Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Campo, N. Articles by Le Bourgeois, P. Search for Related Content PubMed PubMed Citation Articles by Campo, N. Articles by Le Bourgeois, P. Agricola Articles by Campo, N. Articles by Le Bourgeois, P.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, May 2002, p. 2359-2367, Vol. 68, No. 5
0099-2240/02/$04.00+0     DOI: 10.1128/AEM.68.5.2359-2367.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Cre-loxP Recombination System for Large Genome Rearrangements in Lactococcus lactis

Nathalie Campo,¹ Marie-Line Daveran-Mingot,¹ Kees Leenhouts ,^2, Paul Ritzenthaler,^1* and Pascal Le Bourgeois¹

Laboratoire de Microbiologie et Génétique Moléculaire du CNRS (UMR5100), Université Paul Sabatier, 31062 Toulouse, France,¹ Department of Genetics, Biomolecular Sciences and Biotechnology Institute, University of Groningen, Haren, The Netherlands²

Received 6 December 2001/ Accepted 26 February 2002

Top Abstract Introduction Materials and Methods Results Discussion References

 
We have used a new genetic strategy based on the Cre-loxP recombination system to generate large chromosomal rearrangements in Lactococcus lactis. Two loxP sites were sequentially integrated in inverse order into the chromosome either at random locations by transposition or at fixed points by homologous recombination. The recombination between the two chromosomal loxP sites was highly efficient (approximately 1 x 10^-1/cell) when the Cre recombinase was provided in trans, and parental- or inverted-type chromosomal structures were isolated after removal of the Cre recombinase. The usefulness of this approach was demonstrated by creating three large inversions of 500, 1,115, and 1,160 kb in size that modified the lactococcal genome organization to different extents. The Cre-loxP recombination system described can potentially be used for other gram-positive bacteria without further modification.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Over the last decade, our knowledge of the structure and organization of the bacterial chromosome has increased largely thanks to the use of physical mapping methods such as pulsed-field gel electrophoresis (PFGE) and large-scale sequencing. Genome map comparisons have revealed unexpected and substantial differences in replicon geometry, genome size, and organization (for a review, see reference 7). However, there is now evidence that physical constraints or selective pressures exist to maintain gene position and orientation relative to the chromosomal replication origin (34), to control exogenous gene transfer in preferred chromosomal regions (17), and to conserve the relative order of some loci even in distantly related bacterial genomes (13). One aspect that remains an enigma is the dynamic state of the bacterial genomes, in particular the nature of the physical constraints or the selective pressures that act to preserve the genome organization. A direct approach to this matter consists of experimental genome shuffling by construction of artificial large genome rearrangements such as inversions, which disrupt the organization of the bacterial chromosome without altering its genetic context, and studying the phenotypic consequences of these inversions. To date, large genome inversions in bacteria have been experimentally constructed by homologous recombination between two inverse-order inactivated copies of a selectable marker (33, 35, 39). These recombination events were phenotypically selected because they led to the reconstitution of one functional copy of the marker. An alternative strategy for the generation of such rearrangements would be the use of site-specific recombination systems, such as the Flp-FRT system from Saccharomyces cerevisiae (6) or the Cre-loxP system from coliphage P1 (1). The Cre recombinase belongs to the integrase family and catalyzes recombination between two identical 34-bp sites called loxP (locus of crossing-over). Its main function in Escherichia coli is to ensure stable maintenance of the plasmid form of the phage P1 by resolving DNA dimers into plasmid monomers. Both the Flp-FRT and Cre-loxP recombination systems have been successfully used for chromosome engineering in eukaryotic cell lines and whole organisms (18) as well as for excision of chromosomal DNA in bacteria (14, 16). However, site-specific recombination tools have never been described for the construction of large chromosomal rearrangements in bacteria, except in Pseudomonas aeruginosa, where a 1.59-Mb inversion was fortuitously isolated by use of the Flp-FRT system (4).

Lactococcus lactis is a mesophilic lactic acid bacterium that is extensively used as a starter culture in the manufacture of dairy products. It is a low-G+C, gram-positive coccus phylogenetically related to the genus Streptococcus and has a relatively small circular genome (2,500 kb). Due to its industrial importance, L. lactis serves as a model organism for genetic and biochemical studies of lactic acid bacteria, and considerable efforts have been made to develop gene tagging and targeting techniques to facilitate chromosomal gene analysis and gene cloning. The complete sequence of the genome of L. lactis subsp. lactis strain IL-1403 was recently determined (5) and revealed a structure that can be considered typical of eubacteria: the chromosome is divided into two replication arms of nearly equal length (47 and 53% of the genome), and each replication arm shows a strong bias of gene orientations, GC skew, and Chi-site orientation with respect to the direction of replication. Several studies on genome plasticity in lactococci have revealed that although the overall gene order is conserved even at the intersubspecies level, some chromosomal regions are more prone to rearrangements (10, 23). To produce artificial chromosome shuffling in L. lactis, we designed a new recombination strategy based on the phage P1 recombinase Cre and demonstrated the usefulness of this approach by generating three large inversions that modify the genome organization to different extents.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Bacterial strains and growth conditions.
The strains used in this work are listed in Table 1. L. lactis strains were grown at 30°C in M17 (38) broth (Merck, Darmstadt, Germany) supplemented with 0.5% glucose (GM17). E. coli was grown at 37°C in Luria-Bertani broth (Difco Laboratories, Detroit, Mich.). Antibiotics were used at the following concentrations for E. coli: erythromycin (Em), 150 µg/ml; chloramphenicol (Cm), 10 µg/ml; spectinomycin (Spc), 100 µg/ml; tetracycline (Tc), 2 µg/ml; and kanamycin, 40 µg/ml. For L. lactis, the concentrations were as follows: Em, 5 µg/ml; Cm, 5 µg/ml; Spc, 200 µg/ml; and Tc, 2 µg/ml.

