Previous Article | Next Article ![]()
Applied and Environmental Microbiology, February 2002, p. 691-698, Vol. 68, No. 2
0099-2240/02/$04.00+0 DOI: 10.1128/AEM.68.2.691-698.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Enchira Biotechnology Corporation, The Woodlands, Texas 77381
Received 7 June 2001/ Accepted 14 November 2001
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Powerful tools are necessary to sort through the large libraries generated by in vitro recombination to isolate the phenotype of interest. Typically, high-throughput screening methodologies utilizing robotic systems to screen large numbers of samples in a microtiter plate format have been developed (3, 25). One classical method for the selection and isolation of desired mutants that is often overlooked is chemostat selection (8), which can allow for the manifestation of rare mutants within a large population. A chemostat selection can be designed to enrich for a desired phenotype without knowledge of the genotype or underlying molecular mechanisms, and thus it can be used in directed-evolution strategies with samples ranging from well-characterized cloned genes to uncharacterized microorganisms.
In any population, mutations occur spontaneously at a low but measurable frequency. In a chemostat, continuous cell division ensures that new cells are continuously generated at a frequency of 1010 to 1014 cells per day, and thus, even at low spontaneous mutation rates, reasonably large numbers of random mutants can be generated. Any random mutant which is better adapted than the wild type to grow under the selective pressures established within the chemostat will eventually establish itself as the dominant population. The number of mutants in the population can be increased by inoculation into the chemostat of libraries of genetic variants generated by such methods as random mutagenesis or in vitro recombination.
Chemostats have been designed to select for mutants that produce enzymes with increased activity rates (10, 32, 33) or with altered substrate specificity (29). The latter type have been termed gain-of-function mutants. It is a challenge to the researcher to design the chemostat environment such that a mutant with the desired phenotype will have a selective advantage for growing to dominance in the culture. It can be especially difficult to design an environment to select for improvements in the metabolism of minor nutrients such as sulfur, for which the alteration of enzyme rate or specificity do not much influence growth rate.
An example of a sulfur metabolic pathway in need of improvement is the Dsz pathway, which could be of great value in the development of a biocatalytic process for the desulfurization of petroleum streams. Increasingly stringent requirements for sulfur levels in fossil fuels are being mandated by environmental agencies worldwide, and biodesulfurization (BDS) represents a novel process to help refiners achieve goals for low sulfur levels (23). The Dsz pathway employs two monooxygenases (DszC and DszA) and a desulfinase (DszB) to transform organosulfur molecules such as dibenzothiophene (DBT), yielding a partially oxidized hydrocarbon and sulfite. The Dsz pathway was first described for Rhodococcus erythropolis IGTS8 (J. J. Kilbane and B. A. Bielaga, presented at the First International Symposium on the Biological Processing of Coal, Palo Alto, Calif., 1990). The genetics (7, 21) and biochemistry (12) of the IGTS8 BDS pathway are summarized in Fig. 1, with DBT as substrate.
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
Bacteria and plasmids.
The bacterial strains and plasmids used in this work are listed in Table 1. R. erythropolis IGTS8 is a natural soil isolate obtained from an enrichment culture with DBT as a sole sulfur source (Kilbane and Bielaga, presented at the First International Symposium on the Biological Processing of Coal). All of the R. erythropolis strains used in this study are derivatives of IGTS8.
|
(ii) Emulsion plate culture.
For screening of bacterial growth on organosulfur compounds, emulsion agar containing 1% (vol/vol) dodecane was prepared as described previously (2). The sulfur concentration in the oil was 25 mM.
Assays.
BDS activity was determined using two-phase shake flask assays. Assays with BKO53 used frozen cell paste that was thawed in 156 mM phosphate buffer (pH 7.5) with 2% glucose. Assays with other strains were carried out with cells that had been grown in batch culture in BSM1 medium (21). DBT assays were performed as described previously (21) with DBT delivered in hexadecane. DBT specific activity was based on accumulation of 2-(2"-hydroxyphenyl)-benzene sulfinate for BKO53 and on accumulation of hydroxybiphenyl for strains with an active DszB. For assays with other model compounds, the compound was added as a dodecane solution, the assay mixture was incubated at 30°C with shaking, and the oil was recovered by centrifugation for analysis. Total sulfur in the oil phase was determined by combustive UV fluorescence, and substrate and product peaks were analyzed by gas chromatography with sulfur chemiluminescence detection (GC-SCD). In some cases, structures of intermediates were confirmed by gas chromatography-mass spectrometry (GC-MS). A cell-free control was incubated with each model compound to determine the level of volatilization.
Instrumental analysis.
