This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fraser, J. A.
Right arrow Articles by Hynes, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fraser, J. A.
Right arrow Articles by Hynes, M. J.
Agricola
Right arrow Articles by Fraser, J. A.
Right arrow Articles by Hynes, M. J.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, June 2002, p. 2802-2808, Vol. 68, No. 6
0099-2240/02/$04.00+0     DOI: 10.1128/AEM.68.6.2802-2808.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

A Gene from Aspergillus nidulans with Similarity to URE2 of Saccharomyces cerevisiae Encodes a Glutathione S-Transferase Which Contributes to Heavy Metal and Xenobiotic Resistance

James A. Fraser, Meryl A. Davis, and Michael J. Hynes*

Department of Genetics, University of Melbourne, Victoria 3010, Australia

Received 2 November 2001/ Accepted 20 March 2002


arrow
ABSTRACT
 
Aspergillus nidulans is a saprophytic ascomycete that utilizes a wide variety of nitrogen sources. We identified a sequence from A. nidulans similar to the glutathione S-transferase-like nitrogen regulatory domain of Saccharomyces cerevisiae Ure2. Cloning and sequencing of the gene, designated gstA, revealed it to be more similar to URE2 than the S. cerevisiae glutathione S-transferases. However, creation and analysis of a gstA deletion mutant revealed that the gene does not participate in nitrogen metabolite repression. Instead, it encodes a functional theta class glutathione S-transferase that is involved in resistance to a variety of xenobiotics and metals and confers susceptibility to the systemic fungicide carboxin. Northern analysis showed that gstA transcription is strongly activated upon exposure to 1-chloro-2,4-dinitrobenzene and weakly activated by oxidative stress or growth on galactose as a carbon source. These results suggest that nitrogen metabolite repression in A. nidulans does not involve a homolog of the S. cerevisiae URE2 gene and that the global nitrogen regulatory system differs significantly in these two fungi.


arrow
INTRODUCTION
 
The ascomycete Aspergillus nidulans is particularly robust, with resistance to many xenobiotics, high tolerance to changes in temperature and pH, and the ability to utilize a wide range of carbon and nitrogen sources. An important feature of these responses is the ability to tightly regulate the expression of specific subsets of genes under different environmental conditions. For example, synthesis of molecules which are effective only at acidic or at alkaline pH is restricted to environments of the appropriate acidity through the action of the zinc finger-containing transcriptional regulator PacC (28, 29). A similar restriction is observed for genes required for the utilization of a wide variety of nitrogen sources. The presence of the preferred nitrogen source ammonium or L-glutamine prevents the expression of many catabolic enzymes required for the utilization of more complex nitrogen sources (for a review, see reference 50). In A. nidulans this regulation, termed nitrogen metabolite repression, is mediated via the positively acting GATA zinc finger transcription factor AreA (7, 41). In response to nitrogen limitation, AreA activates expression through the consensus sequence HGATAR in the promoters of genes encoding proteins required for the catabolism of secondary nitrogen sources (75). Loss-of-function areA mutants are thus unable to grow on nitrogen sources other than ammonium (7, 36, 37, 41).

Regulation of AreA function occurs at multiple levels. The expression of areA is controlled by autogenous regulation of transcription and reduced transcript stability during nitrogen sufficiency through an element in the 3' untranslated region of the transcript (43, 55, 58). AreA activity is negatively affected by NmrA, a homolog of the Neurospora crassa NMR1 protein which interacts with the zinc finger and carboxyl-terminal residues of the AreA homolog NIT2 (4, 24, 77). Deletion of the C-terminal amino acids of AreA partially relieves nitrogen metabolite repression, while almost complete relief of repression is obtained when the mRNA stability-affecting element in the 3' untranslated region (UTR) of the areA transcript also is mutated (58). A low level of nitrogen metabolite repression is still observed in this double mutant, which suggests that a third mechanism for regulating AreA activity may exist.

Relief of nitrogen catabolite repression in the budding yeast Saccharomyces cerevisiae is dependent on the GATA factors Gln3 and Nil1/Gat1 (16, 53, 54, 66). These factors show little homology to AreA at the C-terminal end, the region with which NmrA is proposed to interact. Consistent with this finding, the S. cerevisiae genome does not encode a recognizable homolog of NmrA. Instead, the activation of genes involved in secondary nitrogen source catabolism by Gln3 and Nil1 is modulated by interaction with the Ure2 protein. Protein phosphorylation via the Tor signal transduction pathway allows Ure2 to retain Gln3 and Nil1 in the cytoplasm during nitrogen sufficiency (9, 10, 13). Nuclear exclusion of these positively acting GATA factors allows the expression of nitrogen-metabolic genes to be tightly controlled. There is no genetic or molecular evidence at present for the existence of a URE2 homolog in A. nidulans.

Cloning of the URE2 gene revealed it to be constitutively expressed and to encode a small protein with an asparagine-rich N terminus (residues 1 to 65) which allows the protein to form the non-Mendelian genetic element [URE3] (18, 25, 73). [URE3] is an inactive, prion form of Ure2, with strains carrying this self-propagating amyloid form displaying phenotypes equivalent to those of ure2 loss-of-function mutants, i.e., a loss of nitrogen catabolite repression of various nitrogen-regulated activities. The remainder of the protein is required for nitrogen catabolite repression via Gln3, shows sequence similarity to the members of the glutathione S-transferase (GST) superfamily, and binds glutathione despite an absence of detectable GST activity (12, 14, 18, 51). GSTs (EC 2.5.1.18) are mainly cytosolic, multifunctional detoxification enzymes that mediate the conjugation of the reduced form of the tripeptide glutathione to many exogenous and endogenous hydrophobic electrophiles. These substrates are typically aliphatic, aromatic, or heterocyclic and are difficult for the cell to detoxify. The ligation of a glutathione moiety to such cytotoxic agents is believed to confer a common structural determinant and increase their water solubility, allowing their glutathione conjugate forms to be actively transported to the vacuole (46).