View this table: [in this window] [in a new window]

TABLE 1. Bacterial strains and plasmids used in this study

Growth kinetics were determined in GM17 broth as follows. Culture tubes (diameter, 16 mm) containing 5 ml of prewarmed medium were inoculated with 2% of an overnight culture and incubated at 30°C without shaking in a water bath. Bacterial growth was monitored by spectrophotometric measurements of the optical density at 600 nm (model UV-1205; Shimadzu, Kyoto, Japan) every 30 min until the culture reached the stationary phase. The growth curve of each strain was constructed from the results of six to eight independent experiments.

DNA manipulations.
Restriction enzymes, Klenow polymerase, Vent polymerase, and T4 DNA ligase were purchased from either Roche Molecular Biochemicals (Mannheim, Germany) or New England Biolabs (Beverly, Mass.) and used as recommended by the suppliers. L. lactis strains were electrotransformed according to the method of Le Bourgeois et al. (24) with 5 µg of integrative plasmid or 50 ng of the replicative plasmid pGh-Cre and plated onto GM17 plates containing the appropriate antibiotic (Em, Spc, or Cm). E. coli DH5 was electrotransformed by use of a gene pulser device (Bio-Rad, Richmond, Calif.) according to the manufacturer's recommendations. E. coli plasmid DNA was isolated by use of a Qiaprep spin kit (small scale) or a plasmid midi kit (large scale) (Qiagen GmbH, Hilden, Germany) according to the manufacturer's instructions. Preparation of lactococcal genomic DNA embedded in agarose matrix, the PFGE method, and Southern hybridizations on dried gels were performed as previously described (26). Hybridization signals were detected with a bioimaging analyzer BAS1000 system (Fuji Photo Film Co., Tokyo, Japan) and analyzed with Tina version 2.07c software (Raytest Isotopenmeßgeräte GmbH, Straubenhardt, Germany).

Plasmids.
The plasmids used in this work are listed in Table 1. The bla gene and the phage f1 replication origin of pCL50 were replaced by different antibiotic resistance genes as follows (in all cloning steps, blunt-ended fragments were generated by using Klenow polymerase before ligation). The 1,464-bp SspI/BspHI fragment (containing the colE1 replication origin and the lacZ peptide regions) of pCL50 was ligated to the 919-bp DdeI/AccI fragment of pAMß1 (the wild-type ermAM gene) (32) to give pCL52 and to the 983-bp NdeI/XbaI fragment of pR324 (the wild-type aad9 gene from pDL269) (22) to give pCL57. A 934-bp DNA fragment containing the functional ISS1 insertion sequence was amplified by PCR from pRL1 with the following primers: ISS1-5 (TGAAAAATTTACAATTCTACTATCA) and ISS1-3 (CGCTTATTTGGACGACAATGA) (Eurogentec, Seraing, Belgium). The fragment was then ligated with SapI-digested pCL52 to give the transpositional integrative plasmid pCL60.

pGh-Cre was obtained by ligating a 2.3-kb AccI fragment (corresponding to the cat and the P_nisA-cre genes) from pNG8048-Cre to a 2.55-kb XbaI-HindIII fragment [corresponding to the ori(Ts) region] of pGh9. Transformation, selection, and propagation of pGh-Cre were performed in E. coli EC1000. pGh-Cre can replicate in L. lactis at 28°C but not at 37°C.

Construction of loxP cassettes.
The 1,187-bp loxP1 cassette (P59-loxP-T₁T₂T_rep) from pILOX1204 was amplified by PCR with the following primers: P59lox1T1T2-1 (CGGGATCCATGATGTTGTTTCTAAA) and P59lox1T1T2-2 (CTCAGGATCCATCGCAACATCAAA). The PCR product was then digested with BamHI (underlined sequences) and cloned into the BamHI site of the integration plasmid, pCL57, to generate pCL302. The loxP2 cassette (T₁T₂T_rep-loxP-tetL open reading frame [ORF]) was constructed in a two-step cloning procedure: a 649-bp DNA fragment containing the three transcription terminators and a loxP site from pILOX1204 was first amplified by PCR with the primers T1T2lox2-1 (GGAATTCCCCTGTTTTGGCGGATGAGA) and T1T2lox2-2 (CCTCCGGATCCTAGCGACAATAACTT). The PCR product was then digested with BamHI (underlined sequence in T1T2lox2-2) and ligated to a 1,495-bp DNA fragment (corresponding to the tetL ORF with its own transcription terminator) that had been generated by PCR amplification of pLS1 with the primers Tetra3 (CCCTATAAACTACAGATCTGCCCTCATTAT) and Tetra2 (GCCCTCTTGAATTCCTGTT) and digested with BglII (underlined sequence in Tetra3). The resulting 2,144-bp fragment (T₁T₂T_rep-loxP-tetL ORF) was amplified by PCR from an aliquot of the ligation mixture with primers T1T2lox2-1 and Tetra2, digested with EcoRI (boldface sequences in T1T2lox2-1 and Tetra2), and cloned into the EcoRI site of pCL60 to generate pCL307.

Chromosomal location and orientation of integrated plasmids.
All of the integrative plasmids described in this study contain unique ApaI, SmaI, NotI, and I-CeuI restriction sites. Their integration sites, as well as their orientations, on the chromosome of lactococcal strains were determined by Southern hybridization of PFGE-separated chromosomal restriction fragments as previously described (25).