Total sulfur in the oil phase was determined by combustive UV fluorescence with the Antek 9000VS Pyro-fluorescent sulfur analyzer (Antek Instruments, Inc., Houston, Tex.). Analysis of sulfur compounds by GC-SCD was performed as described previously (9). GC-MS was performed as described previously (9).
DNA sequencing.
DNA sequencing was performed by the dideoxy chain termination of Sanger et al. (28) using the DYEnamic ET Terminator cycle sequencing system (Amersham Pharmacia Biotech, Inc.) and an ABI Prism 377 DNA sequencer (PE Applied Biosystems).
Isolation of dszC1 allele.
pEBC1100 (4) is a plasmid containing an artificial dszABCD operon in an Escherichia coli-Rhodococcus shuttle vector. The dszC gene in pEBC1100 is flanked by XbaI and SfiI sites. The mutant dszC1 allele was PCR amplified from plasmid JA102 using the following primers: forward, GTAGTTCTAGATTCGAAACCGATAGGAACATCCGCA (the XbaI site is underlined); reverse, TCGAAGGCCGTCGAGGCCACTACATCAGGAGGTGAAGCCGG (the SfiI site is underlined). The PCR product was restricted with XbaI and SfiI and ligated into pEBC1100 from which the wild-type dszC gene was removed with the same enzymes. The ligation mixture was transformed by electroporation into E. coli DH10B to amplify the plasmids. A pool of plasmids was isolated and transformed by electroporation into R. erythropolis JB55, and selections were done on kanamycin agar plates. The final construct was confirmed by DNA sequencing and designated pJA103.
Codon 261 mutagenesis.
To generate a library of derivative strains randomly mutated at codon 261, a modification of the RACHITT method (4) was used. The dszC gene was made into a single-stranded full-length template as described above, and then a synthetic oligonucleotide (donor fragment) was annealed to the template across codon 261. The same forward primer and anchor oligonucleotides as described by Coco et al. (4) were used. The synthetic donor (Fig. 2)
was designed to be degenerate at codon 261. Several silent mutations were also introduced into the synthetic oligonucleotide. The nucleotide immediately upstream of codon 261, i.e., the third position of codon 260, was changed from C to T in an effort to create a larger mismatch region, open up the first position of codon 261 to more mismatching, and increase the degeneracy of the RACHITT product. A MunI site upstream of codon 261 was eliminated by the introduction of two silent mutations. Chimeric products therefore did not have the MunI site. This allowed for elimination of nonchimeric template read-through sequences by restriction of the primary PCR product with MunI followed by secondary PCR.
|
Nucleotide sequence accession number.
The nucleotide sequence of the dsz genes has been assigned GenBank accession number U08850.
| RESULTS |
|---|
|
|
|---|
|
BKO53 did not transform any of the thiophene model compounds tested. This indicates that none of these compounds are a substrate for DszC. TMT sulfone was synthesized and assayed as described above. Abiotic losses in no-cell controls were high (80%) but not complete, while the sulfone was completely removed from the oil phase by BKO53. This suggests that TMT sulfone is a substrate for DszA. These data suggest that DszA may have a wider substrate specificity than DszC toward this class of compounds.
Di-aryl sulfides and aryl-alkyl sulfides have been shown to be substrates for DszC, although in some cases oxidation stops at the level of sulfoxide, leading to the accumulation of chiral sulfoxides with a high enantiomeric excess (H. L. Holland, A. Kerridge, and P. T. Pienkos, presented at the Gordon Conference on Green Chemistry, 11 to 16 July 1999). In this study we observed that symmetric dialkyl sulfides with chain length lower than C8 appear to be substrates for DszC. Octyl sulfide is itself a poor substrate for DszC and is only partially transformed to the sulfone in a 24-h assay. For symmetric dialkyl sulfides, the substrate range for DszA appears to be narrower than that for DszC. Octyl sulfone accumulated in the 24-h assay and was not further transformed. Octyl sulfone was the only product observed from octyl sulfide and was positively identified by GC-MS. By contrast, hexyl sulfide was largely cleared from the oil, suggesting that hexyl sulfone is a substrate for DszA. Hexyl sulfide also served as a sole sulfur source for growth of strain IGTS8, offering further evidence that the sulfone is a substrate for DszA.
Chemostat selection of gain-of-function mutants.