Although analysis of GSTs in higher eukaryotes has been extensive, fungal GSTs have not been as well studied. Early work revealed that the activities of fungal GSTs varied considerably between species, with low specific activities typically measured with the universal GST substrate 1-chloro-2,4-dinitrobenzene (CDNB) (44). It is likely that this low activity occurs because most fungal GSTs belong to the theta class of enzymes, which usually exhibit low activity with this substrate (52). Two true GSTs, Gtt1 and Gtt2, have been identified in S. cerevisiae, and they show a low level of similarity to Ure2 or to each other (14).

Our objective in this study was to clone a gene from A. nidulans (designated gstA) that has higher sequence similarity to URE2 than either GTT1 or GTT2. Our studies have revealed that the gene has no detectable role in nitrogen metabolite repression but contributes to resistance to xenobiotics and heavy metals, indicating that it probably encodes a functional theta class GST.


arrow
MATERIALS AND METHODS
 
A. nidulans strains, growth media, and transformation.
Growth media and conditions were as described by Cove (19). Nitrogen sources were used at a final concentration of 10 mM and carbon sources were used at 1% (wt/vol), unless stated otherwise. Genetic analysis was performed with the techniques of Clutterbuck (15). The A. nidulans strains used in this study are given in Table 1. A. nidulans protoplast preparation and DNA transformation were performed by the method of Andrianopoulos et al. (3). DNA for transformation of A. nidulans was isolated using the High Purity Plasmid kit (Roche), and genomic DNA was prepared as described by Lee and Taylor (45). Cultures for RNA extraction were grown for 16 h at 37°C in 1% glucose-Aspergillus nitrogen-free minimal medium (ANM) with 10 mM ammonium tartrate.


View this table:
[in this window]
[in a new window]
 
TABLE 1. A. nidulans strains used in this study

Molecular techniques.
Standard methods were as described by Sambrook et al. (63). Restriction enzymes (Promega) were used with the supplied buffers. DNA fragments were purified from agarose gels using the Agarose Gel DNA Extraction Kit (Boehringer Mannheim). RNA was isolated from A. nidulans cultures using the RNA Red Fast Prep kit (BIO 101) and electrophoresed on a formamide-containing 1.2% agarose denaturing gel, followed by blotting to an H bond N+ nylon membrane (Amersham) with 40 mM NaOH. PCR was performed using primers ure2a (CCTTACCTACCTCGCTGAGC) and ure2b (CCTCCCAAGCCTTAAGATGC).

Construction of gstA plasmids.
An 8-kb XhoI fragment from bacterial artificial chromosome (BAC) 16E08 was subcloned into pBluescript SK(+) (pJAF4858) and further subcloned as a 2.8-kb NotI/XhoI fragment (pJAF4989). The gstA deletion plasmid pJAF5084 was created by inserting a 2.3-kb SmaI/BglII riboB+ fragment from pPL1 (56) into pJAF4989 digested with BglII and SnaBI, disrupting exon 3. The 4.5-kb SalI/XhoI gstA::riboB+ fragment was inserted into pJAF4858 digested with SalI to give pJAF5086, increasing the flanking genomic sequence.

Nucleotide sequence accession number.
The gstA sequence has been deposited in GenBank under accession number AF425746.


arrow
RESULTS
 
Cloning of an A. nidulans gene with homology to S. cerevisiae URE2.
A search of the University of Oklahoma A. nidulans expressed sequence tag (EST) database (www.genome.ou.edu/fungal.html) with the S. cerevisiae Ure2 sequence revealed multiple ESTs (f1a11a1.r1, z4 h02a1.f1, and z4 h02a1.r1) with identity to the yeast protein. The PCR primers ure2a and ure2b were designed based upon these sequences and used to amplify a 365-bp fragment from A. nidulans genomic DNA. The fragment was used to probe an A. nidulans genomic BAC library high-density filter (kindly provided by Ralph Dean, Department of Plant Pathology and Physiology, Clemson University, Clemson, S.C.), resulting in multiple positive clones. Based upon genomic Southern blots, a hybridizing 8-kb XhoI fragment was subcloned from one of the hybridizing clones (BAC clone 16E08) into pBluescript SK(+) to give pJAF4858, which was in turn subcloned as a 2.8-kb NotI/XhoI fragment, creating pJAF4989. Probing of genomic Southern blots at low stringency failed to show cross-hybridization with any related URE2-like sequences (not shown).

Sequence analysis of gstA.
Sequencing of the insert of pJAF4989 revealed a single region in the center of the clone with sequence similarity to GSTs. With the aid of the available ESTs, the gene (designated gstA) was determined to contain two introns and to encode a predicted 250-amino-acid product. Comparison (22) to yeast proteins revealed that the encoded protein more closely resembled Ure2 (47% similarity and 35% identity) than the two characterized S. cerevisiae GSTs Gtt1 and Gtt2 (35% similarity and 24% identity and 35% similarity and 25% identity, respectively), indicating that this gene might be a URE2 ortholog. The predicted GstA sequence lacked an asparagine-rich N terminus, which functions as a prion-forming domain in Ure2 (residues 1 to 94) (30, 68). Database searches revealed higher similarity to several GST-like sequences, only one of which has been characterized. Identity was highest to the protein GST1 from the plant pathogen Botrytis cinerea (73%) (60), with lower identity to uncharacterized GST-like sequences in the genomes of N. crassa (68%) (sequence contig 1.1301, assembly version 1, Neurospora Sequencing Project) and Candida albicans (48%, sequence contig 6-2410, unfinished fragment of complete C. albicans genome).

A second unpublished GST-like sequence from C. albicans (accession no. AF260777) with a much higher level of similarity to S. cerevisiae Ure2 has already been identified as having Ure2-like sequences from Saccharomyces douglassi (AF260775) and Kluyveromyces lactis (AF260776). As with S. cerevisiae Ure2, these all contain the long asparagine-rich prion forming N terminus, in addition to a conserved 27-residue insertion in the center of the GST-like nitrogen regulatory domain. Both of these features are lacking in A. nidulans GstA and the GstA-like sequences from B. cinerea, N. crassa, and C. albicans. The fact that both gstA and URE2 homologs exist in C. albicans suggests that A. nidulans gstA is not an ortholog of URE2.