Induction of the cre gene by nisin.
Strains carrying pGh-Cre were grown overnight at 28°C in GM17-Cm, diluted 100-fold in the same medium supplemented with a 1:1,000 dilution of the supernatant of the nisin-producing strain NZ9700 (20), and allowed to grow at 28°C to an optical density at 600 nm of 1.0.

Stabilization of chromosomal rearrangements.
The loss of pGh-Cre was provoked as described by Maguin et al. (31) with minor modifications: strains containing pGh-Cre were grown overnight in GM17-Cm medium at 28°C, diluted 100-fold in 5 ml of GM17 without antibiotics, and incubated for 2 h at 28°C (water bath) to allow exponential growth to resume. The cultures were then shifted to 37.5°C for 7 h (water bath), and 50 µl of a 10^-5 dilution was plated on GM17 plates (nonselective medium) and incubated at 28°C. One hundred colonies were transferred with toothpicks to nonselective or Cm-containing GM17 plates and incubated at 28°C. Approximately 25% of the colonies were phenotypically Cm^s, and the loss of pGh-Cre plasmid was confirmed by Southern hybridization with the cre gene as a probe. The genomic structure (parental type or inverted) of the Cm^s colonies was determined by PFGE and Southern hybridization by use of the tetL ORF probe.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Scheme for generation of chromosomal inversions by use of the inducible Cre-loxP recombination system.
The general scheme of the strategy (Fig. 1) involved a three-step procedure. The first step was the integration of two inverse-order loxP cassettes into the chromosome of L. lactis subsp. cremoris strain NZ9000, either randomly or at a fixed point depending on the integrative plasmid used. Strain NZ9000 is a derivative of strain MG1363, in which the nisRK constitutive operon was integrated into the dispensable gene pepN, allowing the use of the nisin induction-controlled expression system (21). Briefly, this food-grade gene expression system is based on the use of the promoter of the nisA gene (the structural gene of nisin), PnisA, which is inducible by the addition of nisin via the two-component regulatory system consisting of the response regulator protein NisR and the nisin sensor histidine kinase NisK. In nonproducing nisin strains that contain the nisRK operon, genes under the control of PnisA are expressed at a very low level. When nisin is added to the growth medium, transcription of these genes is activated. The physical chromosome map of NZ9000 is thought to be identical to that of MG1363 (26), because no restriction pattern variations were revealed by PFGE after ApaI, SmaI, NotI, or I-CeuI digestions (data not shown). One loxP cassette, the loxP1 cassette (Fig. 2A), consisted of the lactococcal constitutive promoter P59 (40) followed by a loxP site and three lactococcal transcription terminators (T₁T₂T_rep). The second cassette, the loxP2 cassette (Fig. 2A), corresponded to the three transcription terminators, T₁T₂T_rep, followed by a loxP site and the promoterless tetL ORF from pLS1 (37). The function of the terminators in the loxP1 cassette was to stop transcription from the P59 promoter, and the loxP2 cassette terminators prevented any readthrough from a chromosomal promoter that could activate expression of the tetL ORF. Integration of the loxP cassettes into the chromosome via replicative transposition (ISS1 transposition) or single crossing-over (homologous recombination) generally gives rise to multicopy insertion of the integrative plasmids (8, 27, 29, 31).

View larger version (21K): [in this window] [in a new window]

FIG. 1. Schematic representation of the Cre-loxP recombination system. A, B, C, and D represent the chromosome order. The letter n represents the number of AU of the integrated plasmids. The loxP sites, represented by triangles, are drawn in inverse orientation in order to yield an inversion after Cre-mediated recombination. The other option, whereby the loxP sites would be oriented as direct repeats, has been omitted from the figure.

View larger version (15K): [in this window] [in a new window]

FIG. 2. (A) Structures of the loxP cassettes used in the Cre-loxP recombination system. The loxP sites are represented by triangles. (B) Plasmids used for the Cre-loxP recombination. Abbreviations: N, NotI; C, I-CeuI; A, ApaI; H, HindIII; E, EcoRI; S, SmaI; Ac, AccI; X, XbaI. (C) Schematic representation of the chromosomal organization of strain NZ9000 showing the location of the inversion endpoints. Different gray scales indicate inverted fragments. Arrows indicate the orientation of the loxP sites.

The second step was the transformation of the double integrant (containing the loxP1 and loxP2 sites in its chromosome) with the thermosensitive replication plasmid pGh-Cre (Fig. 2B), which contains the cre gene regulated by the inducible promoter PnisA (11). In permissive conditions for pGh-Cre replication and cre expression, the Cre recombinase catalyzes recombination between two loxP sites. The result of the recombination depends on the relative orientation of the loxP sites: if they are oriented as direct repeats, the recombination event leads to the deletion of the DNA segment between the sites, and if they are oriented as inverse repeats, the DNA segment between the sites is inverted.

The last step was the recovery of cells harboring either parental- or inverted-type chromosome structures. This was achieved by removing pGh-Cre by growing bacteria at 37.5°C, a temperature not permissive for pGh-Cre replication. Cells that acquired the inverted-type chromosome could be screened for their ability to grow in the presence of Tc, because the recombination between the loxP1 and loxP2 sites generated a transcriptional fusion between the P59 promoter and the tetL ORF. To illustrate the usefulness of this genetic system, we constructed large inversions at four positions in the NZ9000 chromosome (Fig. 2C).