In order to select for mutants with increased substrate range for the Dsz system, 5-MBT, n-octylthiophene, and octyl sulfide were selected for use in the sulfur-limited chemostat. After 63 days of operation, n-octylthiophene was replaced by TMT because TMT was judged to be more representative of alkyl thiophenes in petroleum products. The chemostat was initially operated with limiting sulfate to maintain a stable population. The organosulfur compounds, supplied in the dodecane oil phase, represented a sulfur source unavailable to the wild-type population. It was hypothesized that mutations in dszC could arise to allow growth with 5-MBT or TMT or that mutations in dszA could arise to allow growth with octyl sulfide. Such a gain-of function mutant would then have access to additional sulfur and would come to dominate the chemostat population. The long hydraulic retention time of 46 h was chosen to allow the emergence of a mutant with even poor activity towards a model compound.
The chemostat was inoculated with R. erythropolis JB55(pEBC388) and operated for 240 days without apparent contamination. This construct was chosen because it contained a single copy of the dszABC operon on a plasmid with dszD present on the chromosome. The products of this operon allowed growth on organosulfur compounds as a sole sulfur source. Initially, model compounds were supplied at 1.0 mM in the oil phase feed, and at this concentration, each individual model compound could support a cell density of 3.5 g (dry weight) of cells per liter (based on empirical studies of sulfur-limited cultures of strain IGTS8). The concentration of these compounds was increased to 4 mM on day 29. Octyl sulfone was detected in the effluent oil initially but dropped to trace amounts after several weeks, indicating a shift in DszA. The influent octyl sulfide concentration was increased in steps to 8 mM on day 77, and the cell density in the chemostat increased in response as evidenced by increased glucose consumption (traditional methods of measuring cell density, such as absorbance or dry weight measurement, are difficult in two-phase cultures of R. erythropolis due to cell attachment to oil droplets). Total sulfur analysis of influent and effluent samples indicated a loss of approximately 2 mM S in the chemostat, and GC-SCD analysis confirmed that the loss was due to the degradation of octyl sulfide. These data indicated that a population that could grow on octyl sulfide as a sole sulfur source had become established, and so sulfate was removed from the influent medium as a maintenance sulfur source on day 87. The chemostat population remained stable after removal of sulfate, indicating that a transition to utilization of the sulfur compounds in the oil phase had indeed occurred.
With evidence that octyl sulfide was now being metabolized by the chemostat population, we wished to change the selective pressure, and octyl sulfide was removed from the feed on day 143. 3-MBT (which can support growth) was supplied in the influent oil at 2 mM to maintain a baseline population. The concentration of 3-MBT in the chemostat feed was reduced in steps (to 1, 0.3, and 0.15 mM) over a period of 45 days. By day 170, the concentration of total sulfur removed in the chemostat began to exceed the concentration of 3-MBT in the influent oil (0.3 mM). This indicated that the chemostat population had begun to metabolize a new compound. Analysis of the effluent oil indicated that 5-MBT was being utilized. However, when 3-MBT was completely removed from the chemostat on day 188, the cell density declined even at a dilution rate of 0.022 h-1. Even though the culture would wash out at this growth rate, it could be restored in batch mode with 5-MBT as the sole sulfur source. This batch growth was accompanied by significant reduction of 5-MBT in the oil phase, indicating that a 5-MBT-utilizing population had emerged.
At no point in the 8-month period of chemostat operation was there any evidence that a shift towards alkyl thiophene utilization had occurred.
Screening of chemostat isolates.
Chemostat effluent samples were regularly plated on rich medium plates and DBT emulsion plates. During the life of the chemostat, the diversity of colony morphologies observed on these plates increased. However, all isolates had the distinct orange pigmentation of Rhodococcus, suggesting they were derivatives of the parental strain used to inoculate the chemostat. On day 104 (54 generations), the chemostat was clearly established on octyl sulfide, and a sample from the chemostat was streaked onto a DBT plate. Five randomly picked isolates were selected, grown in liquid culture in minimal medium, and tested in two-phase resting-cell assays for 16 h with octyl sulfide in dodecane at 58 µmol (6:1 water/oil ratio). Control strains with the wild-type Dsz system removed <2.3 µmol of octyl sulfide. Two of the five chemostat isolates removed 7.7 and 8.9 of µmol octyl sulfide, respectively. This represented specific activities toward octyl sulfide of 0.13 and 0.15 µmol g (dry weight) of cells-1 min-1, respectively. The remaining three chemostat isolates removed no octyl sulfide, suggesting that the wild-type strain had not yet washed out, perhaps because the rate of octyl sulfide transformation was sufficient to support cross feeding. One of the octyl sulfide-transforming isolates was selected for further characterization and was designated R. erythropolis C4-104. The specific activity of C4-104 toward DBT was 0.54 µmol g (dry weight) of cells-1 min-1, compared with a specific activity of the parental strain of 0.65 µmol g (dry weight) of cells-1 min-1.
