This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ellis, R. T.
Right arrow Articles by Narva, K. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ellis, R. T.
Right arrow Articles by Narva, K. E.
Agricola
Right arrow Articles by Ellis, R. T.
Right arrow Articles by Narva, K. E.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, March 2002, p. 1137-1145, Vol. 68, No. 3
0099-2240/02/$04.00+0     DOI: 10.1128/AEM.68.3.1137-1145.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Novel Bacillus thuringiensis Binary Insecticidal Crystal Proteins Active on Western Corn Rootworm, Diabrotica virgifera virgifera LeConte

R. Tracy Ellis, Brian A. Stockhoff, Lisa Stamp,,{dagger} H. Ernest Schnepf, George E. Schwab, Mark Knuth,,{ddagger} Josh Russell, Guy A. Cardineau, and Kenneth E. Narva*

Dow AgroSciences, San Diego, California 92121

Received 22 August 2001/ Accepted 13 December 2001


arrow
ABSTRACT
 
A new family of insecticidal crystal proteins was discovered by screening sporulated Bacillus thuringiensis cultures for oral activity against western corn rootworm (WCR) larvae. B. thuringiensis isolates PS80JJ1, PS149B1, and PS167H2 have WCR insecticidal activity attributable to parasporal inclusion bodies containing proteins with molecular masses of ca. 14 and 44 kDa. The genes encoding these polypeptides reside in apparent operons, and the 14-kDa protein open reading frame (ORF) precedes the 44-kDa protein ORF. Mutagenesis of either gene in the apparent operons dramatically reduced insecticidal activity of the corresponding recombinant B. thuringiensis strain. Bioassays performed with separately expressed, biochemically purified 14- and 44-kDa polypeptides also demonstrated that both proteins are required for WCR mortality. Sequence comparisons with other known B. thuringiensis insecticidal proteins failed to reveal homology with previously described Cry, Cyt, or Vip proteins. However, there is evidence that the 44-kDa polypeptide and the 41.9- and 51.4-kDa binary dipteran insecticidal proteins from Bacillus sphaericus are evolutionarily related. The 14- and 44-kDa polypeptides from isolates PS80JJ1, PS149B1, and PS167H2 have been designated Cry34Aa1, Cry34Ab1, and Cry34Ac1, respectively, and the 44-kDa polypeptides from these isolates have been designated Cry35Aa1, Cry35Ab1, and Cry35Ac1, respectively.


arrow
INTRODUCTION
 
The various isolates and subspecies of Bacillus thuringiensis are best known as valuable sources of commercially important biopesticides (41). The most well-studied B. thuringiensis insecticidal proteins are the {delta}-endotoxins, which are parasporal crystalline inclusions that have diverse sizes, shapes, and protein compositions (21). The {delta}-endotoxins are proteins that belong to a number of sequence similarity groups and have oral activity against a wide range of insect pests (6, 11, 17, 22, 39). Advances in agricultural biotechnology have enabled expression of several B. thuringiensis proteins in transgenic plants, thereby imparting intrinsic insect resistance traits to a number of important crops (28, 35, 36, 43).

The larvae of western corn rootworm (WCR), Diabrotica virgifera virgifera LeConte (Coleoptera: Chrysomelidae), and related Diabrotica species are major coleopteran pests of corn (15). Crop rotation with soybeans, estimated to be used in 80% of north central United States acreage by the National Agricultural Statistics Service, is the most common pest management practice for corn rootworm control. However, newly identified rootworm behavioral adaptations potentially threaten the sustainability of crop rotation as an effective means of controlling this pest complex. In Minnesota a northern corn rootworm, Diabrotica barberi Smith & Lawrence biotype, has developed an extended diapause, in which eggs remain in the soil for an extra year and hatching is delayed until corn is planted again (20). In addition, the Illinois Natural History Survey and University of Illinois (http://www.staff.uiuc.edu/~s-isard/WCRStart.html) are tracking a strain of WCR beetles that have evolved behaviorally to lay eggs in soybean fields where corn is planted, and the eggs are ready to hatch the next year (19, 34).

Chemical pesticides are also used to control corn rootworms. The National Agricultural Statistics Service estimates that approximately 8 million pounds of soil insecticides are applied annually to 68 million corn acres in the United States for rootworm control. Some of these pesticides are currently being reviewed by the Environmental Protection Agency under the Food Quality Protection Act and could lose their registrations, while long-term use of some others is threatened by development of resistant rootworms or soil-enhanced microbial degradation (37, 44).

The challenges to corn rootworm management mentioned above reinforce the need to diversify rootworm control measures, and an option that we have explored is to use transgenic corn hybrids expressing B. thuringiensis-derived proteins in their roots for protection against larval damage. A first step towards this goal was the discovery of B. thuringiensis proteins with effective levels of activity against the economically important rootworm pest complex, and it is thought that the gene(s) encoding these proteins could be engineered for expression in commercial corn hybrids to provide an additional management tool for rootworm control. In this report we describe a novel class of binary B. thuringiensis insecticidal crystal proteins that form the basis for highly efficacious control of corn rootworms when the proteins are expressed in transgenic corn hybrids (29).

(Some aspects of this work have been described in patent applications [PCT international applications WO9740162 {30 October 1997}, and WO0114417 {March 2001}] and related U.S. patents [31, 32].)


arrow
MATERIALS AND METHODS
 
Native bacterial isolates and culture.
The bacterial isolates used in this study are listed in Table 1. B. thuringiensis isolates PS80JJ1, PS149B1, and PS167H2 were obtained from the Dow AgroSciences proprietary collection of bacteria and were deposited in the permanent collection of the Agricultural Research Service Patent Culture Collection, Regional Research Center, Peoria, Ill. B. thuringiensis isolates were grown to lysis in cross-baffled flasks at 30°C with shaking at 250 rpm in PGSM medium (7) supplemented with 10 µg of erythromycin per ml when appropriate. Lysed cultures were centrifuged at 10.8 x g for 25 min at 4°C, and the cell pellets were resuspended in small volumes of sterile, deionized water. Sample aliquots were stored on ice at 4°C and used for bioassays immediately, and the remaining portions were either stored at -80°C or lyophilized, stored at room temperature, and used for further purification. Two proteins, which had molecular masses of 14 and 44 kDa, were quantified by densitometry of sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) gels by using a Molecular Dynamics densitometer and bovine serum albumin as the standard.