Construction of a 500-kb inversion in the same replication arm of the NZ9000 chromosome. (i) Integration of the loxP cassettes.
The transpositional plasmid pCL307 (Fig. 2B) was first integrated at random into the chromosome of NZ9000. The pCL307 integration sites of 40 Em^r clones were located and oriented on the physical map of the NZ9000 genome. The chromosomal structure of one of them, named CL307/1 (Fig. 3A, panel 1), which was localized near the oriC site (Fig. 2C), was analyzed after I-CeuI digestion and hybridization with the tetL ORF as a probe. In addition to the 180-kb hybridizing fragment representative of the pCL307 integration, a 5.4-kb fragment was observed (Fig. 3B, lane 1). This hybridizing fragment corresponded to plasmid amplification at an undetermined copy number, but the amplification unit (AU) number was found to vary from 1 to 50 depending on the integration event (N. Campo, unpublished data). The integrative plasmid pCL311 (Fig. 2B) was then inserted into the chromosome of strain CL307/1, generating strain CL307/1-311. Plasmid pCL311 integrates at the pcp locus by homologous recombination, and its correct integration site, together with the resulting chromosomal structure (Fig. 3A, panel 2), was verified by PFGE after ApaI, SmaI, and I-CeuI digestion and hybridization with pcp or pBSIIKS as a probe (data not shown). An amplification of integrated pCL311 plasmid has been also observed (data not shown).

View larger version (28K): [in this window] [in a new window]

FIG. 3. (A) Theoretical chromosome structures of strain CL307/1 (panel 1), strain CL307/1-311 (panel 2), and parental- (panel 3) and inverted (panel 4)-type strains. The predicted sizes of the I-CeuI restriction fragments are indicated, and those hybridizing with the tetL probe are indicated in boldface. Fragment sizes are not drawn to scale. C, I-CeuI. (B) Hybridization of I-CeuI-digested chromosomes with the tetL probe after separation by PFGE (electrophoresis conditions were 10 V/cm and 17 s of pulse time for 13 h). Lanes: M, lambda DNA concatemer size standards; L, HindIII-digested lambda DNA; 1, CL307/1-311; 2, CL307/1-311 x pGh-Cre in permissive replication conditions; 3, parental-type strain; 4, inverted-type strain. Hybridization was performed in the presence of 32P-labeled lambda DNA.

(ii) Cre-mediated recombination between the loxP sites.
Strain CL307/1-311 was transformed by the pGh-Cre plasmid. The resulting strain was cultured in conditions permissive for plasmid replication and used to determine the optimal experimental conditions for Cre-mediated recombination. First, the AU numbers of pCL307 and pCL311 were monitored during growth for 100 generations with or without antibiotics by Southern analysis of I-CeuI-digested chromosomes with a pBSIIKS probe. In the absence of pGh-Cre, the AU number was relatively stable, regardless of the growth conditions (Fig. 4, left lanes). As expected, the presence of pGh-Cre led to a strong decrease in the AU copy number, but only under nonselective growth conditions (Fig. 4, right lanes), suggesting that plasmid amplification was necessary to confer an Em and Spc resistance phenotype to the strain. Chromosomal inversion by recombination between the loxP1 and loxP2 sites generated a new 330-kb I-CeuI fragment (Fig. 3A, panel 4) that was identified by hybridization with tetL as a probe. This property was used to evaluate the recombination efficiency between loxP1 and loxP2 sites during growth without selective pressure. Unexpectedly, induction of the cre gene reduced the recombination efficiency between the loxP sites (data not shown). A hypothesis to explain this behavior is given in Discussion. Altogether, these results demonstrated that the most optimal experimental conditions for Cre-mediated recombination between the direct- or inverse-order loxP sites were the noninduction of the cre gene and nonselective growth of the cells (i.e., the absence of the antibiotics Em and Spc). Under these conditions, the ratio of the hybridization signals of the 330- and 180-kb I-CeuI fragments allowed us to estimate that 15% of the chromosomes of the cell population contained the 500-kb inversion (Fig. 3B, lane 2).

View larger version (46K): [in this window] [in a new window]

FIG. 4. Visualization of the pCL307 and pCL311 amplification units in strains CL307/1-311 and CL307/1-311 x pGh-Cre in different conditions by hybridization of PFGE-separated chromosomal DNA after ApaI digestion with pBSIIKS(-) as a probe. The number above each lane indicates the generation number. The signs - and + correspond to the absence and presence, respectively, of Em and Spc in the growth medium.

(iii) Isolation of strains with a parental- or inverted-type chromosome.
Strains carrying either the parental (Fig. 3A, panel 3)- or the inverted (Fig. 3A, panel 4)-type chromosome were isolated after removal of pGh-Cre by growth at a nonpermissive temperature for its replication. Although inverted-type strains can be selected for their ability to grow in the presence of Tc, the high recombination efficiency allowed the recovery of parental- and inverted-type strains directly from colonies obtained from GM17 plates at 37°C without selective pressure after I-CeuI digestion of individual chromosomal DNA, PFGE separation, and hybridization with tetL as a probe (Fig. 3B, lanes 3 and 4). It should be pointed out that every parental- and inverted-type strain analyzed at this step contained only one copy of each loxP cassette (data not shown), indicating that the removal of AU by recombination between the proximal direct-order loxP sites has an efficiency of 100%.

Inversions of half of the L. lactis chromosome in two different regions.
Two other large chromosomal inversions were constructed through the same experimental procedure. First, a 1,160-kb inversion was generated by integration of pCL311 in the pcp locus of the strain CL307/5 (Fig. 2C). This inversion of half of the chromosome altered neither the length of the two replication arms nor the location and orientation of genes with respect to oriC. The proper integration of these plasmids and the resulting chromosomal structure of the double integrant were verified by Southern hybridation with tetL, pcp, or ISS1 probes (data not shown). Both plasmids were integrated into the chromosome in multiple copies. In addition to the removal of the amplification units of the pCL307 and pCL311 plasmids, the introduction of pGh-Cre into the double integrant led to chromosomal inversion in 50% of the cell population, as determined by the ratio of hybridization signals from fragments that signed the inverted or parental structure (Fig. 5, lane 1), and parental- or inverted-type strains were easily isolated after elimination of the pGh-Cre plasmid (Fig. 5, lanes 2 and 3).