On day 224 (117 generations), the chemostat was clearly established on 5-MBT, and an effluent sample was plated onto 5-MBT emulsion agar. Growth was slow, but after several weeks a subpopulation of large orange colonies was established on these plates. Four of these colonies were randomly picked and grown in liquid culture. Two-phase resting-cell assays were performed with 5-MBT in dodecane at 3.45 mM (6:1 water/oil ratio). Three of the four isolates removed 2.76 mM 5-MBT in a 72-h assay. The fourth isolate was similar to the control strains carrying the wild-type Dsz system that removed only 0.3 mM 5-MBT in the same assay. One of the positive isolates was selected for further characterization and was designated R. erythropolis C4-224.
The ability of C4-224 to transform both octyl sulfide and DBT was retained (Table 3). This indicated that the octyl sulfide gain of function was not lost during the 5-MBT phase of the enrichment and that the wild-type function (DBT oxidation) was not lost by strains containing these mutations.
|
CGC. This mutated dszA allele was designated dszA1. This mutation spanned DszA codons 344 (silent mutation) and 345 (Q345A). As expected, the dszC sequence of pJA101 was unchanged from the wild-type. The pEBC388 derivative plasmid in strain C4-224 was isolated and designated pJA102. The dszA and dszC genes of pJA102 were sequenced from both directions. The dszA gene of pJA102 contained the same three-nucleotide mutation at codons 344 and 345 as observed in pJA101. An additional G-to-T transversion was observed (G60V), and this allele was designated dszA2. A G-to-T transversion was detected in the dszC gene of pJA102, and this allele was designated dszC1.
(ii) Localization of 5-MBT gain-of-function phenotype to DszC V261F.
We were more interested in the 5-MBT gain-of-function phenotype because benzothiophenes are more of a problem in petroleum streams than long-chain alkyl sulfides. Because DszC is the bottleneck in transformation of 5-MBT, we surmised that the DszC V261F mutation was responsible for the 5-MBT gain-of-function phenotype. To test this, the mutant dszC1 allele was inserted into a vector, pEBC1100 (4), that had been constructed with the wild-type dszABD genes. The dszC gene of pEBC1100 was removed and replaced with the PCR-amplified mutant allele. The resulting construct, pJA103, was transformed into R. erythropolis JB55. R. erythropolis JB55(pJA103) was able to grow with 5-MBT as the sole sulfur source. Table 3 summarizes the results of resting-cell assays performed with R. erythropolis JB55(pJA103) and control strains. Comparing strain C4-224 to strain JB55(pJA103), strain JB55(pJA103) retained the ability to transform 5-MBT but transformed octyl sulfide poorly, if at all (evidence that the octyl sulfide gain of function was due to the mutations in dszA). Strain JB55(pJA103) removed more than twice the amount of 5-MBT as did C4-224, but the ratios of 5-MBT activity to DBT activity in the two strains were nearly the same. This is likely due to increased levels of flavin reductase in pEBC1100 and its derivatives. Flavin reductase is encoded by dszD. Although dszD is located on the chromosomes of both strains, pJA103 contains an extra copy. In addition to the 5-MBT gain of function, strains with the V261F DszC mutation had improved activity against benzothiophene.
In vitro mutagenesis of dszC codon 261.
Because the V261F mutation in DszC resulted in a broadening of the substrate range to include 5-MBT, we decided to make further changes at codon 261 to explore the potential for further improvements in substrate range to expand the utility of DszC in BDS. By using a modified RACHITT method (4), a library containing clones randomized with respect to the sequence at codon 261 was constructed. Clones were picked at random for sequencing to identify at least one clone with each of the possible amino acids substitutions. A total of 321 clones were sequenced. The library was quite randomized, as 53 distinct codon 261 mutations were represented, including at least one of all possible amino acid substitutions.
Assays with codon 261 mutant set.
A set of 19 mutants, each with a different amino acid substitution at codon 261, was tested in resting-cell assays for transformation of DBT, 5-MBT, and benzothiophene. Most of the substitution mutants that were tested represented those sequences of most frequent codon usage for each respective amino acid in Rhodococcus. As a control, a strain with the wild-type sequence (valine) at codon 261 was also tested. The phenylalanine mutant was the only mutant that was able to transform 5-MBT and was the only mutant that transformed benzothiophene more efficiently than the wild-type (valine) strain. Interestingly, the activity on DBT of many of the mutants was reduced or, in some cases, eliminated (Table 4). No mutant had a DBT specific activity greater than that of the wild-type strain, and although the V261F mutant had gained the ability to transform 5-MBT, it had relatively low DBT activity compared to the wild type.
|
| DISCUSSION |
|---|
|
|
|---|
There have been no previous reports of the ability of the Dsz system to transform alkyl sulfides. Growth of IGTS8 on dimethyl sulfoxide has been reported (15), but we have observed that Dsz- strains can transform dimethyl sulfoxide (unpublished observations). Our study has shown that dialkyl sulfides are substrates for the complete Dsz system, although increased alkylation resulted in less efficient transformation. The accumulation of sulfones in octyl sulfide transformations indicates that DszA has a narrower substrate range than DszC for dialkyl sulfides.
