium. Biotechnol. Bioeng. 67:327335.[CrossRef][Medline]
17 - Hoppner, T. C., and H. W. Doelle. 1983. Purification and kinetic characteristics of pyruvate decarboxylase and ethanol dehydrogenase from Zymomonas mobilis in relation to ethanol production. Eur. J. Appl. Microbiol. Biotechnol. 17:152157.[CrossRef]
18 - Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease. 1989. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77:6168.[CrossRef][Medline]
19 - Huang, L., and C. W. Forsberg. 1990. Cellulose digestion and cellulase regulation and distribution in Fibrobacter succinogenes subsp. succinogenes S85. Appl. Environ. Microbiol. 56:12211228.[Abstract/Free Full Text]
20 - Ingram, L. O., T. Conway, D. P. Clark, G. W. Sewell, and J. F. Preston. 1987. Genetic engineering of ethanol production in Escherichia coli. Appl. Environ. Microbiol. 53:24202425.[Abstract/Free Full Text]
21 - Jennert, K., C. Tardif, D. Young, and M. Young. 2000. Gene transfer to Clostridium cellulolyticum ATCC 35319. Microbiology 146:30713080.[Abstract/Free Full Text]
22 - Keasling, J. D. 1999. Gene-expression tools for metabolic engineering of bacteria. Trends Biotechnol. 7:452460.
23 - Lamed, R., and J. G. Zeikus. 1980. Ethanol production by thermophilic bacteria: relationship between fermentation product yields of and catabolic enzyme activities in Clostridium thermocellum and Thermoanaerobium brockii. J. Bacteriol. 144:569578.[Abstract/Free Full Text]
24 - Leschine, S. B. 1995. Cellulose degradation in anaerobic environments. Annu. Rev. Microbiol. 49:399426.[CrossRef][Medline]
25 - Oultram, J. D., I. D. Burr, M. J. Elmore, and N. P. Minton. 1993. Cloning and sequence analysis of the genes encoding phosphotransbutyrylase and butyrate kinase from Clostridium acetobutylicum NCIMB 8052. Gene 131:107112.[CrossRef][Medline]
26 - Payot, S., E. Guedon, C. Cailliez, E. Gelhaye, and H. Petitdemange. 1998. Metabolism of cellobiose by Clostridium cellulolyticum growing in continuous culture: evidence for decreased NADH reoxidation as a factor limiting growth. Microbiology 144:375384.
27 - Petitdemange, E., F. Caillet, J. Giallo, and C. Gaudin. 1984. Clostridium cellulolyticum sp. nov., a cellulolytic mesophilic species from decayed grass. Int. J. Syst. Bacteriol. 34:155159.[Abstract/Free Full Text]
28 - Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
29 - Theys, J., S. Nuyts, W. Landuyt, L. Van Mellaert, C. Dillen, M. Böhringer, P. Dürre, P. Lambin, and J. Anné. 1999. Stable Escherichia coli-Clostridium acetobutylicum shuttle vector for secretion of murine tumor necrosis factor alpha. Appl. Environ. Microbiol. 65:42954300.[Abstract/Free Full Text]
30 - Updegraff, D. M. 1969. Semimicro determination of cellulose in biological materials. Anal. Biochem. 32:420424.[CrossRef][Medline]
31 - Zdanovsky, A., and M. Zdanovskaia. 2000. Simple and efficient method for heterologous expression of clostridial proteins. Appl. Environ. Microbiol. 66:31663173.[Abstract/Free Full Text]
Applied and Environmental Microbiology, January 2002, p. 53-58, Vol. 68, No. 1
0099-2240/02/$04.00+0 DOI: 10.1128/AEM.68.1.53-58.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Mingardon, F., Perret, S., Belaich, A., Tardif, C., Belaich, J.-P., Fierobe, H.-P.
(2005). Heterologous Production, Assembly, and Secretion of a Minicellulosome by Clostridium acetobutylicum ATCC 824. Appl. Environ. Microbiol.
71: 1215-1222
[Abstract]
[Full Text]
-
Perret, S., Belaich, A., Fierobe, H.-P., Belaich, J.-P., Tardif, C.
(2004). Towards Designer Cellulosomes in Clostridia: Mannanase Enrichment of the Cellulosomes Produced by Clostridium cellulolyticum. J. Bacteriol.
186: 6544-6552
[Abstract]
[Full Text]
-
Tyurin, M. V., Desai, S. G., Lynd, L. R.
(2004). Electrotransformation of Clostridium thermocellum. Appl. Environ. Microbiol.
70: 883-890
[Abstract]
[Full Text]
-
Fujita, Y., Ito, J., Ueda, M., Fukuda, H., Kondo, A.
(2004). Synergistic Saccharification, and Direct Fermentation to Ethanol, of Amorphous Cellulose by Use of an Engineered Yeast Strain Codisplaying Three Types of Cellulolytic Enzyme. Appl. Environ. Microbiol.
70: 1207-1212
[Abstract]
[Full Text]
-
Maamar, H., de Philip, P., Belaich, J.-P., Tardif, C.
(2003). ISCce1 and ISCce2, Two Novel Insertion Sequences in Clostridium cellulolyticum. J. Bacteriol.
185: 714-725
[Abstract]
[Full Text]