View larger version (36K): [in this window] [in a new window]

FIG. 5. Hybridization of ApaI-digested chromosomes with the tetL probe after separation by PFGE (electrophoresis conditions were 10 V/cm and 7 s of pulse time for 13 h). Lanes: M, lambda DNA concatemer size standards; L, HindIII-digested lambda DNA; 1, CL307/5-311 x pGh-Cre in permissive replication conditions; 2, parental-type strain isolated after pGh-Cre curing; 3, inverted-type strain isolated after pGh-Cre curing. Hybridization was performed in the presence of 32P-labeled lambda DNA. The letter I corresponds to the ApaI fragment that signs the inverted structure, whereas P corresponds to the ApaI fragment characteristic of the parental structure.

Second, a 1,115-kb inversion, which largely modifies the length of the two replication arms by shifting the terC site at 180 kb to the oriC position (Fig. 2C), was constructed by transforming strain CL307/1 with pCL324 (Fig. 2B), a plasmid able to integrate at the ilv locus of the NZ9000 chromosome. pCL324 was integrated in a single copy into the CL307/1 chromosome (data not shown). Introduction of pGh-Cre into the double integrant led to a recombination event between the different loxP sites, removing the AU of pCL307 from every cell in the population and inverting the chromosomal DNA located between the inverse-order loxP1 and loxP2 sites in 6% of the population (data not shown). The proper chromosomal structures of parental- and inverted-type strains were confirmed by Southern analysis with the tetL ORF as a probe after I-CeuI digestion and separation by PFGE (data not shown).

Effect of the chromosomal inversion on the growth rate in rich medium.
In E. coli and Salmonella enterica serovar Typhimurium, large chromosomal inversions can affect the fitness of the cells to various extents depending on the positions of their endpoints (15, 30, 35). Each inversion constructed in this study was evaluated for a direct effect on cell fitness by comparing the growth rates of the parental- and inverted-type strains in GM17. All inverted-type strains have a reduced growth rate compared to that of their isogenic parental-type counterpart (Table 2), with a decrease in the specific growth rate ranging from 8% for the strains with the 1,160-kb inversion that altered neither the length of the two replication arms nor the location and orientation of genes with respect to oriC to 18% for the strains with the 1,115-kb inversion that largely modified the lengths of the two replication arms.

View this table: [in this window] [in a new window]

TABLE 2. Specific growth rates of L. lactis strains in GM17 medium

Top Abstract Introduction Materials and Methods Results Discussion References

 
With the aim of studying the dynamics of the L. lactis chromosome, we proposed to experimentally construct large inversions from different locations of the chromosome by using the homologous recombination strategy described for Bacillus subtilis (39). Unfortunately, we observed that single crossing-over and transpositional integration of exogenous DNA in L. lactis generally lead to the amplification of the integrated DNA, regardless of the selective marker used (data not shown). Similar observations have been made by different groups (8, 27, 29, 31). As inversions can only be easily obtained if the two targets are both present on the chromosome in single copies, this amplification phenomenon constituted a major drawback. To overcome this difficulty, we devised new genetic tools based on the use of the recombinase Cre from E. coli phage P1 (1) to obtain chromosomal inversions between two inverse-order loxP sites integrated at various positions on the chromosome of L. lactis. Paradoxically, the Cre-loxP recombination system is commonly used to generate efficient chromosomal rearrangements in eukaryotic cell lines and whole organisms (18) but is rarely used to promote in vivo recombination in bacteria (2, 41). In L. lactis, the highest recombination efficiency was obtained without induction of cre and in the absence of selective pressure. This indicates that the basal level of Cre recombinase in the cell, caused by a low level of leakiness of the nisA promoter, is sufficient to promote efficient recombination between the loxP sites, suggesting that very few Cre protein molecules are necessary in the cell to allow the full recombination process. The decrease of the inversion efficiency between the two distal loxP sites observed after overexpression of the cre gene by nisin induction can be explained in light of a recent study which demonstrated that in E. coli, overexpression of the Cre recombinase altered the directionality for recombination, leading to deletion instead of inversion in substrates carrying two loxP sites as inverted repeats (3).

To demonstrate the usefulness of the Cre-loxP recombination system, three large chromosomal inversions have been constructed at different locations in the genome of L. lactis. The first inversion (interval, 307/1-pcp) changes the orientation of one half of the right replication arm without modifying the chromosome symmetry with respect to oriC. The second inversion (interval, 307/1-ilvD) results in strong asymmetrical chromosome replication: the "lower" (counterclockwise-moving) fork replicates about 92% of the chromosome and meets the opposite fork 180 kb from oriC. The last inversion (interval, 307/5-pcp) does not alter the length of the two replication arms or the location or orientation of genes with respect to oriC. All inversions have an effect on the cell fitness compared to that associated with the corresponding isogenic parental structure, with a decrease in growth rate ranging from 8 to 18% depending on the extent of the chromosome disorganization. Experimentation involving additional large-scale inversions with endpoints located at various sites on the chromosome and investigation of the genetic behavior of these rearrangements (by monitoring their stability) as well as of their phenotypic consequences for cell fitness (by directly comparing the growth rates of isogenic parental- and inverted-type strains in different culture conditions) should provide data on the constraints acting to preserve the lactococcal genome organization.