View this table:
[in this window]
[in a new window]
 
TABLE 1. B. thuringiensis and P. fluorescens bacteria evaluated for insecticidal activity against WCR in this study

Bioassays.
Test materials were applied to the surface of casein and wheat germ modified artificial diet for corn rootworm (26). Forty-eight-well plates with a surface area of 0.78 cm2 were treated by using an application rate of 125 µl of treatment suspension per well. Treated bioassay plates were surface dried in a laminar flow hood. The bioassay negative controls were Cry-B (40), a B. thuringiensis strain lacking insecticidal protein genes that was tested at a cell mass rate equivalent to that of other B. thuringiensis treatments, and water. Each well was infested with approximately six neonate WCR hatched from eggs purchased from French Agricultural Research, Lamberton, Minn. Infested plates were sealed with ventilated film (Clear Lam Packaging, Elk Grove Village, Ill.) and then kept in the dark at 25°C at 40 to 50% relative humidity for 4 days before observations of larval mortality were made. Dose-response data were analyzed by Probit Analysis using POLO-PC software (24). The 50% lethal concentration (LC50) was defined as the concentration that caused 50% mortality of the test population and was expressed in micrograms of protein per square centimeter of diet surface.

Insecticidal gene cloning, plasmid construction, and DNA sequencing.
Total cellular DNA was prepared from B. thuringiensis cells grown to an optical density at 600 nm of 1.0. Cells were harvested by centrifugation and resuspended in protoplast buffer (20 mg of lysozyme per ml in 0.3 M sucrose-25 mM Tris-Cl [pH 8.0]-25 mM EDTA). After incubation at 37°C for 1 h, protoplasts were lysed by two cycles of freezing and thawing. Nine volumes of a solution containing 0.1 M NaCl, 0.1% SDS, and 0.1 M Tris-Cl was added to complete lysis. The cleared lysate was extracted twice with phenol-chloroform (1:1). Nucleic acids were precipitated with 2 volumes of ethanol and pelleted by centrifugation. The pellet was resuspended in 10 mM Tris-Cl [pH 8.0]-1 mM EDTA (TE) buffer, and RNase was added to a final concentration of 50 µg/ml. After incubation at 37°C for 1 h, the solution was extracted once with phenol-chloroform (1:1) and once with TE-saturated chloroform. DNA was precipitated from the aqueous phase by adding 0.1 volume of 3 M sodium acetate and 2 volumes of ethanol. DNA was pelleted by centrifugation, washed with 70% ethanol, dried, and resuspended in TE buffer.

PS80JJ1 or PS167H2 total DNA was partially digested with Sau3AI and fractionated by agarose gel electrophoresis. DNA fragments that were 9.3 to 23 kbp in size were excised from the gel, electroeluted from the gel slice, purified on an Elutip-D ion-exchange column (Schleicher and Schuell, Keene, N.H.), and recovered by ethanol precipitation. The Sau3AI inserts were ligated into BamHI-digested LambdaGem-11 (Promega, Madison, Wis.). Recombinant phage were packaged and plated on Escherichia coli KW251 cells.

Oligonucleotide probes for the genes encoding the PS80JJ1 14- and 44-kDa proteins were designed on the basis of N-terminal peptide sequence data, and the sequences (IUB codes) were biased for B. thuringiensis codon usage. The sequence of the 28-base oligonucleotide probe for the 14-kDa protein gene was 5' GW GAA GTW CAT ATW GAA ATW AAT AAT AC 3'. The sequence of the 29-base oligonucleotide probe for the 44-kDa protein gene was 5' ATG YTW GAT ACW AAT AAA GTW TAT GAA AT 3'. The probes were radiolabeled with polynucleotide kinase and [{gamma}-32P]ATP and used for hybridization of phage plaques and Southern blot analysis by standard methods (25). Hybridizing phage were plaque purified and used to infect liquid cultures of E. coli KW251 cells for isolation of DNA by standard procedures (25).

Using Southern blot analysis of DNA from recombinant phage containing PS80JJ1 inserts, we identified one clone that contained an approximately 4.8-kbp XbaI-SacI fragment suitable for subcloning the PS80JJ1 44-kDa protein gene. The SacI site flanking the PS80JJ1 gene is a phage vector cloning site, while the flanking XbaI site is located within the PS80JJ1 DNA insert. This DNA restriction fragment was subcloned by standard methods into pBluescript S/K (Stratagene, San Diego, Calif.) to generate pMYC2421 and into the high-copy-number bifunctional shuttle vector pHT370 (3) to generate pMYC2426.

Using Southern blot analysis of DNA from recombinant phage containing PS167H2 inserts, we identified one clone that contained an approximately 4.0- to 4.4-kbp HindIII fragment that hybridized to the PS80JJ1 44-kDa protein gene probe. This DNA restriction fragment was isolated, purified, and subcloned into pHT370 to generate pMYC2427.

Using Southern blot analysis of DNA from recombinant phage containing PS149B1 inserts, we identified one clone that contained an approximately 5.9-kbp ClaI DNA fragment that hybridized to the PS80JJ1 44-kDa protein gene probe. Complete ClaI digests of PS149B1 genomic DNA were size fractionated on agarose gels, cloned into pHT370, and screened by hybridization. One representative clone containing the PS149B1 genes was designated pMYC2429.

DNA inserts containing genes in pMYC2421, pMYC2427, and pMYC2429 were sequenced by using ABI373 or ABI377 automated sequencers and software (PE Biosystems, Foster City, Calif.). Additional sequence analysis was performed by using Wisconsin Package, version 10.2 (Genetics Computer Group, Madison, Wis.).