GstA resembles a theta class GST.
GSTs have been classified based on substrate specificity, antibody cross-reactivity, crystal structure, and amino acid sequence data into five main classes: alpha, mu, pi, sigma, and theta (35, 48, 52, 62). The low level of similarity of GstA to most characterized GSTs suggests that the A. nidulans enzyme belongs to the theta class, as this is the most heterogenous class. Comparison to the structurally derived consensus pattern for theta class GSTs confirmed this designation, with only 7 deviations from 35 consensus residues (62). The most significant of these differences is in one of six theta class-specific residues with the conservative change of serine to threonine at position 13. Mutagenesis studies and analysis of crystal structures have shown that this is the catalytic residue required for glutathione ligation in theta class enzymes (11, 74). Significantly, Rossjohn et al. (62) found deviation at this position only in GST-like proteins that have no detectable GST activity (LIGF from Pseudomonas paucimobilis, SSP1 from Escherichia coli, SSP2 from Haemophilus sommus, and Ure2 from S. cerevisiae). One possibility is that in A. nidulans threonine 13 is responsible for activation of glutathione by promoting thiolate formation. Alternatively, tyrosine 9 may participate in the binding of the sulfhydryl moiety of glutathione instead, as occurs in the alpha, mu, and pi classes (39, 47, 49, 57, 67).

GstA does not play a role in nitrogen metabolite repression.
A gstA deletion strain was generated by homologous recombination of a disruption construct (pJAF5086) in which the 148-bp BglII/StuI fragment in exon 3 was replaced with the riboB+ selectable marker, disrupting the gene after codon 91. To allow more sensitive testing for potential nitrogen-regulatory phenotypes, the recipient strain MH9870 carried the nmrA{Delta} (4) and areA-{Delta}UTR5 (an areA 3'UTR deletion [59]) alleles. pJAF5086 was linearized with XhoI, and transformants were selected for riboflavin prototrophy. Analysis by Southern blotting of 40 Ribo+ transformants revealed a gstA knockout frequency of 35%. One such transformant (MH9985) was selected for further study.

Several studies have used a variety of plate tests to qualitatively determine nitrogen metabolite repression of several activities required for the utilization of poor nitrogen sources. One such approach is the detection of increased sensitivity to toxic nitrogen source analogs in the presence of a repressing nitrogen source (4, 58). A comparison between gstA{Delta} and gstA+ strains was performed using areA-{Delta}UTR5, nmrA{Delta}, and otherwise wild-type backgrounds (strains are described in Table 1). gstA deletion strains showed sensitivity to 200 mM potassium chlorate (a toxic analog of nitrate) equivalent to that of gstA+ strains in the presence of 5 mM ammonium tartrate. Growth tests on 5 mM thiourea (a toxic analog of urea) with 2.5 mM ammonium tartrate also failed to show any difference in sensitivity (not shown). Inappropriate derepression of extracellular proteases has previously been shown to cause a halo of milk clearing on plates containing 1% skim milk (Diploma) with 10 mM ammonium tartrate (17). This test also failed to show any difference from the gstA+ phenotype in the equivalent gstA{Delta} strains (not shown). These plate assays strongly suggest that gstA plays no role in the global regulation of genes involved in the utilization of poor nitrogen sources.

The acetamidase enzyme, encoded by the amdS gene, allows growth on acetamide as a carbon and/or nitrogen source by producing ammonium and acetate. Regulation of amdS expression is complex, involving multiple induction signals as well as control by carbon and nitrogen metabolites (for a review, see reference 38). By crossing the gstA{Delta} mutant with various amdS::lacZ reporter strains (20), we were able to determine whether gstA played a role in nitrogen metabolite repression. Comparison of amdS::lacZ expression in wild-type (MH3408) and gstA{Delta} (MH9986) strains in cultures grown overnight with either 10 mM ammonium tartrate (a repressing nitrogen source) or 10 mM alanine (a limiting nitrogen source) showed that deletion of gstA had no effect (Table 2). Similarly no effect on expression of amdS::lacZ was observed following transfer of ammonium-grown mycelium to minimal medium lacking a nitrogen source for 4 h. Furthermore, deletion of gstA did not affect amdS::lacZ regulation in genetic backgrounds with altered nitrogen metabolite repression (areA-{Delta}UTR5 [MH9987]; nmrA{Delta} [MH9988], and areA-{Delta}UTR5 nmrA{Delta} [MH9989]) (Table 2). Therefore, no role for gstA in nitrogen metabolite repression was detected.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Effects of gstA{Delta} on amdS::lacZ expressiona

GstA contributes to resistance to multiple xenobiotics and heavy metals.
The absence of a nitrogen-regulatory role for GstA suggested that despite the higher identity to Ure2 than to the S. cerevisiae GSTs Gtt1 and Gtt2, this gene might encode a true GST. In agreement with this, a strain carrying the gstA{Delta} allele (MH9986) showed increased sensitivity to the antimicrobial phenylpyrrole derivative pyrrolnitrin [3-chloro-4-(2'-nitro-3'-chloro-phenyl)pyrrole], a compound that inhibits the electron transport system in N. crassa (6, 27), at 10 µg/ml. The deletion mutant also grew more poorly than the wild type in the presence of sulfanilamide (at 50 µg/ml) or oxidative stress induced by diamide (0.2 µl/ml) compared to the wild-type strain MH1 (Fig. 1A) (40, 72). No difference in sensitivity was apparent when the mutant strain was grown in the presence of the toxic molecule CDNB (5 µg/ml), a common GST substrate (44).



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 1. Phenotypes of the gstA deletion strain (gstA{Delta}) (MH9986) and the wild-type strain (WT) (MH1). Colonies were grown on 1% glucose-ANM supplemented with 10 mM ammonium tartrate for 2 days at 37°C. Xenobiotics (A) and heavy metals (B) were added at the indicated concentrations. Metals were added as salts (selenium as Na2SeO3, silver as AgNO3, and nickel as NiSO4).

Surprisingly, growth tests in the presence of various heavy metals revealed that the gstA{Delta} mutant had increased sensitivity relative to the wild type. The mutant strain exhibited poor growth in the presence of 2 mM selenium (as Na2SeO3) and, to a lesser extent, in the presence of 0.1 mM silver (as AgNO3) and 2 mM nickel (as NiSO4) (Fig. 1B). Work with S. cerevisiae has revealed that a glutathione S-conjugate pump contributes to heavy metal resistance (31, 46, 61). These data suggest that the same is true in A. nidulans.