The Cre-loxP recombination system has several major advantages over the other strategies used to generate genome rearrangements in bacteria. First, the recombination efficiency is high enough for an easy recovery of rearranged clones without any selection system and seemed to be independent of the nature of the chromosomal DNA to be inverted. Thus, it can potentially be used for generating rearrangements in any region of the bacterial chromosome. Second, the efficiency of Cre-mediated recombination does not depend on the length of the DNA fragment located between the two inverted loxP sites, because 500-, 1,115-, and 1,160-kb inversions were easily obtained. These results contrast with those found for eukaryotic cells, in which the recombination frequencies decrease as the genetic distance between the two loxP sites increases (42). Third, the Cre recombinase does not need any host factors or additional processes for catalyzing the complete recombination between the loxP sites, in contrast to what has been observed for S. enterica serovar Typhimurium, in which inversions generated by a homologous recombination mechanism require the RecA and RecBCD proteins (36) and thus may proceed through extensive DNA replication (19).

In conclusion, the Cre-loxP recombination system described in this paper appears to be a powerful tool for purposes such as control of the copy number of integrated exogenous DNA in gene expression investigations or shuffling of the bacterial chromosome (by deletions or inversions) for applied and fundamental genome studies. This recombination system can potentially be used in other gram-positive species without further modifications, since all of the components described here (selectable markers, ISS1 insertion sequence, and pGhost replicon) are functional in alternative gram-positive bacteria (9, 31).

 
This work was supported by grants from the Centre National de la Recherche Scientifique (UMR5100), the Region Midi-Pyrénées (RECH 97002182), and the EC BIOTECH program (BIO4-CT96-0498). N. Campo was supported by a fellowship from the Ministère de l'Enseignement Supérieur et de la Recherche.

We thank M. Dias, A. Edelman, and M. J. Pillaire for helping to improve the manuscript.

 
* Corresponding author. Mailing address: LMGM du CNRS, Université Paul Sabatier, 118 route de Narbonne, 31062 Toulouse Cedex, France. Phone: (33) 561 33 58 25. Fax: (33) 561 33 58 86. E-mail: ritzenth{at}ibcg.biotoul.fr.

This paper is dedicated to the memory of Patrick Duwat (5 January 2000).