B. thuringiensis transformation.
Recombinant bifunctional shuttle plasmids were transformed into the acrystalliferous B. thuringiensis host, Cry-B, by electroporation. Cells were grown in Luria-Bertani medium (25) to an optical density at 600 nm of 0.2 to 0.5, harvested by centrifugation, and washed three times in 0.4 M sucrose. Washed cells were concentrated 1,000-fold and resuspended in 0.4 M sucrose. Plasmid DNA resuspended in 2 to 5 µl of TE was mixed with 50 µl of cells and transferred to a 0.2-cm cuvette on ice. Electroporation was performed with a Bio-Rad Gene Pulser and controller set at 0.9 kV, 25 µF, and 200 {Omega}. Transformed cells were recovered from the cuvette in 1 ml of cold Luria-Bertani medium containing 0.4 M sucrose and incubated for 2 h at 30°C. Cultures were then plated on DM3-G regeneration medium (10) containing 0.4 M sucrose and 10 µg of erythromycin per ml and incubated overnight at 30°C.

Heterologous expression and protein purification.
The 14- and 44-kDa proteins were overexpressed in a Dow AgroSciences proprietary inducible Pseudomonas fluorescens plasmid expression system. The 14- and 44-kDa protein genes were first separately engineered into a plasmid vector under control of an inducible promoter by standard DNA cloning methods; the recombinant plasmids were then transformed by electroporation into P. fluorescens host strain MB214 to obtain strains MR1242 and MR1240, respectively. Following growth and induction, a portion of either an MR1240 culture or an MR1242 culture was lysed in lysozyme buffer to obtain protein inclusions. These inclusions were then resuspended in 50 mM sodium citrate (pH 3.3) by gentle rocking at 4°C for 1 h. This buffer completely solubilized the 14-kDa protein and partially solubilized the 44-kDa protein. The preparations were then centrifuged at 15,000 x g for 20 min, and the supernatants were decanted. The 14-kDa protein was further purified by ion-exchange chromatography. The solubilized 14-kDa protein was bound to an Econo-S column (Bio-Rad, Hercules, Calif.) and eluted with a 0 to 1 M sodium chloride gradient.

To prepare insecticidal proteins from B. thuringiensis, 1 g of a lyophilized PS80JJ1 or MR543 wet cell pellet was suspended in a wash buffer containing 80 mM Tris-Cl, 5 mM Na2EDTA, 100 µM phenylmethylsulfonyl fluoride, 5 µg of leupeptin per ml, 0.7 mg of pepstatin per ml, and 40 µg of bestatin per ml (pH 7.8). The resulting suspension was centrifuged at 5,000 x g for 30 min. The resulting supernatant was discarded, and the wash procedure was repeated an additional four times. The final pellet was resuspended in 10 ml of the wash buffer. The materials were then processed as described above for the proteins expressed in P. fluorescens.

Gene mutagenesis.
The PS80JJ1 genes were separately inactivated on two plasmid constructs. The mutated operons were maintained under control of the native promoter for expression in B. thuringiensis. First, the 44-kDa protein gene was mutated by truncation at the EcoRI site at base position 387 of the open reading frame (ORF). The resulting operon, which included the intact 14-kDa protein gene and the truncated 44-kDa protein gene, was subcloned into pHT370 to generate pMYC2424. Transformation of pMYC2424 into Cry-B by electroporation generated recombinant B. thuringiensis strain MR541. Next, the 14-kDa protein gene was mutated by insertion of an oligonucleotide linker containing termination codons in all possible reading frames at the NruI site at base position 11 of the 14-kDa protein ORF. The sequence of the mutagenic linker was 5' TGAGTAACTAGATCTATTCAATTA 3'. The linker introduced a BglII site for screening putative mutants by BglII restriction digestion. Plasmid clones containing the mutagenic linker were identified with BglII and sequenced for verification. The operon insert which encoded the 14-kDa protein nonsense mutations was subcloned into pHT370, resulting in plasmid pMYC2425. This plasmid was transformed into Cry-B by electroporation to obtain recombinant B. thuringiensis strain MR542.

Nucleotide sequence accession numbers.
The GenBank accession numbers for the nucleotide and protein sequences, as well as the designations of the PS80JJ1, PS167H2, and PS149B1 binary insecticidal crystal proteins, are shown in Table 2.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Sequence accession numbers and designations of the binary insecticidal crystal proteinsa


arrow
RESULTS
 
B. thuringiensis isolates active on WCR.
B. thuringiensis isolates PS80JJ1, PS167H2, and PS149B1 all produced parasporal inclusions comprised primarily of proteins whose molecular masses were approximately 13 to 14 and 44 kDa, as determined by SDS-PAGE (Fig. 1). The B. thuringiensis strains were determined to have activity on WCR neonates in surface-applied bioassays. The estimated effective LC50 of total 14- and 44-kDa proteins from spore crystal preparations from the three B. thuringiensis isolates for WCR were 6 to 8 µg/cm2 (Table 3). Tests of these B. thuringiensis isolates at estimated concentrations of 100 µg/cm2 with the primary lepidopteran corn pests, including European corn borer (Ostrinia nubilalis Hubner) (Lepidoptera: Crambidae), corn earworm (Helicoverpa zea Boddie), and black cutworm (Agrotis ipsilon Hufnagel) (Lepidoptera: Noctuidae), revealed no observable insecticidal effect (data not shown).



