AEM
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, S.-C.
Right arrow Articles by Wong, S.-L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, S.-C.
Right arrow Articles by Wong, S.-L.
Agricola
Right arrow Articles by Wu, S.-C.
Right arrow Articles by Wong, S.-L.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, July 2002, p. 3261-3269, Vol. 68, No. 7
0099-2240/02/$04.00+0     DOI: 10.1128/AEM.68.7.3261-3269.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Functional Production and Characterization of a Fibrin-Specific Single-Chain Antibody Fragment from Bacillus subtilis: Effects of Molecular Chaperones and a Wall-Bound Protease on Antibody Fragment Production

Sau-Ching Wu,1 Jonathan C. Yeung,1 Yanjun Duan,1 Ruiqiong Ye,1 Steven J. Szarka,1,{dagger} Hamid R. Habibi,2 and Sui-Lam Wong1*

Division of Cellular, Molecular and Microbial Biology,1 Division of Zoology, Department of Biological Sciences, University of Calgary, Calgary, Alberta T2N 1N4, Canada2

Received 29 November 2001/ Accepted 9 April 2002


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
To develop an ideal blood clot imaging and targeting agent, a single-chain antibody (SCA) fragment based on a fibrin-specific monoclonal antibody, MH-1, was constructed and produced via secretion from Bacillus subtilis. Through a systematic study involving a series of B. subtilis strains, insufficient intracellular and extracytoplasmic molecular chaperones and high sensitivity to wall-bound protease (WprA) were believed to be the major factors that lead to poor production of MH-1 SCA. Intracellular and extracytoplasmic molecular chaperones apparently act in a sequential manner. The combination of enhanced coproduction of both molecular chaperones and wprA inactivation leads to the development of an engineered B. subtilis strain, WB800HM[pEPP]. This strain allows secretory production of MH-1 SCA at a level of 10 to 15 mg/liter. In contrast, with WB700N (a seven-extracellular-protease-deficient strain) as the host, no MH-1 SCA could be detected in both secreted and cellular fractions. Secreted MH-1 SCA from WB800HM[pMH1, pEPP] could be affinity purified using a protein L matrix. It retains comparable affinity and specificity as the parental MH-1 monoclonal antibody. This expression system can potentially be applied to produce other single-chain antibody fragments, especially those with folding and protease sensitivity problems.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Fibrin-specific monoclonal antibodies (MAbs) have many practical applications. Since the presence of soluble fibrin in serum is an early indicator of blood clot formation in many thrombotic events, including pulmonary embolism as well as deep venous thrombosis and disseminated intravascular coagulopathy, enzyme-linked immunosorbent assay (ELISA) systems have been developed based on fibrin-specific MAbs as a diagnostic tool to detect these thrombotic disorders (6, 13). Fibrin-specific antibodies also serve as noninvasive imaging agents to locate blood clots and as fibrin targeting agents to deliver blood clot-dissolving agents selectively to the clots (16, 33, 41, 47). For these applications, it would be important to miniaturize intact MAbs (~160 kDa) to single-chain antibody fragments (SCA; ~25 kDa) which retain an intact antigen binding site (7, 19). With a short in vivo half-life, SCA fragments are better suited as imaging agents since excess labeled SCA fragments can be rapidly eliminated from the circulation (8-10, 38). This feature is essential for decreasing the background to the basal level in a short period of time. As targeting agents, fibrin-specific SCA fragments are expected to have better clot penetration capability and would be ideal to serve as targeting domains when fused to clot-dissolving agents. Although several fibrin-specific MAbs have been generated and characterized, many of them suffer from one or more drawbacks, including low affinity to fibrin, binding to fibrin degradation products, variability in reacting with antigens, and recognition of transiently available neoantigens on fibrin (35, 39, 42, 54). Gargan et al. (14) reported the development of a fibrin-specific MAb designated MH-1 with a number of desirable features for imaging and targeting applications. MH-1 binds specifically to fibrin with high affinity (Kd = 6.7 x 10-10 M), even in the presence of a 500-fold molar excess of fibrinogen, and does not react with any fibrin or fibrinogen degradation products.