Present address: Biomade Technology Foundation, Mijenbergh 4, 9747 AG Groningen, The Netherlands.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Abremski, K., R. Hoess, and N. Sternberg. 1983. Studies on the properties of P1 site-specific recombination: evidence for topologically unlinked products following recombination. Cell 32:1301-1311.[CrossRef][Medline]
2
2. Altier, C., and M. Suyemoto. 1999. A recombinase-based selection of differentially expressed bacterial genes. Gene 240:99-106.[CrossRef][Medline]
3
3. Aranda, M., C. Kanellopoulou, N. Christ, M. Peitz, K. Rajewsky, and P. Droge. 2001. Altered directionality in the Cre-loxP site-specific recombination pathway. J. Mol. Biol. 311:453-459.[CrossRef][Medline]
4
4. Barekzi, N., K. Beinlich, T. T. Hoang, X. Q. Pham, R. Karkhoff-Schweizer, and H. P. Schweizer. 2000. High-frequency Flp recombinase-mediated inversions of the oriC-containing region of the Pseudomonas aeruginosa genome. J. Bacteriol. 182:7070-7074.[Abstract/Free Full Text]
5
5. Bolotin, A., P. Wincker, S. Mauger, O. Jaillon, K. Malarme, J. Weissenbach, S. D. Ehrlich, and A. Sorokin. 2001. The complete genome sequence of the lactic acid bacterium Lactococcus lactis ssp. lactis IL1403. Genome Res. 11:731-753.[Abstract/Free Full Text]
6
6. Broach, J. R., V. R. Guarascio, and M. Jayaram. 1982. Recombination within the yeast plasmid 2µ circle is site-specific. Cell 29:227-234.[CrossRef][Medline]
7
7. Casjens, S. 1998. The diverse and dynamic structure of bacterial genomes. Annu. Rev. Genet. 32:339-377.[CrossRef][Medline]
8
8. Chopin, M. C., A. Chopin, A. Rouault, and N. Galleron. 1989. Insertion and amplification of foreign genes in the Lactococcus lactis subsp. lactis chromosome. Appl. Environ. Microbiol. 55:1769-1774.[Abstract/Free Full Text]
9
9. Claverys, J. P., A. Dintilhac, E. V. Pestova, B. Martin, and D. A. Morrison. 1995. Construction and evaluation of new drug-resistance cassettes for gene disruption mutagenesis in Streptococcus pneumoniae, using an ami test plaform. Gene 164:123-128.[CrossRef][Medline]
10
10. Davidson, B. E., N. Kordias, M. Dobos, and A. J. Hillier. 1996. Genomic organization of lactic acid bacteria, p. 65-87. In G. Venema, J. H. J. Huis in’t Veld, and J. Hugenholtz (ed.), Lactic acid bacteria: genetics, metabolism and applications. Kluwer Academic Publishers, Dordrecht, The Netherlands.
11
11. de Ruyter, P. G., O. P. Kuipers, M. M. Beerthuyzen, I. J. van Alen-Boerrigter, and W. M. de Vos. 1996. Functional analysis of promoters in the nisin gene cluster of Lactococcus lactis. J. Bacteriol. 178:3434-3439.[Abstract/Free Full Text]
12
12. Gasson, M. J. 1983. Plasmid complements of Streptococcus lactis NCDO712 and other lactic streptococci after protoplast-induced curing. J. Bacteriol. 154:1-9.[Abstract/Free Full Text]
13
13. Glaser, P., L. Frangeul, C. Buchrieser, C. Rusniok, A. Amend, F. Baquero, P. Berche, H. Bloecker, P. Brandt, T. Chakraborty, A. Charbit, F. Chetouani, E. Couve, A. de Daruvar, P. Dehoux, E. Domann, G. Dominguez-Bernal, E. Duchaud, L. Durant, O. Dussurget, K. D. Entian, H. Fsihi, F. G. Portillo, P. Garrido, L. Gautier, W. Goebel, N. Gomez-Lopez, T. Hain, J. Hauf, D. Jackson, L. M. Jones, U. Kaerst, J. Kreft, M. Kuhn, F. Kunst, G. Kurapkat, E. Madueno, A. Maitournam, J. M. Vicente, E. Ng, H. Nedjari, G. Nordsiek, S. Novella, B. de Pablos, J. C. Perez-Diaz, R. Purcell, B. Remmel, M. Rose, T. Schlueter, N. Simoes, A. Tierrez, J. A. Vazquez-Boland, H. Voss, J. Wehland, and P. Cossart. 2001. Comparative genomics of Listeria species. Science 294:849-852.[Abstract/Free Full Text]
14
14. Hasan, N., M. Koob, and W. Szybalski. 1994. Escherichia coli genome targeting. I. Cre-lox-mediated in vitro generation of ori^- plasmids and their in vivo chromosomal integration and retrieval. Gene 150:51-56.[CrossRef][Medline]
15
15. Hill, C. W., and J. A. Gray. 1988. Effects on chromosomal inversion on cell fitness in Escherichia coli K-12. Genetics 119:771-778.[Abstract/Free Full Text]
16
16. Huang, L. C., E. A. Wood, and M. M. Cox. 1991. A bacterial model system for chromosomal targeting. Nucleic Acids Res. 19:443-448.[Abstract/Free Full Text]
17
17. Janssen, P. J., B. Audit, and C. A. Ouzounis. 2001. Strain-specific genes of Helicobacter pylori: distribution, function and dynamics. Nucleic Acids Res. 29:4395-4404.[Abstract/Free Full Text]
18
18. Kilby, N. J., M. R. Snaith, and J. A. Murray. 1993. Site-specific recombinases: tools for genome engineering. Trends Genet. 9:413-421.[CrossRef][Medline]
19
19. Kogoma, T. 1996. Recombination by replication. Cell 85:625-627.[CrossRef][Medline]
20
20. Kuipers, O. P., M. M. Beerthuyzen, R. J. Siezen, and W. M. de Vos. 1993. Characterization of the nisin gene cluster nisABTCIPR of Lactococcus lactis. Requirement of expression of the nisA and nisI genes for development of immunity. Eur. J. Biochem. 216:281-291.[Medline]
21
21. Kuipers, O. P., P. G. de Ruyter, and M. Kleerebezem. 1998. Quorum sensing-controlled gene expression in lactic acid bacteria. J. Biotechnol. 64:15-21.
22
22. LeBlanc, D. J., L. N. Lee, and J. M. Inamine. 1991. Cloning and nucleotide base sequence analysis of a spectinomycin adenyltransferase AAD(9) determinant from Enterococcus faecalis. Antimicrob. Agents Chemother. 35:1804-1810.[Abstract/Free Full Text]
23
23. Le Bourgeois, P., M. L. Daveran-Mingot, and P. Ritzenthaler. 2000. Genome plasticity among related Lactococcus strains: identification of genetic events associated with macrorestriction polymorphisms. J. Bacteriol. 182:2481-2491.[Abstract/Free Full Text]
24
24. Le Bourgeois, P., P. Langella, and P. Ritzenthaler. 2000. Electrotransformation of Lactococcus lactis, p. 56-65. In J. Teissié and N. Eynard (ed.), Electrotransformation of bacteria, Springer lab manual. Springer, Heidelberg, Germany.
25
25. Le Bourgeois, P., M. Lautier, M. Mata, and P. Ritzenthaler. 1992. New tools for the physical and genetic mapping of Lactococcus strains. Gene 111:109-114.[CrossRef][Medline]
26
26. Le Bourgeois, P., M. Lautier, L. van den Berghe, M. J. Gasson, and P. Ritzenthaler. 1995. Physical and genetic map of the Lactococcus lactis subsp. cremoris MG1363 chromosome: comparison with that of Lactococcus lactis subsp. lactis IL1403 reveals a large genome inversion. J. Bacteriol. 177:2840-2850.[Abstract/Free Full Text]
27
27. Leenhouts, K. J., A. Bolhuis, G. Venema, and J. Kok. 1998. Construction of a food-grade multiple-copy integration system for Lactococcus lactis. Appl. Microbiol. Biotechnol. 49:417-423.[CrossRef][Medline]
28
28. Leenhouts, K. J., G. Buist, A. Bolhuis, A. ten Berge, J. Kiel, I. Mierau, M. Dabrowska, G. Venema, and J. Kok. 1996. A general system for generating unlabelled gene replacements in bacterial chromosomes. Mol. Gen. Genet. 253:217-224.[CrossRef][Medline]
29
29. Leenhouts, K. J., J. Kok, and G. Venema. 1989. Campbell-like integration of heterologous plasmid DNA into the chromosome of Lactococcus lactis subsp. lactis. Appl. Environ. Microbiol. 55:394-400.[Abstract/Free Full Text]
30
30. Louarn, J. M., J. P. Bouché, F. Legendre, J. Louarn, and J. Patte. 1985. Characterization and properties of very large inversions of the E. coli chromosome along the origin-to-terminus axis. Mol. Gen. Genet. 201:467-476.[CrossRef][Medline]
31
31. Maguin, E., H. Prévots, S. D. Ehrlich, and A. Gruss. 1996. Efficient insertional mutagenesis in lactococci and other gram-positive bacteria. J. Bacteriol. 178:931-935.[Abstract/Free Full Text]
32
32. Martin, B., G. Alloing, V. Méjean, and J. P. Claverys. 1987. Constitutive expression of erythromycin resistance mediated by the ermAM determinant of plasmid pAMß1 results from deletion of 5' leader peptide sequences. Plasmid 18:250-253.[CrossRef][Medline]
33
33. Rebollo, J. E., V. François, and J. M. Louarn. 1988. Detection and possible role of two large nondivisible zones on the Escherichia coli chromosome. Proc. Natl. Acad. Sci. USA 85:9391-9395.[Abstract/Free Full Text]
34
34. Rocha, E. P., A. Danchin, and A. Viari. 1999. Universal replication biases in bacteria. Mol. Microbiol. 32:11-16.[CrossRef][Medline]
35
35. Segall, A. M., M. J. Mahan, and J. R. Roth. 1988. Rearrangement of the bacterial chromosome: forbidden inversions. Science 241:1314-1318.[Abstract/Free Full Text]
36
36. Segall, A. M., and J. R. Roth. 1994. Approaches to half-tetrad analysis in bacteria: recombination between repeated, inverse-order chromosomal sequences. Genetics 136:27-39.[Abstract]
37
37. Stassi, D. L., P. Lopez, M. Espinosa, and S. A. Lacks. 1981. Cloning of chromosomal genes in Streptococcus pneumoniae. Proc. Natl. Acad. Sci. USA 78:7028-7032.[Abstract/Free Full Text]
38
38. Terzaghi, B. E., and W. E. Sandine. 1975. Improved medium for lactic streptococci and their bacteriophages. Appl. Microbiol. 29:807-813.
39
39. Toda, T., T. Tanaka, and M. Itaya. 1996. A method to invert DNA segments of the Bacillus subtilis 168 genome by recombination between homologous sequences. Biosci. Biotech. Biochem. 60:773-778.[Medline]
40
40. van der Vossen, J. M., D. van der Lelie, and G. Venema. 1987. Isolation and characterization of Streptococcus cremoris Wg2-specific promoters. Appl. Environ. Microbiol. 53:2452-2457.[Abstract/Free Full Text]
41
41. Yoon, Y. G., J. H. Cho, and S. C. Kim. 1998. Cre/loxP-mediated excision and amplification of large segments of the Escherichia coli genome. Genet. Anal. 14:89-95.[Medline]
42
42. Zheng, B., M. Sage, E. A. Sheppeard, V. Jurecic, and A. Bradley. 2000. Engineering mouse chromosomes with Cre-loxP: range, efficiency, and somatic applications. Mol. Cell. Biol. 20:648-655.[Abstract/Free Full Text]