View larger version (71K):
[in this window]
[in a new window]
 
FIG. 1. SDS-PAGE analysis of parasporal crystalline inclusions from isolates active against WCR. Lane 1, molecular mass markers; lane 2, PS80JJ1; lane 3, PS149B1; lane 4, PS167H2.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Insecticidal activity of B. thuringiensis isolates against WCR neonates in three top load artificial diet bioassays

Nucleotide and deduced amino acid sequences for the insecticidal protein operons.
Southern blot restriction fragment length polymorphism analyses of PS80JJ1 total DNA that was hybridized with oligonucleotide probes based on the N-terminal sequences of the 14- and 44-kDa proteins suggested that the genes encoding these proteins were located adjacent to each other (data not shown). Therefore, phage and plasmid clones encoding the 44-kDa crystal protein from each B. thuringiensis isolate were identified by hybridization with the gene probe for the PS80JJ1 44-kDa protein N-terminal sequence. Sequence analyses of the 44-kDa protein loci revealed that all three B. thuringiensis isolates active on WCR have the genes encoding the 14- and 44-kDa crystal proteins arranged in an apparent operon. The nucleotide and deduced polypeptide sequences for the PS80JJ1 operon are shown in Fig. 2. The predicted molecular masses of the deduced polypeptides from B. thuringiensis isolate PS80JJ1 are 13.2 and 44.3 kDa, whereas the molecular masses of the homologous proteins from both PS149B1 and PS167H2 are 13.6 and 43.8 kDa. The size differences for the ca. 14-kDa proteins are apparent in Fig. 1, lanes 2 to 4. Size comparisons of the ca. 44-kDa proteins were complicated by apparent proteolytic processing (Fig. 1, lane 4; also see below). The genes are arranged with the 14-kDa protein ORF upstream of the 44-kDa protein ORF. Both the 14-kDa protein ORF and the 44-kDa protein ORF are preceded by putative ribosome binding sites. Intergenic spacers separating the 14- and 44-kDa protein ORFs were 121 bp long (PS80JJ1) or 107 bp long (PS149B1 and PS167H2). The intergenic region of the PS80JJ1 sequence contains inverted repeats (Fig. 2) that have the potential to form a secondary structure with a {Delta}Gfolding of -18.8 kcal/mol (estimated at 37°C). Similar patterns, lacking the outermost repeat, occur in the shorter spacers found in PS149B1 and PS167H2 (data not shown). Sequence comparisons of the proteins from the three B. thuringiensis isolates revealed that the 14- and 44-kDa proteins comprise two new sequence families and that the PS80JJ1 proteins are more distantly related to the homologous proteins of either PS149B1 or PS167H2. For example, the PS80JJ1 14-kDa protein is 77% identical to the PS149B1 14-kDa protein, whereas the PS80JJ1 44-kDa protein is 80% identical to the PS149B1 44-kDa protein. The homologous 14- and 44-kDa protein pairs for PS149B1 and PS167H2 both exhibit approximately 94% sequence identity. In the case of the PS80JJ1 operon, a portion of an IS240-like insertion element, similar to that in the GenBank accession number M23741 sequence, is present in the sequence distal to the gene for the 44-kDa protein, including an inverted repeat and a portion of a transposase (Fig. 2). While this apparent insertion element may have disrupted the normal transcription terminator for the PS80JJ1 sequence, a strong terminator-mRNA stabilizer sequence of the type found for the Cry1 genes (reviewed in reference 39) also appears to be absent in the 120 to 200 bp 3' to the 44-kDa protein coding sequences in the other two strains.



View larger version (80K):
[in this window]
[in a new window]
 
FIG. 2. Nucleotide and deduced amino acid sequences of the PS80JJ1 operon (GenBank accession number AY016411) (Table 2). The positions of the reading frames for the 14- and 44-kDa polypeptides are shown together with the positions of their ribosome binding sites (RBS). The small horizontal arrows indicate inverted repeat motifs. The locations of the C-terminal portion of a transposon-like sequence (Tn) (encoded by the complement of the sequence shown) and an IS240-like inverted repeat (IR) are also indicated (both sequences are similar to the sequence deposited under GenBank accession number M23741).

Expression and mutational analysis of the PS80JJ1 insecticidal protein operon.
Recombinant B. thuringiensis isolates expressing both the 14- and 44-kDa proteins encoded by the PS80JJ1 operon or these proteins separately were constructed (Fig. 3) to determine if one or both proteins were responsible for WCR mortality. Wild-type and mutant genes were subcloned into an E. coli-B. thuringiensis shuttle vector (pHT370) and transformed into the Cry-B host. Expression of the 14-kDa protein (Fig. 4, lane 2), the 44-kDa protein (Fig. 4, lane 3), or both proteins together (Fig. 4, lane 4) was observed when recombinant isolates were grown to the sporulation stage. Recombinant B. thuringiensis Cry-B strains containing the operons from both PS149B1 and PS167H2 also expressed both 14- and 44-kDa proteins (data not shown).



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 3. Schematic representation of recombinant strains used for mutational analysis of the PS80JJ1 operon. MR541 contains a multicopy plasmid construct encoding the 14-kDa protein and the first 129 amino acids (C-terminal deletion of 256 amino acids) of the 44-kDa protein. The truncation was made by using an internal EcoRI site at nucleotide 387 of the 44-kDa protein gene. MR542 contains a construct expressing only the 44-kDa protein; X represents a six-frame nonsense codon oligonucleotide linker inserted at an NruI site at nucleotide position 11 of the 14-kDa protein gene. MR543 contains the wild-type operon on a multicopy plasmid vector.



View larger version (79K):
[in this window]
[in a new window]
 
FIG. 4. SDS-PAGE analysis of parasporal crystalline inclusions from recombinant B. thuringiensis isolates shown in Fig. 3. Lane 1, molecular mass markers; lane 2, MR541; lane 3, MR542; lane 4, MR543; lane 5, Cry-B host strain.

The bioassay results for recombinants expressing proteins derived from isolate PS80JJ1 showed that only the strain expressing both the 14- and 44-kDa proteins, MR543, was insecticidal for WCR larvae. The LC50 for MR543 containing coexpressed proteins was estimated to be 37 µg/cm2 (90% confidence interval, 17 to 366 µg/cm2; slope, 0.8). The activities of the recombinants that expressed only individual proteins (e.g., MR541 expressing the 14-kDa protein and MR542 expressing the 44-kDa protein) were indistinguishable from the activities of negative controls at similar doses. The negative controls, including water and acrystalliferous Cry-B applied at similar biomass rates, caused 4% WCR mortality.