The sulfur-limited chemostat was effective for the directed evolution of gain-of-function mutants with an expanded substrate range for the enzymes involved in BDS. Furthermore, the same chemostat was effective for the sequential accumulation of different evolved phenotypic targets in a single strain. This was accomplished by changing the selective pressure after the appearance of the first mutation to select a second mutation. The resultant population had accumulated both octyl sulfide and 5-MBT gain-of-function phenotypes, and both of these traits were present in a single isolate. The unique three-nucleotide mutation in dszA of C4-104 was conserved in C4-224, indicating that the latter strain was a descendant of the former. It was anticipated that the octyl sulfide gain of function would require a DszA mutation, and this was borne out with the mutations detected in C4-104 and C4-224. The nature of the DszA mutations has not been characterized, and it remains to be determined how each contributes to the gain-of-function phenotypes. The DszC mutation was isolated and shown to be responsible for the 5-MBT gain of function.
Only the clone with the V261F mutation was able to transform 5-MBT, but the loss of DBT activity as a result of several other substitutions at codon 261 shows the importance of this codon for DBT monooxygenase activity. The transformation by DBT monooxygenase of substituted thiophenes remains intractable. No mutant that utilized alkylated thiophenes appeared in the chemostat, and none of the codon 261 mutants demonstrated activity with alkylated thiophenes. Additional broadening of the substrate range of DszC will likely require mutations at different positions. A structural model of DszC has not been reported, and it is not known which residues contribute to the active site. It is interesting that the ability to transform 5-MBT was gained by replacement of the small hydrophobic valine residue with the larger hydrophobic phenylalanine residue. We propose that a smaller binding pocket allows a better fit for the 5-MBT structure. If this is true, one might expect a corresponding loss in activity for larger structures, and in fact the ability to transform 5-MBT was gained at the expense of DBT activity in the V261F mutant. DBT activity was generally lost when polar residues were substituted and retained when nonpolar residues were substituted at codon 261. All reported natural homologs of DszC contain either valine or leucine at codon 261 (7, 13, 14). There have been reports of bacterial isolates that can metabolize benzothiophene and thiophene but not DBT (15, 22), and it has been suggested that no single enzyme system can oxidize all of these classes of sulfur heterocycles. The V261F DszC mutant represents an enzyme that can transform both DBT and benzothiophene.
Recently, homologous dszC genes from two different sources were employed in an in vitro recombination study using RACHITT (4). Although clones that had higher activity and altered substrate specificity were obtained, it is worth noting that the V261F mutant selected in the present study could not have been generated in the RACHITT experiment because the two parental genes were homozygous at the codon 261 locus. This demonstrates that random mutagenesis, while perhaps not as powerful as in vitro recombination, remains a useful technique for the generation of genetic diversity. The chemostat has a role to play in screening large libraries for desirable phenotypes. The success of this approach in selecting for desired gain-of-function mutants confirms that, if care is taken to design the appropriate selective pressure, the chemostat can be an important tool in the directed-evolution toolbox.
The broad substrate range of the Dsz system is one of the driving forces for the development of BDS as a commercial process, but it also presents opportunities for the biocatalytic production of specialty chemicals. These include sulfinates (the product of both DszC and DszA from DBTs), a starting material for novel surfactants (23). In addition, a number of prochiral sulfides have been transformed by DszC to yield chiral sulfoxides with the opposite stereospecificity of the better-studied fungal biocatalysts (Holland et al., presented at the Gordon Conference on Green Chemistry). The ability to broaden the substrate range of the Dsz system through directed evolution increases the likelihood that low sulfur target levels in petroleum streams can be achieved with BDS, and it also expands opportunities to generate specialty chemicals.
| ACKNOWLEDGMENTS |
|---|
We thank Wayne Coco and Hans Hektor for helpful discussions and Maureen Downey and Chanda Tavoloni for technical assistance.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | Microbiol. Mol. Biol. Rev. | Eukaryot. Cell | All ASM Journals |
|---|