---

Applied and Environmental Microbiology, May 2002, p. 2359-2367, Vol. 68, No. 5
0099-2240/02/$04.00+0     DOI: 10.1128/AEM.68.5.2359-2367.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Bouvier, J., Stragier, P., Morales, V., Remy, E., Gutierrez, C. (2008). Lysine Represses Transcription of the Escherichia coli dapB Gene by Preventing Its Activation by the ArgP Activator. J. Bacteriol. 190: 5224-5229 [Abstract] [Full Text]  
• Bachmann, H., Kleerebezem, M., van Hylckama Vlieg, J. E. T. (2008). High-Throughput Identification and Validation of In Situ-Expressed Genes of Lactococcus lactis. Appl. Environ. Microbiol. 74: 4727-4736 [Abstract] [Full Text]  
• Banerjee, A., Biswas, I. (2008). Markerless Multiple-Gene-Deletion System for Streptococcus mutans. Appl. Environ. Microbiol. 74: 2037-2042 [Abstract] [Full Text]  
• Leibig, M., Krismer, B., Kolb, M., Friede, A., Gotz, F., Bertram, R. (2008). Marker Removal in Staphylococci via Cre Recombinase and Different lox Sites. Appl. Environ. Microbiol. 74: 1316-1323 [Abstract] [Full Text]  
• Lambert, J. M., Bongers, R. S., Kleerebezem, M. (2007). Cre-lox-Based System for Multiple Gene Deletions and Selectable-Marker Removal in Lactobacillus plantarum. Appl. Environ. Microbiol. 73: 1126-1135 [Abstract] [Full Text]  
• Pomerantsev, A. P., Sitaraman, R., Galloway, C. R., Kivovich, V., Leppla, S. H. (2006). Genome Engineering in Bacillus anthracis Using Cre Recombinase. Infect. Immun. 74: 682-693 [Abstract] [Full Text]  
• Suzuki, N., Nonaka, H., Tsuge, Y., Inui, M., Yukawa, H. (2005). New Multiple-Deletion Method for the Corynebacterium glutamicum Genome, Using a Mutant lox Sequence. Appl. Environ. Microbiol. 71: 8472-8480 [Abstract] [Full Text]  
• Bron, P. A., Grangette, C., Mercenier, A., de Vos, W. M., Kleerebezem, M. (2004). Identification of Lactobacillus plantarum Genes That Are Induced in the Gastrointestinal Tract of Mice. J. Bacteriol. 186: 5721-5729 [Abstract] [Full Text]  
• Bron, P. A., Benchimol, M. G., Lambert, J., Palumbo, E., Deghorain, M., Delcour, J., de Vos, W. M., Kleerebezem, M., Hols, P. (2002). Use of the alr Gene as a Food-Grade Selection Marker in Lactic Acid Bacteria. Appl. Environ. Microbiol. 68: 5663-5670 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Campo, N. Articles by Le Bourgeois, P. Search for Related Content PubMed PubMed Citation Articles by Campo, N. Articles by Le Bourgeois, P. Agricola Articles by Campo, N. Articles by Le Bourgeois, P.