Heterologous insecticidal protein expression.
The PS80JJ1 14- and 44-kDa proteins were also expressed individually in recombinant P. fluorescens strains designated MR1240 and MR1242 (Fig. 5, lanes 4 and 5, respectively). Doublet bands were observed for the 44-kDa protein expressed in MR1240 (Fig. 5, lane 4), and these bands had slightly slower mobility than the corresponding polypeptide produced in either the native or recombinant B. thuringiensis strain (Fig. 5, lanes 2 and 3). The N-terminal sequences of both bands of the doublet from MR1240 were determined by using Edman degradation (27), and the results showed that both protein species in this doublet have the same N-terminal sequence as the deduced 44-kDa polypeptide sequence and the crystals obtained from B. thuringiensis. The mobilities of the 44-kDa proteins from the native and recombinant bacterial sources (Fig. 5, lanes 2 to 4) provide indirect evidence that there is C-terminal proteolytic processing of the 44-kDa polypeptides obtained from both sources.



View larger version (97K):
[in this window]
[in a new window]
 
FIG. 5. SDS-PAGE analysis of proteins expressed in B. thuringiensis or P. fluorescens. Lane 1, molecular mass markers; lane 2, PS80JJ1 native crystals; lane 3, MR543 crystals; lane 4, 44-kDa protein inclusions from MR1240; lane 5, 14-kDa protein inclusions from MR1242; lane 6, mixture of MR1240 and MR1242.

The inclusions produced by the recombinant P. fluorescens strains were purified and quantified by gel densitometry for use in bioassays with WCR. Purified recombinant MR1240 expressing the14-kDa protein and purified recombinant MR1242 expressing the 44-kDa protein were tested with WCR individually and at a protein concentration ratio of 1:1. This mass ratio mimics the 3:1 molar ratio of the 14- and 44-kDa proteins observed for wild-type strain PS80JJ1. Similar to the results of the gene knockout experiment, oral activity against WCR was observed when recombinant proteins were added to the WCR diet in a mixture (LC50, 138 µg/cm2), whereas the proteins added individually were not lethal (Table 4).


View this table:
[in this window]
[in a new window]
 
TABLE 4. Activity of 14- and 44-kDa proteins derived from PS80JJ1 coexpressed in B. thuringiensis (MR543) or expressed in P. fluorescens separately or at a mass ratio of 1:1 (MR1240 and MR242) against WCR neonates in top load bioassays

The bioassay experiments (Tables 3 and 4; also see above) suggested that the levels of activity observed for the 14- and 44-kDa proteins when they were expressed by B. thuringiensis clone MR543 and P. fluorescens and administered in a mixture were not as high as the levels of activity observed when parent isolate PS80JJ1 was used. However, the combined results of the gene knockout experiment and the heterologous expression experiment provide convincing evidence that both the 14- and 44-kDa proteins were responsible for the lethal effect observed with WCR. This led to further expression experiments performed with the genes from isolates PS167H2 and PS149B1 to determine if insecticidal activity could be optimized with different combinations (data not shown). The results of studies in which we used B. thuringiensis operon clones and separately expressed 14- and 44-kDa proteins from PS149B1 in P. fluorescens revealed a level of activity that was approximately the same as the level of activity of the PS149B1 B. thuringiensis isolate. Based on the higher level of activity of the PS149B1 proteins, we decided to transform corn with the PS149B1 genes for rootworm protection (29).

Sequence similarities between the insecticidal proteins and other proteins.
Sequence comparisons failed to show a convincing similarity between the 14- and 44-kDa proteins and any of the previously described B. thuringiensis Cry, Cyt, or Vip proteins. However, a BLAST (2) database search using the PS149B1 44-kDa protein (as a representative of this family) revealed matches with the 42-kDa Bacillus sphaericus crystal inclusion protein (expectation score, 3 x 10-14) and the 51-kDa B. sphaericus crystal inclusion protein (expectation score, 3 x 10-9). An alignment of the 44-kDa PS149B1 peptide sequence with the 42-kDa B. sphaericus crystal inclusion protein sequence revealed 26% identity over 325 residues. A similar comparison of the 44-kDa PS149B1 peptide sequence with the 51-kDa B. sphaericus crystal inclusion protein sequence revealed 29% identity over 229 residues. Similar results were obtained when the PS80JJ1 and PS167H2 sequences were used. As shown in the multiple-sequence alignment in Fig. 6, a number of conserved sequence motifs were identified in the three proteins by the MEME algorithm (4). Four of these conserved motifs overlapped with conserved blocks A, B, C, and D identified by Baumann et al. (5) between the 51- and 42-kDa B. sphaericus crystal proteins. An additional conserved motif was identified between the B and C motifs due to the greater similarity of the 44-kDa B. thuringiensis proteins to the B. sphaericus 42-kDa protein in this region. The N termini of the 44-kDa B. thuringiensis proteins are aligned near the 10th residue of the B. sphaericus 42-kDa protein and the 25th residue of the B. sphaericus 51-kDa protein (Fig. 6). This region is close to the segment defining the required functional N terminus of both B. sphaericus proteins, as determined by protease cleavage sites or deletion analysis (5, 12, 33), and could indicate that there is a minimal dispensable sequence at the N terminus. The position of the C termini of the 44-kDa B. thuringiensis proteins in the alignment is intermediate between the positions of the C termini of the corresponding B. sphaericus proteins and well past the positions of the segments required for minimal function. The latter finding is consistent with the apparent C-terminal proteolytic processing of the 44-kDa proteins described above.



View larger version (71K):
[in this window]
[in a new window]
 
FIG. 6. Comparison of the 44-kDa proteins of PS149B1, PS167H2, and PS80JJ1 with the 51.4- and 41.9-kDa proteins of B. sphaericus. (GenBank accession number M20390). Previously observed features of the B. sphaericus proteins are: blocks of sequence similarity (5) (A to D), protease cleavage sites (5, 11) near the ends (arrows, underlined), and deletion endpoints from a functional analysis (32), indicated by boxed sections near the ends, where terminal endpoints retained toxicity, and internal endpoints were nontoxic, when combined with the intact binary partner. Overlined regions are conserved regions found in register in at least four of the five proteins by the MEME program (4). Black highlighting indicates that conserved residues are present in all five sequences, while gray highlighting indicates that conserved residues are present in four of the five sequences.