In contrast to the susceptibility to other xenobiotics and heavy metals, the gstA{Delta} strain showed increased resistance to the systemic fungicide carboxin (5,6-dihydro-2-methyl-1,4-oxathiin-3-carboxanilide) at 10 µg/ml, with increased conidiation and denser colonial growth. Mutations in three different loci, i.e., carA (cbxB), carB (cbxC), and carC (cbxA), have previously been reported to confer resistance to carboxin in A. nidulans (32, 71). One of these loci may correspond to gstA.

Transformation of the riboB2 homozygous diploid strain MH6590 allowed the creation of a gstA{Delta} heterozygous strain (MH9951). Haploidization using the techniques described by Clutterbuck (15) revealed that the gstA gene maps to linkage group III, the same linkage group as carC. Unfortunately a strain carrying this mutation was unavailable for further analysis, so we were unable to determine whether carC and gstA are the same gene.

Regulation of gstA expression.
Transcriptional regulation of gstA was consistent with the gene encoding a GST required in the presence of toxic compounds and oxidative stress. Treatment with 40 µg of CDNB per ml for 1 h resulted in very strong activation of gstA transcription, despite the apparent failure of this hydrophobic electrophile to be a GstA substrate (Fig. 2). Overexposure revealed a low level of transcriptional activation in response to oxidative stress caused by 5 mM H2O2, but this was not seen during growth on 10 mM uric acid as a nitrogen source, catabolism of which produces H2O2 (64). Neither osmotic shock (0.5 M NaCl) nor heat shock (45°C for 1 h) led to an increase in expression. Surprisingly, slightly increased transcript levels were observed following growth overnight on galactose as a carbon source. Alteration of the quality of the available nitrogen source by overnight growth on 10 mM alanine rather than 10 mM ammonium tartrate revealed no alteration in expression, indicating that gstA transcription is unaffected by nitrogen metabolite repression (Fig. 2).



View larger version (45K):
[in this window]
[in a new window]
 
FIG. 2. Northern blot analysis of gstA transcription. RNA was isolated from A. nidulans strain MH1. Mycelium was grown in 1% glucose-10 mM ammonium tartrate medium at 37°C for 16 h unless an alternative carbon or nitrogen source is specified. Subsequent treatments were for 1 h. Northern blots were hybridized with probes specific for gstA or A. nidulans histone H3 as a loading control (26). The nitrogen source used was 10 mM ammonium tartrate (except for the alanine [10 mM] and uric acid [10 mM] cultures), and the carbon source was 1% glucose (except for the 1% galactose culture). Heat shock at 45°C and treatment with H2O2 (5 mM), NaCl (0.5 M), or CDNB (40 µg/ml) were for 1 h to cultures pregrown for 16 h at 37°C. The CDNB treatment lane was underloaded, as shown by the histone loading control. The last two lanes show shorter exposures (2 days rather than 11 days) of the CDNB and uric acid treatments.


arrow
DISCUSSION
 
Nitrogen metabolite repression in both A. nidulans and S. cerevisiae involves GATA factors activating the expression of genes required for the catabolism of secondary nitrogen sources. Recent advances in the understanding of this global regulatory response in yeast center on the ability of Ure2 to control the subcellular localization of Gln3 and Nil1/Gat1 and hence their function (9, 10, 13). Unpublished Ure2-like sequences (accession numbers AF260777, AF260775, and AF260776) have already been identified in other yeasts, suggesting that this regulatory mechanism may be conserved. These fungi are all more closely related to S. cerevisiae than to Aspergillus species (70).

This study has provided information that strongly suggests that the A. nidulans nitrogen global regulatory circuit does not include a Ure2 homolog. The genome of N. crassa has recently become available (corresponding to a depth of greater than 10 times, with an estimated coverage of 97% [www-genome.wi.mit.edu]), and searches of this database failed to reveal a Ure2-like sequence. Furthermore, recent studies (42) have shown that the first 300 residues N terminal of Gln3, a region which is not conserved in AreA or in NIT2 of N. crassa, are required for interaction with Ure2. Additional evidence for fundamental differences in regulation of nitrogen catabolism between S. cerevisiae and filamentous fungi is given by the lack of a homolog of nmrA/nmr-1 in the genome sequence of S. cerevisiae.

An analysis by Lau et al. (44) failed to detect GST activity in A. nidulans, in agreement with many studies which have suggested that fungal GSTs either are highly labile or fail to exhibit activities with the classical GST substrate CDNB. Although this suggests that most fungal GSTs belong to the theta class (a class which is partly defined by lack of activity with this substrate), fungal GSTs of different classes from multiple organisms have been partially characterized (23, 65). The fact that GstA appears to belong to the theta class supports the findings of Lau et al. (44), as does the failure of the gstA{Delta} mutation to alter growth in the presence of CDNB. Although transcription of gstA is highly induced by CDNB, this may be a consequence of this molecule being highly toxic to the cell, and its presence could be expected to elicit a strong stress-related response.

GstA also contributes to metal detoxification, as evidenced by the sensitivity to selenium, silver, and nickel of strains lacking an intact copy of gstA. In S. cerevisiae resistance to heavy metals is affected by the activity of yeast cadmium factor 1 (Ycf1p), an ATP-dependent glutathione S-conjugate pump with broad substrate specificity (31, 46, 61). ycf1 mutants are defective in vacuolar sequestration of glutathione S-conjugates and are more susceptible to organic xenobiotics, heavy metals, and cytotoxic drugs. Ycf1p belongs to the ABC superfamily of transporters, several of which have already been identified in A. nidulans (1, 2, 5, 21). It is therefore probable that a member of this family functions in the same manner as Ycf1p in conjunction with GstA in heavy metal sequestration. Although there is presently no evidence implicating the yeast GSTs, Gtt1 and Gtt2, in heavy metal tolerance, it is likely that they are involved.

The functions and substrate specificities of fungal GSTs constitute a rich and unexplored field that promises insights into xenobiotic metabolism, a subject of both pharmacological and agronomic interest. The contribution of GST activity to insecticide detoxification in several insect species has been recognized (33, 34). The role of GSTs in fungicide resistance may also be important, particularly in the cases of emerging fungal pathogens with reduced antimicrobial susceptibility and the development of resistance in existing pathogenic strains (for reviews, see references 8 and 69). GST activity provides one of several mechanisms (including altered targets, decreased drug accumulation, increase of cell damage repair, and increased drug inactivation) that may render cells refractory to cytotoxic agents (76).


arrow
ACKNOWLEDGMENTS
 
J.A.F. was a recipient of an Australian Postgraduate Award. This work was supported by a grant from the Australian Research Council. The predicted N. crassa GST sequence was identified via the Neurospora Sequencing Project, Whitehead Institute/MIT Center for Genome Research (www-genome.wi.mit.edu). The C. albicans predicted GST sequence was generated at the Stanford DNA Sequencing and Technology Center with the support of the NIDR and the Burroughs Wellcome Fund.

We thank Ralph A. Dean for providing the A. nidulans genomic BAC library.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Genetics, University of Melbourne, Victoria 3010, Australia. Phone: (61) (3) 8344 6246. Fax: (61) (3) 8344 5139. E-mail: mjhynes{at}unimelb.edu.au. Back