A BLAST database (2) search performed with the 14-kDa proteins described here detected no sequences that had significant similarity beyond the similarities of related B. thuringiensis crystal protein sequences that were described in recent patent applications (PCT international patent applications WO0114417 [1 March 2001] and WO0066742 [9 November 2000]).


arrow
DISCUSSION
 
B. thuringiensis {delta}-endotoxins are well known for their ability to control a variety of insect pests, including members of the Lepidoptera, Coleoptera, and Diptera (41). However, only a few previously described B. thuringiensis proteins have significant levels of efficacy against WCR. These proteins include the insecticidal crystal proteins Cry3 (13, 14, 18, 23) and Cry6Aa1 (30, 42) and soluble proteins expressed during the vegetative growth phase, Vip1 and Vip2 (9). In addition, genetically engineered derivatives of Cry3Bb1 (16) have been reported to have improved activity against rootworms. The binary insecticidal proteins described here represent new families of insecticidal crystal proteins that are effective against WCR larvae. In tests conducted so far, activity of these insecticidal proteins was observed with other members of the genus Diabrotica and certain other members of the Coleoptera, but no insecticidal activity at comparable rates has been observed with primary lepidopteran pests of corn. Recently, the PS149B1 14- and 44-kDa proteins were cotransformed into corn and were shown to provide excellent protection against corn rootworm damage (29); therefore, these proteins provide a biotechnological option for corn rootworm pest control.

The 14- and 44-kDa protein families are unique among the insecticidal proteins both because of their sequence relatedness and because two separate proteins are required for insecticidal activity. While neither of these protein families is related to any previously described Cry proteins, the 44-kDa proteins have significant homology with the B. sphaericus 41.9- and 51.4-kDa polypeptides comprising the binary insecticidal proteins active against mosquitoes (5). The B. sphaericus proteins affect mosquito midgut cells in a 1:1 association; the 51.4-kDa protein provides the binding function, while the 41.9-kDa protein is required for activity (12, 33). While the B. thuringiensis binary corn rootworm insecticidal crystal proteins appear to act on the larval midgut after ingestion (29), further work is necessary to determine the role of each protein component in the intoxication process. Also, mosquito screening assays of the type used to identify mosquitocidal B. sphaericus and B. thuringiensis strains have not identified a similar level of activity for these B. thuringiensis binary toxin proteins.

We concluded that the binary toxins described here are encoded in apparent operons based on their close proximity, coordinate function, and coordinate appearance in crystals. A promoter(s) and terminators of transcription were not mapped or otherwise functionally assessed. Additionally, no strong potential RNA hairpin structure, indicative of a terminator-stabilizer sequence such as that found for the Cry1 genes (reviewed in reference 39), is apparent 3' to the 44-kDa protein coding sequences reported here. An extensive inverted repeat motif is present in the intergenic region. This inverted repeat structure or other folds that could arise in this sequence could partially terminate transcription and/or modulate mRNA degradation (reviewed in reference 8) and thereby influence the stoichiometry of the proteins. It seems less likely that transcription both terminates and reinitiates within the spacer.

The B. sphaericus binary crystal protein genes are found in operons, and several other genes for B. thuringiensis insecticidal proteins, including Cry2Aa, Cry11A, and Cyt1Aa, are also known to be organized in operons encoding additional accessory proteins that are implicated in crystallization but do not have a direct effect on insect activity (1). More recently, the 34- and 40-kDa proteins encoded by an operon in B. thuringiensis subsp. thompsoni were shown to act in a synergistic manner (38). This finding is similar to the findings of the present study, in which it was found that the insecticidal 14- and 44-kDa proteins are both necessary to kill WCR.


arrow
ADDENDUM
 
During the revision of the manuscript, the binary insecticidal crystal proteins described here were designated Cry34Aa1, Cry34Ab1, and Cry34Ac1 (for the 14-kDa polypeptide components) and Cry35Aa1, Cry35Ab1, and Cry35Ac1 (for the 44-kDa polypeptide components), as shown in Table 2 (N. Crickmore, D. R. Zeigler, E. Schnepf, J. Van Rie, D. Lereclus, J. Baum, A. Bravo, and D. H. Dean, http://www.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/index.html).


arrow
ACKNOWLEDGMENTS
 
We thank Candace Poutre, Leo Kim, and James Bing for their support and encouragement.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Dow AgroSciences, 5501 Oberlin Dr., San Diego, CA 92121. Phone: (858) 352-4348. Fax: (858) 352-4466. E-mail: kenarva{at}dowagro.com. Back