arrow
REFERENCES
 
    1
  1. Andrade, A. C., G. Del Sorbo, J. G. van Nistelrooy, and M. A. de Waard. 2000. The ABC transporter AtrB from Aspergillus nidulans mediates resistance to all major classes of fungicides and some natural toxic compounds. Microbiology 146:1987-1997.[Abstract/Free Full Text]
  2. 2
  3. Andrade, A. C., J. G. van Nistelrooy, R. B. Peery, P. L. Skatrud, and M. A. de Waard. 2000. The role of ABC transporters from Aspergillus nidulans in protection against cytotoxic agents and in antibiotic production. Mol. Gen. Genet. 263:966-977.[CrossRef][Medline]
  4. 3
  5. Andrianopoulos, A., and M. J. Hynes. 1988. Cloning and analysis of the positively acting regulatory gene amdR from Aspergillus nidulans. Mol. Cell. Biol. 8:3532-3541.[Abstract/Free Full Text]
  6. 4
  7. Andrianopoulos, A., S. Kourambas, J. A. Sharp, M. A. Davis, and M. J. Hynes. 1998. Characterization of the Aspergillus nidulans nmrA gene involved in nitrogen metabolite repression. J. Bacteriol. 180:1973-1977.[Abstract/Free Full Text]
  8. 5
  9. Angermayr, K., W. Parson, G. Stoffler, and H. Haas. 1999. Expression of atrC—encoding a novel member of the ATP binding cassette transporter family in Aspergillus nidulans—is sensitive to cycloheximide. Biochim. Biophys. Acta 1453:304-310.[Medline]
  10. 6
  11. Arima, K., H. Imanaka, M. Kousaka, A. Fukuta, and G. Tamura. 1964. Pyrrolnitrin, a new antibiotic substance, produced by Pseudomonas. Agric. Biol. Chem. 28:575-576.
  12. 7
  13. Arst, H. N., Jr., and D. J. Cove. 1973. Nitrogen metabolite repression in Aspergillus nidulans. Mol. Gen. Genet. 126:111-141.[CrossRef][Medline]
  14. 8
  15. Bastert, J., M. Schaller, H. C. Korting, and E. G. Evans. 2001. Current and future approaches to antimycotic treatment in the era of resistant fungi and immunocompromised hosts. Int. J. Antimicrob. Agents 17:81-91.[CrossRef][Medline]
  16. 9
  17. Beck, T., and M. N. Hall. 1999. The TOR signalling pathway controls nuclear localization of nutrient-regulated transcription factors. Nature 402:689-692.[CrossRef][Medline]
  18. 10
  19. Bertram, P. G., J. H. Choi, J. Carvalho, W. Ai, C. Zeng, T. F. Chan, and X. F. Zheng. 2000. Tripartite regulation of Gln3 by TOR, Ure2, and phosphatases. J. Biol. Chem. 275:35727-35733.[Abstract/Free Full Text]
  20. 11
  21. Board, P. G., M. Coggan, M. C. Wilce, and M. W. Parker. 1995. Evidence for an essential serine residue in the active site of the Theta class glutathione transferases. Biochem. J. 311:247-250.
  22. 12
  23. Bousset, L., H. Belrhali, R. Melki, and S. Morera. 2001. Crystal structures of the yeast prion Ure2p functional region in complex with glutathione and related compounds. Biochemistry 40:13564-13573.[CrossRef][Medline]
  24. 13
  25. Cardenas, M. E., N. S. Cutler, M. C. Lorenz, C. J. Di Como, and J. Heitman. 1999. The TOR signaling cascade regulates gene expression in response to nutrients. Genes Dev. 13:3271-3279.[Abstract/Free Full Text]
  26. 14
  27. Choi, J. H., W. Lou, and A. Vancura. 1998. A novel membrane-bound glutathione S-transferase functions in the stationary phase of the yeast Saccharomyces cerevisiae. J. Biol. Chem. 273:29915-29922.[Abstract/Free Full Text]
  28. 15
  29. Clutterbuck, J. A. 1974. Aspergillus nidulans genetics, p. 447-510. In R. C. King (ed.), Handbook of genetics, vol. 1. Plenum Publishing Corp., New York, N.Y.
  30. 16
  31. Coffman, J. A., R. Rai, T. Cunningham, V. Svetlov, and T. G. Cooper. 1996. Gat1, a GATA family protein whose production is sensitive to nitrogen catabolite repression, participates in transcriptional activation of nitrogen-catabolic genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 16:847-858.[Abstract]
  32. 17
  33. Cohen, B. L. 1972. Ammonium repression of extracellular proteases in Aspergillus nidulans. J. Gen. Microbiol. 71:293-299.
  34. 18
  35. Coschigano, P. W., and B. Magasanik. 1991. The URE2 gene product of Saccharomyces cerevisiae plays an important role in the cellular response to the nitrogen source and has homology to glutathione S-transferases. Mol. Cell. Biol. 11:822-832.[Abstract/Free Full Text]
  36. 19
  37. Cove, D. J. 1966. The induction and repression of nitrate reductase in the fungus Aspergillus nidulans. Biochim. Biophys. Acta 113:51-56.[Medline]
  38. 20
  39. Davis, M. A., C. S. Cobbett, and M. J. Hynes. 1988. An amdS-lacZ fusion for studying gene regulation in Aspergillus. Gene 63:199-212.[CrossRef][Medline]
  40. 21
  41. Del Sorbo, G., A. C. Andrade, J. G. van Nistelrooy, J. A. van Kan, E. Balzi, and M. A. De Waard. 1997. Multidrug resistance in Aspergillus nidulans involves novel ATP-binding cassette transporters. Mol. Gen. Genet. 254:417-426.[CrossRef][Medline]
  42. 22
  43. Devereuax, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395.
  44. 23
  45. Dowd, C. A., C. M. Buckley, and D. Sheehan. 1997. Glutathione S-transferases from the white-rot fungus, Phanerochaete chrysosporium. Biochem. J. 324:243-248.
  46. 24
  47. Dunn-Coleman, N. S., A. B. Tomsett, and R. H. Garrett. 1981. The regulation of nitrate assimilation in Neurospora crassa: biochemical analysis of the nmr-1 mutants. Mol. Gen. Genet. 182:234-239.[CrossRef][Medline]
  48. 25
  49. Edskes, H. K., V. T. Gray, and R. B. Wickner. 1999. The [URE3] prion is an aggregated form of Ure2p that can be cured by overexpression of Ure2p fragments. Proc. Natl. Acad. Sci. USA 96:1498-1503.[Abstract/Free Full Text]
  50. 26
  51. Ehinger, A., S. H. Denison, and G. S. May. 1990. Sequence, organization and expression of the core histone genes of Aspergillus nidulans. Mol. Gen. Genet. 222:416-424.[CrossRef][Medline]
  52. 27
  53. el-Banna, N., and G. Winkelmann. 1998. Pyrrolnitrin from Burkholderia cepacia: antibiotic activity against fungi and novel activities against streptomycetes. J. Appl. Microbiol. 85:69-78.[CrossRef][Medline]
  54. 28
  55. Espeso, E. A., and H. N. Arst, Jr. 2000. On the mechanism by which alkaline pH prevents expression of an acid-expressed gene. Mol. Cell. Biol. 20:3355-3363.[Abstract/Free Full Text]
  56. 29
  57. Espeso, E. A., T. Roncal, E. Diez, L. Rainbow, E. Bignell, J. Alvaro, T. Suarez, S. H. Denison, J. Tilburn, H. N. Arst, Jr., and M. A. Penalva. 2000. On how a transcription factor can avoid its proteolytic activation in the absence of signal transduction. EMBO J. 19:719-728.[CrossRef][Medline]
  58. 30
  59. Fernandez-Bellot, E., E. Guillemet, and C. Cullin. 2000. The yeast prion [URE3] can be greatly induced by a functional mutated URE2 allele. EMBO J. 19:3215-3222.[CrossRef][Medline]
  60. 31
  61. Ghosh, M., J. Shen, and B. P. Rosen. 1999. Pathways of As(III) detoxification in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 96:5001-5006.[Abstract/Free Full Text]
  62. 32
  63. Gunatilleke, I. A., H. N. Arst, Jr., and C. Scazzocchio. 1975. Three genes determine the carboxin sensitivity of mitochondrial succinate oxidation in Aspergillus nidulans. Genet. Res. 26:297-305.[Medline]
  64. 33
  65. Hemingway, J. 2000. The molecular basis of two contrasting metabolic mechanisms of insecticide resistance. Insect Biochem. Mol. Biol. 30:1009-1015.[CrossRef][Medline]
  66. 34
  67. Hemingway, J., and H. Ranson. 2000. Insecticide resistance in insect vectors of human disease. Annu. Rev. Entomol. 45:371-391.[CrossRef][Medline]
  68. 35
  69. Hiratsuka, A., N. Sebata, K. Kawashima, H. Okuda, K. Ogura, T. Watabe, K. Satoh, I. Hatayama, S. Tsuchida, T. Ishikawa, et al. 1990. A new class of rat glutathione S-transferase Yrs-Yrs inactivating reactive sulfate esters as metabolites of carcinogenic arylmethanols. J. Biol. Chem. 265:11973-11981.[Abstract/Free Full Text]
  70. 36
  71. Hynes, M. J. 1972. Mutants with altered glucose repression of amidase enzymes in Aspergillus nidulans. J. Bacteriol. 111:717-722.[Abstract/Free Full Text]
  72. 37
  73. Hynes, M. J. 1975. Studies on the role of the areA gene in the regulation of nitrogen catabolism in Aspergillus nidulans. Aust. J. Biol. Sci. 28:301-313.[Medline]
  74. 38
  75. Hynes, M. J., and M. A. Davis. 1996. Regulation of acetamide catabolism, p. 381-394. In G. A. Marzluf and R. Brambl (ed.), The Mycota, vol. 3. Springer-Verlag, Berlin, Germany.
  76. 39
  77. Kong, K. H., M. Nishida, H. Inoue, and K. Takahashi. 1992. Tyrosine-7 is an essential residue for the catalytic activity of human class PI glutathione S-transferase: chemical modification and site-directed mutagenesis studies. Biochem. Biophys. Res. Commun. 182:1122-1129.[CrossRef][Medline]
  78. 40
  79. Kosower, N. S., and E. M. Kosower. 1987. Formation of disulfides with diamide. Methods Enzymol. 143:264-270.[Medline]
  80. 41
  81. Kudla, B., M. X. Caddick, T. Langdon, N. M. Martinez-Rossi, C. F. Bennett, S. Sibley, R. W. Davies, and H. N. Arst, Jr. 1990. The regulatory gene areA mediating nitrogen metabolite repression in Aspergillus nidulans. Mutations affecting specificity of gene activation alter a loop residue of a putative zinc finger. EMBO J. 9:1355-1364.[Medline]
  82. 42
  83. Kulkarni, A. A., A. T. Abul-Hamd, R. Rai, H. El Berry, and T. G. Cooper. 2001. Gln3 nuclear localization and interaction with Ure2 in Saccharomyces cerevisiae. J. Biol. Chem. 276:32136-32144.[Abstract/Free Full Text]
  84. 43
  85. Langdon, T., A. Sheerins, A. Ravagnani, M. Gielkens, M. X. Caddick, and H. N. Arst, Jr. 1995. Mutational analysis reveals dispensability of the N-terminal region of the Aspergillus transcription factor mediating nitrogen metabolite repression. Mol. Microbiol. 17:877-888.[CrossRef][Medline]
  86. 44
  87. Lau, E. P., L. Niswander, D. Watson, and R. R. Fall. 1980. Glutathione-S-transferase is present in a variety of microorganisms. Chemosphere 9:565-569.[CrossRef]
  88. 45
  89. Lee, S., and J. Taylor. 1990. Isolation of DNA from fungal mycelia and single spores, p. 282-287. In M. A. Innis, D. H. Gelfand, and T. J. White (ed.), PCR protocols: a guide to methods and applications. Academic Press, San Diego, Calif.
  90. 46
  91. Li, Z. S., Y. P. Lu, R. G. Zhen, M. Szczypka, D. J. Thiele, and P. A. Rea. 1997. A new pathway for vacuolar cadmium sequestration in Saccharomyces cerevisiae: YCF1-catalyzed transport of bis(glutathionato)cadmium. Proc. Natl. Acad. Sci. USA 94:42-47.[Abstract/Free Full Text]
  92. 47
  93. Liu, S., P. Zhang, X. Ji, W. W. Johnson, G. L. Gilliland, and R. N. Armstrong. 1992. Contribution of tyrosine 6 to the catalytic mechanism of isoenzyme 3-3 of glutathione S-transferase. J. Biol. Chem. 267:4296-4299.[Abstract/Free Full Text]
  94. 48
  95. Mannervik, B., P. Alin, C. Guthenberg, H. Jensson, M. K. Tahir, M. Warholm, and H. Jornvall. 1985. Identification of three classes of cytosolic glutathione transferase common to several mammalian species: correlation between structural data and enzymatic properties. Proc. Natl. Acad. Sci. USA 82:7202-7206.[Abstract/Free Full Text]
  96. 49
  97. Manoharan, T. H., A. M. Gulick, R. B. Puchalski, A. L. Servais, and W. E. Fahl. 1992. Structural studies on human glutathione S-transferase pi. Substitution mutations to determine amino acids necessary for binding glutathione. J. Biol. Chem. 267:18940-18945.[Abstract/Free Full Text]
  98. 50
  99. Marzluf, G. A. 1997. Genetic regulation of nitrogen metabolism in the fungi. Microbiol. Mol. Biol. Rev. 61:17-32.[Abstract]
  100. 51
  101. Masison, D. C., and R. B. Wickner. 1995. Prion-inducing domain of yeast Ure2p and protease resistance of Ure2p in prion-containing cells. Science 270:93-95.[Abstract/Free Full Text]
  102. 52
  103. Meyer, D. J., B. Coles, S. E. Pemble, K. S. Gilmore, G. M. Fraser, and B. Ketterer. 1991. Theta, a new class of glutathione transferases purified from rat and man. Biochem. J. 274:409-414.
  104. 53
  105. Minehart, P. L., and B. Magasanik. 1991. Sequence and expression of GLN3, a positive nitrogen regulatory gene of Saccharomyces cerevisiae encoding a protein with a putative zinc finger DNA-binding domain. Mol. Cell. Biol. 11:6216-6228.[Abstract/Free Full Text]
  106. 54
  107. Mitchell, A. P., and B. Magasanik. 1984. Regulation of glutamine-repressible gene products by the GLN3 function in Saccharomyces cerevisiae. Mol. Cell. Biol. 4:2758-2766.[Abstract/Free Full Text]
  108. 55
  109. Morozov, I. Y., M. G. Martinez, M. G. Jones, and M. X. Caddick. 2000. A defined sequence within the 3' UTR of the areA transcript is sufficient to mediate nitrogen metabolite signalling via accelerated deadenylation. Mol. Microbiol. 37:1248-1257.[CrossRef][Medline]
  110. 56
  111. Oakley, C. E., C. F. Weil, P. L. Kretz, and B. R. Oakley. 1987. Cloning of the riboB locus of Aspergillus nidulans. Gene 53:293-298.[CrossRef][Medline]
  112. 57
  113. Penington, C. J., and G. S. Rule. 1992. Mapping the substrate-binding site of a human class mu glutathione transferase using nuclear magnetic resonance spectroscopy. Biochemistry 31:2912-2920.[CrossRef][Medline]
  114. 58
  115. Platt, A., T. Langdon, H. Arst, D. Kirk, D. Tollervey, J. M. Sanchez, and M. X. Caddick. 1996. Nitrogen metabolite signalling involves the C-terminus and the GATA domain of the Aspergillus transcription factor AreA and the 3' untranslated region of its mRNA. EMBO J. 15:2791-2801.[Medline]
  116. 59
  117. Platt, A., A. Ravagnani, H. Arst, Jr., D. Kirk, T. Langdon, and M. X. Caddick. 1996. Mutational analysis of the C-terminal region of AreA, the transcription factor mediating nitrogen metabolite repression in Aspergillus nidulans. Mol. Gen. Genet. 250:106-114.[Medline]
  118. 60
  119. Prins, T. W., L. Wagemakers, A. Schouten, and J. A. L. van Kan. 2000. Cloning and characterization of a glutathione S-transferase homologue from the plant pathogenic fungus Botrytis cinerea. Mol. Plant Pathol. 1:169-178.[CrossRef]
  120. 61
  121. Rebbeor, J. F., G. C. Connolly, M. E. Dumont, and N. Ballatori. 1998. ATP-dependent transport of reduced glutathione on YCF1, the yeast orthologue of mammalian multidrug resistance associated proteins. J. Biol. Chem. 273:33449-33454.[Abstract/Free Full Text]
  122. 62
  123. Rossjohn, J., P. G. Board, M. W. Parker, and M. C. Wilce. 1996. A structurally derived consensus pattern for theta class glutathione transferases. Protein Eng. 9:327-332.[Abstract/Free Full Text]
  124. 63
  125. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  126. 64
  127. Scazzocchio, C. 1994. The purine degradation pathway, genetics, biochemistry and regulation, p. 221-257. In S. D. Martinelli and J. R. Kinghorn (ed.), Aspergillus: 50 years on. Elsevier Science, Amsterdam, The Netherlands.
  128. 65
  129. Sheehan, D., and J. P. Casey. 1993. Evidence for alpha and Mu class glutathione S-transferases in a number of fungal species. Comp. Biochem. Physiol. B 104:7-13.[CrossRef][Medline]
  130. 66
  131. Stanbrough, M., D. W. Rowen, and B. Magasanik. 1995. Role of the GATA factors Gln3 and Nil1 of Saccharomyces cerevisiae in the expression of nitrogen-regulated genes. Proc. Natl. Acad. Sci. USA 92:9450-9454.[Abstract/Free Full Text]
  132. 67
  133. Stenberg, G., P. G. Board, and B. Mannervik. 1991. Mutation of an evolutionarily conserved tyrosine residue in the active site of a human class Alpha glutathione transferase. FEBS Lett. 293:153-155.[CrossRef][Medline]
  134. 68
  135. Taylor, K. L., N. Cheng, R. W. Williams, A. C. Steven, and R. B. Wickner. 1999. Prion domain initiation of amyloid formation in vitro from native Ure2. Science 283:1339-1343.[Abstract/Free Full Text]
  136. 69
  137. van Burik, J. A., and P. T. Magee. 2001. Aspects of fungal pathogenesis in humans. Annu. Rev. Microbiol. 55:743-772.[CrossRef][Medline]
  138. 70
  139. van de Peer, Y., L. Hendriks, A. Goris, J. M. Neefs, M. Vancanneyt, K. Kersters, J. F. Berny, G. L. Hennebert, and R. De Wachter. 1992. Evolution of basidiomycetous yeasts as deduced from small ribosomal subunit RNA sequences. Syst. Appl. Microbiol. 15:250-258.
  140. 71
  141. van Tuyl, J. M. 1975. Acquired resistance to carboxin in Aspergillus nidulans. Neth. J. Plant Pathol. 81:122-123.[CrossRef]
  142. 72
  143. Vora, M. R., and D. V. Tamhane. 1966. Action of sulphanilamide in Neurospora: growth inhibition studies with wild and cholineless mutant strains of N. crassa. Indian J. Biochem. 3:83-86.[Medline]
  144. 73
  145. Wickner, R. B. 1994. [URE3] as an altered URE2 protein: evidence for a prion analog in Saccharomyces cerevisiae. Science 264:566-569.[Abstract/Free Full Text]
  146. 74
  147. Wilce, M. C., P. G. Board, S. C. Feil, and M. W. Parker. 1995. Crystal structure of a theta-class glutathione transferase. EMBO J. 14:2133-2143.[Medline]
  148. 75
  149. Wilson, R. A., and H. N. Arst, Jr. 1998. Mutational analysis of AreA, a transcriptional activator mediating nitrogen metabolite repression in Aspergillus nidulans and a member of the "streetwise" GATA family of transcription factors. Microbiol. Mol. Biol. Rev. 62:586-596.[Abstract/Free Full Text]
  150. 76
  151. Wilson, T. G. 2001. Resistance of Drosophila to toxins. Annu. Rev. Entomol. 46:545-571.[CrossRef][Medline]
  152. 77
  153. Xiao, X., Y. H. Fu, and G. A. Marzluf. 1995. The negative-acting NMR regulatory protein of Neurospora crassa binds to and inhibits the DNA-binding activity of the positive-acting nitrogen regulatory protein NIT2. Biochemistry 34:8861-8868.[CrossRef][Medline]