{dagger} Present address: 12756 Via Felino, Del Mar, CA 92014. Back

{ddagger} Present address: 16744 Valle Verde Road, Poway, CA 92064. Back


arrow
REFERENCES
 
    1
  1. Agaisse, H., and D. Lereculs. 1995. How does Bacillus thuringiensis produce so much insecticidal crystal protein? J. Bacteriol. 177:6027-6032.[Free Full Text]
  2. 2
  3. Altschul, S. F., T. L. Madden, A. A. Schäffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
  4. 3
  5. Arantes, O., and D. Lereclus. 1991. Construction of cloning vectors for Bacillus thuringiensis. Gene 108:115-119.[CrossRef][Medline]
  6. 4
  7. Baily, T. L., and C. Elkan. 1995. Unsupervised learning of multiple motifs in biopolymers using expectation maximization. Machine Learning 21:51-83.
  8. 5
  9. Baumann, L., A. H. Broadwell, and P. Baumann. 1988. Sequence analysis of the mosquitocidal toxin genes encoding 51.4- and 41.9-kilodalton proteins from Bacillus sphaericus 2362 and 2297. J. Bacteriol. 170:2045-2050.[Abstract/Free Full Text]
  10. 6
  11. Bravo, A. 1997. Phylogenetic relationships of Bacillus thuringiensis delta-endotoxin family proteins and their functional domains. J. Bacteriol. 179:2793-2801.[Free Full Text]
  12. 7
  13. Brownbridge, M., and J. Margalit. 1986. New Bacillus thuringiensis strains isolated in Israel are highly toxic to mosquito larvae. J. Invertebr. Pathol. 48:216-222.[CrossRef][Medline]
  14. 8
  15. Carrier, T. A., and J. D. Keasling. 1997. Controlling messenger RNA stability in bacteria: strategies for engineering gene expression. Biotechnol. Prog. 13:699-708.[CrossRef][Medline]
  16. 9
  17. Carrozzi, N. B., V. C. Kramer, G. W. Warren, and M. G. Koziel. April 1993. Bacillus thuringiensis strains against coleopteran insects. U.S. patent 5,204,100.
  18. 10
  19. Chang, S., and S. N. Cohen. 1979. High frequency transformation of Bacillus subtilis protoplasts by plasmid DNA. Mol. Gen. Genet. 168:111-115.[CrossRef][Medline]
  20. 11
  21. Crickmore, N., D. R. Zeigler, J. Feitelson, H. E. Schnepf, J. Van Rie, D. Lereclus, J. Baum, and D. H. Dean. 1998. Revision of the nomenclature for the Bacillus thuringiensis pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 62:807-813.[Abstract/Free Full Text]
  22. 12
  23. Davidson, E. W., C. Oei, M. Meyer, A. L. Bieber, J. Hindley, and C. Berry. 1990. Interaction of the Bacillus sphaericus mosquito larvicidal proteins. Can. J. Microbiol. 36:870-878.[Medline]
  24. 13
  25. Donovan, W. P., J. J. Gonzalez, Jr., B. L. Levinson, and A. Macaluso. June 1991. Coleopteran active microorganisms, related insecticide compositions and methods for their production and use. U.S. patent 5,024,837.
  26. 14
  27. Donovan, W. P., M. J. Rupar, A. C. Slaney, T. Malvar, M. C. Gawron-Burke, and T. B. Johnson. 1992. Characterization of two genes encoding Bacillus thuringiensis insecticidal crystal proteins toxic to Coleoptera species. Appl. Environ. Microbiol. 58:3921-3927.[Abstract/Free Full Text]
  28. 15
  29. Drees, B. M., E. Levine, J. W. Stewart, G. R. Sutter, and J. J. Tollefson. 1999. Injury and management of corn rootworms, p. 65-68. In K. L. Steffey, M. E. Rice, J. All, D. A. Andow, M. E. Gray, and J. W. Van Duyn (ed.), Handbook of corn insects. Entomological Society of America, Lanham, Md.
  30. 16
  31. English, L. H., S. M. Brussock, T. M. Malvar, J. W. Bryson, C. A. Kulesza, F. S. Walters, S. L. Slatin, M. A. Von Tersch, and C. Romano. February 2000. Insect-resistant transgenic plants. U.S. patent 6,023,013.
  32. 17
  33. Feitelson, J. S., J. Payne, and L. Kim. 1992. Bacillus thuringiensis: insects and beyond. Bio/Technology 10:271-275.[CrossRef]
  34. 18
  35. Gaertner, F. H., G. G. Soares, and J. Payne. 20 March 1990. Novel Bacillus thuringiensis isolate. U.S. patent 4,910,016.
  36. 19
  37. Gray, M. E., E. Levine, and K. L. Steffey. 1996. Western corn rootworms and crop rotation: have we selected a new strain, p. 653-660. In Brighton Crop Protection Conference: Pests and Diseases, vol. 3. British Crop Protection Council, Farnham, England.
  38. 20
  39. Gray, M. E., E. Levine, and H. Oloumi-Sadeghi. 1998. Adaptation to crop rotation: western and northern corn rootworms respond uniquely to a cultural practice. Recent Res. Dev. Entomol. 2:19-31.
  40. 21
  41. Heimple, A. M. 1967. A critical review of Bacillus thuringiensis var. thuringiensis Berliner and other crystalliferous bacteria. Annu. Rev. Entomol. 12:287-322.[CrossRef][Medline]
  42. 22
  43. Hofte, H., and H. R. Whiteley. 1989. Insecticidal crystal proteins of Bacillus thuringiensis. Microbiol. Rev. 53:242-255.[Abstract/Free Full Text]
  44. 23
  45. Krieg, A., A. M. Huger, and W. Schnetter. 25 July 1989. Strains of Bacillus toxic to Coleoptera. U.S. patent 4,851,340.
  46. 24
  47. LeOra Software. 1987. POLO-PC: user's guide to Probit or Logit analysis. LeOra Software, Berkeley, Calif.
  48. 25
  49. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
  50. 26
  51. Marrone, P. G., F. D. Ferri, T. R. Mosley, and L. J. Meinke. 1985. Improvements in laboratory rearing of the southern corn rootworm, Diabrotica undecimpunctata howardi Barber (Coleoptera: Chrysomelidae), on an artificial diet and corn. J. Econ. Entomol. 78:290-293.
  52. 27
  53. Matsudaira, P. 1987. Sequence from picomole quantities of proteins electroblotted onto polyvinylidene difluoride membranes. J. Biol. Chem. 262:10035-10038.[Abstract/Free Full Text]
  54. 28
  55. Meeusen, R. L., and G. W. Warren. 1988. Insect control with genetically engineered crops. Annu. Rev. Entomol. 34:373-381.[CrossRef]
  56. 29
  57. Mollenbeck, D. J., M. L. Peters, J. W. Bing, J. R. Rouse, L. S. Higgins, L. Sims, T. Nevshemal, L. Marshall, R. T. Ellis, P. G. Bystrak, B. A. Lang, J. L. Stewart, K. Kouba, V. Sondag, V. Gustafson, K. Nour, D. Xu, J. Swenson, J. Zhang, T. Czapla, G. Schwab, S. Jayne, B. A. Stockhoff, K. E. Narva, H. E. Schnepf, S. J. Stelman, C. Poutre, M. Koziel, and N. Duck. 2001. Insecticidal proteins from Bacillus thuringiensis protect corn from corn rootworms. Nat. Biotechnol. 19:668-672.[CrossRef][Medline]
  58. 30
  59. Narva, K. E., G. E. Schwab, and G. A. Bradfisch. 16 February 1993. Novel Bacillus thuringiensis gene encoding coleopteran-active toxin. U.S. patent 5,186,934.
  60. 31
  61. Narva, K. E., H. E. Schnepf, M. Knuth, M. R. Pollard, G. Cardineau, and G. E. Schwab. July 2000. Pesticidal toxins. U.S. patent 6,083,499.
  62. 32
  63. Narva, K. E., H. E. Schnepf, M. Knuth, M. R. Pollard, G. Cardineau, G. E. Schwab, and T. E. Michaels. October 2000. Pesticidal toxins. U.S. patent 6,127,180.
  64. 33
  65. Oei, C., J. Hindley, and C. Berry. 1992. Binding of purified Bacillus sphaericus binary toxin and its deletion derivatives to Culex quinquefasciatus gut: elucidation of functional binding domains. J. Gen. Microbiol. 138:1515-1526.[Abstract/Free Full Text]
  66. 34
  67. O'Neil, M. E., M. E Gray, and C. A. Smyth. 1999. Population characteristics of a western corn rootworm (Coleoptera: Chrysomelidae) strain in east-central Illinois corn and soybean fields. J. Econ. Entomol. 92:1301-1310.
  68. 35
  69. Perlak, F. J., W. R. Deaton, T. A. Armstrong, R. I. Fuchs, S. R. Sims, J. T. Greenplate, and D. A. Fischhoff. 1990. Insect resistant cotton plants. Bio/Technology 8:939-943.[CrossRef][Medline]
  70. 36
  71. Prieto-Samsonov, D. L., R. I. Vazquez-Padron, C. Ayra-Pardo, J. Gonzalez-Cabrera, and G. A. de la Riva. 1997. Bacillus thuringiensis: from biodiversity to biotechnology. J. Ind. Microbiol. Biotechnol. 19:3202-3219.
  72. 37
  73. Racke, K. D., and J. R. Coats. 1990. Enhanced biodegradation of insecticides in Midwestern corn soils. Am. Chem. Soc. Symp. Ser. 426:68-81.
  74. 38
  75. Rang, C., L. A. Lacey, and R. Frutos. 2000. The crystal proteins from Bacillus thuringiensis subsp. thompsoni display a synergistic activity against the codling moth, Cydia pomonella. Curr. Microbiol. 40:200-204.[CrossRef][Medline]
  76. 39
  77. Schnepf, H. E., N. Crickmore, J. Van Rie, D. Lereclus, J. Baum, J. Feitelson, D. R. Zeigler, and D. H. Dean. 1998. Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 62:775-780.[Abstract/Free Full Text]
  78. 40
  79. Stahly, D. P., D. W. Dingman, L. A. Bulla, Jr., and A. I. Aronson. 1978. Possible origin and function of the parasporal crystals in Bacillus thuringiensis. Biochem. Biophys. Res. Commun. 84:581-588.[CrossRef][Medline]
  80. 41
  81. Tanada, Y., and H. K. Kaya. 1993. Insect pathology. Academic Press, Inc., San Diego, Calif.
  82. 42
  83. Thompson, M., M. Knuth, and G. Cardineau. February 1999. Bacillus thuringiensis toxins with improved activity. U.S. patent 5,874,288.
  84. 43
  85. Vaeck, M., A. Reynaerts, H. Hofte, S. Jansens, M. de Beuckeleer, C. Dean, M. Zabeau, M. van Montagu, and J. Leemans. 1987. Transgenic plants protected from insect attack. Nature 328:33-37.[CrossRef]
  86. 44
  87. Wright, R. J., M. E. Scharf, L. J. Meinke, X. G. Zhou, B. D Siegfried, and L. D. Chandler. 2000. Larval susceptibility of an insecticide-resistant western corn rootworm (Coleoptera: Chrysomelidae) population to soil insecticides: laboratory bioassays, assays of detoxification enzymes, and field performance. J. Econ. Entomol. 93:7-13.