Applied and Environmental Microbiology, June 2002, p. 2802-2808, Vol. 68, No. 6
0099-2240/02/$04.00+0     DOI: 10.1128/AEM.68.6.2802-2808.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Sato, I., Shimizu, M., Hoshino, T., Takaya, N. (2009). The Glutathione System of Aspergillus nidulans Involves a Fungus-specific Glutathione S-Transferase. J. Biol. Chem. 284: 8042-8053 [Abstract] [Full Text]  
  • Todd, R. B., Fraser, J. A., Wong, K. H., Davis, M. A., Hynes, M. J. (2005). Nuclear Accumulation of the GATA Factor AreA in Response to Complete Nitrogen Starvation by Regulation of Nuclear Export. Eukaryot Cell 4: 1646-1653 [Abstract] [Full Text]  
  • Fitzgibbon, G. J., Morozov, I. Y., Jones, M. G., Caddick, M. X. (2005). Genetic Analysis of the TOR Pathway in Aspergillus nidulans. Eukaryot Cell 4: 1595-1598 [Abstract] [Full Text]  
  • Davis, M. A., Askin, M. C., Hynes, M. J. (2005). Amino Acid Catabolism by an areA-Regulated Gene Encoding an L-Amino Acid Oxidase with Broad Substrate Specificity in Aspergillus nidulans. Appl. Environ. Microbiol. 71: 3551-3555 [Abstract] [Full Text]  
  • Canovas, D., Vooijs, R., Schat, H., de Lorenzo, V. (2004). The Role of Thiol Species in the Hypertolerance of Aspergillus sp. P37 to Arsenic. J. Biol. Chem. 279: 51234-51240 [Abstract] [Full Text]  
  • Bai, M., Zhou, J.-M., Perrett, S. (2004). The Yeast Prion Protein Ure2 Shows Glutathione Peroxidase Activity in Both Native and Fibrillar Forms. J. Biol. Chem. 279: 50025-50030 [Abstract] [Full Text]  
  • Rai, R., Tate, J. J., Cooper, T. G. (2003). Ure2, a Prion Precursor with Homology to Glutathione S-Transferase, Protects Saccharomyces cerevisiae Cells from Heavy Metal Ion and Oxidant Toxicity. J. Biol. Chem. 278: 12826-12833 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fraser, J. A.
Right arrow Articles by Hynes, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fraser, J. A.
Right arrow Articles by Hynes, M. J.
Agricola
Right arrow Articles by Fraser, J. A.
Right arrow Articles by Hynes, M. J.