Applied and Environmental Microbiology, March 2002, p. 1137-1145, Vol. 68, No. 3
0099-2240/02/$04.00+0     DOI: 10.1128/AEM.68.3.1137-1145.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Schnepf, H. E., Lee, S., Dojillo, J., Burmeister, P., Fencil, K., Morera, L., Nygaard, L., Narva, K. E., Wolt, J. D. (2005). Characterization of Cry34/Cry35 Binary Insecticidal Proteins from Diverse Bacillus thuringiensis Strain Collections. Appl. Environ. Microbiol. 71: 1765-1774 [Abstract] [Full Text]  
  • Beron, C. M., Curatti, L., Salerno, G. L. (2005). New Strategy for Identification of Novel cry-Type Genes from Bacillus thuringiensis Strains. Appl. Environ. Microbiol. 71: 761-765 [Abstract] [Full Text]  
  • Baum, J. A., Chu, C.-R., Rupar, M., Brown, G. R., Donovan, W. P., Huesing, J. E., Ilagan, O., Malvar, T. M., Pleau, M., Walters, M., Vaughn, T. (2004). Binary Toxins from Bacillus thuringiensis Active against the Western Corn Rootworm, Diabrotica virgifera virgifera LeConte. Appl. Environ. Microbiol. 70: 4889-4898 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ellis, R. T.
Right arrow Articles by Narva, K. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ellis, R. T.
Right arrow Articles by Narva, K. E.
Agricola
Right arrow Articles by Ellis, R. T.
Right arrow Articles by Narva, K. E.