Production of MH-1 SCA in microbial systems, however, represents a major challenge. It has a strong tendency to form inclusion bodies when expressed in Escherichia coli either intracellularly or via secretion (J. A. McLinden, personal communication). In a previous study using the Bacillus subtilis expression-secretion system, we also encountered the problem of inclusion body formation when we attempted to produce an anti-digoxin SCA (49, 51, 53). We solved the problem by using an engineered B. subtilis strain (53) which coproduces two series of major intracellular molecular chaperones, including GroES/GroEL and DnaK/DnaJ/GrpE, and an extracytoplasmic molecular chaperone, PrSA (24, 25, 46). It would be of interest to determine whether B. subtilis would be a better expression host for producing MH-1 SCA. In this study, we report the construction of engineered B. subtilis strains to successfully produce functional MH-1 SCA fragments via secretion. These strains address two major problems associated with the MH-1 SCA production (namely, slow or improper folding and degradation). The resulting MH-1 SCA fragments were affinity purified and demonstrated to retain specificity and affinity comparable to those of the parental MH-1 MAb.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Construction of pMH-1.
Plasmid pMH-1 is a pWB980 derivative (50) carrying a structural gene encoding the MH-1 SCA fragment for secretory production in B. subtilis. The coding sequences of VL and VH were PCR amplified individually as an EcoRI-SacI fragment (forward primer, 5' GGGAATTCAAGCTTTTGCAGATATCGTGTTAACACAGTCTCCAGCTTCTTTGG 3'; backward primer, 5' GAGAGCTCTTAAGATCTCGAGCTTGGTGCCTCCACCGAAC 3') and a BamHI-SphI fragment (forward primer, 5' GTGGATCCCAAGTTCAGCTGCAGCAGTCAGGACCTGAG 3'; backward primer, 5' GTGCATGCTTATGTCGACACGGTTACCGAGGTTCCTTGACCCC 3') by using plasmid pTF77-7A1#46 (kindly provided by James McLinden, American Biogenetic Sciences, Inc.) as the template. Plasmid pTF77-7A1#46 is an E. coli pKK233 derivative carrying a structural gene of MH-1 SCA for expression in E. coli (Fig. 1). Two PCR primers were designed to generate the linker sequence encoding for a 19-amino acid linker. The 3' end region of the forward primer (5' GTGAGCTCCTAATGGCGCATCTGAATCTGGATCTGCACCTG 3') is complementary to the 3' end region of the backward primer (5' GAGGATCCAGGCGCCGAAGACGTGTCAGGTGCAGATCCAGATTCAG 3'). The annealed primers were extended to full length by a single cycle of PCR to generate a SacI-BamHI fragment. To assemble the structural gene for the MH-1 SCA, each of these VH, linker, and VL sequences was digested with the corresponding pair of restriction enzymes and sequentially inserted into the polylinker region in the E. coli Bluescript vector (pBS). In the first step, the PCR amplified VH fragment was digested with BamHI and SphI and was inserted to the BamHI- and SphI-digested pBS to generate pBS-VH. This vector was then digested with SacI and BamHI and ligated with the SacI- and BamHI-digested linker fragment. The resulting vector was designated pBS-L-VH. Insertion of the EcoRI- and SacI-digested VL fragment to pBS-L-VH generated pBS-MH1 (Fig. 1). The assembled structural gene for the MH-1 SCA was digested from pBS-MH1 with HindIII and SphI and ligated to the B. subtilis secretion vector pWB980 digested with the same pair of restriction enzymes. The resulting plasmid was designated pMH-1 (Fig. 1).



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 1. Construction of pMH-1, a B. subtilis expression vector for secretory production of anti-fibrin SCA fragment. See text for the detailed description of the construction of pMH-1. VL and VH are the variable regions of light and heavy chains of the fibrin specific MAb, respectively. L is the linker sequence. P43 and SP represent the P43 promoter and the levansucrase signal peptide sequence from B. subtilis, respectively.

 
Construction of WB700N, WB700NHM, WB800, and WB800HM.
WB700H is a seven-extracellular-protease-deficient B. subtilis strain (55). Its chromosomal copy of the vpr protease gene was replaced by a modified vpr gene carrying both an internal deletion and the insertion of a hygromycin resistance marker (Table 1). In order to allow the reuse of the hygromycin marker for the disruption of other protease genes in WB700H, a new WB700 strain, designated WB700N (N stands for a new version), was constructed. WB700N carries an internally deleted vpr gene without the insertion of any antibiotic resistance marker (Table 1). This strain was constructed by cotransformation of two plasmids, pE194 and a SphI-linearized p{Delta}VPRBAM (55), to WB700H. Plasmid p{Delta}VPRBAM is an E. coli Bluescript vector carrying a modified vpr gene with an internal deletion and the insertion of a BamHI linker at the site of the internal deletion. Transformants were first selected on erythromycin-lincomycin-containing agar plates (5 µg of erythromycin/ml and 5 µg of lincomycin/ml). They were then checked for the loss of hygromycin resistance by spotting individual colonies to a hygromycin-containing agar plate (100 µg of hygromycin/ml). Those transformants that were unable to grow on hygromycin plates were confirmed to carry an internally deleted vpr gene by PCR amplification with a pair of vpr primers. To eliminate the pE194 plasmid in these cells, cells were cultivated at 42°C because of the inability of pE194 to replicate at high temperatures. After this treatment, a majority of the cells were unable to grow on erythromycin-lincomycin-containing agar plates. One of these colonies was designated WB700N. To construct WB700NHM, a B. subtilis strain that coproduces intracellular molecular chaperones from both groE and dnaK operons without heat shock, WB700N was transformed with a KpnI-linearized integration vector pKS3 (51). This vector is an E. coli Bluescript vector which carries an internally truncated hrcA gene with the insertion of a gentamicin resistance marker at the site of deletion. The KpnI site used for plasmid linearization is located in the polylinker region of the Bluescript vector and is outside of the modified hrcA gene. hrcA encodes a repressor that reduces the expression of both groE and dnaK operons under non-heat shock conditions (56). One of the resulting gentamicin-resistant transformants was designated WB700NHM (Table 1). The replacement of the natural chromosomal hrcA gene in WB700N by the modified hrcA gene was confirmed by PCR amplification with hrcA-specific primers and the overproduction of GroEL and DnaK in a constitutive manner without heat shock. This WB700NHM strain was used for expression studies. WB800 (Table 1) was constructed by the inactivation of the wall-bound protease gene, wprA (30), in the genetic background of WB700N. To disrupt the chromosomal wprA gene, an integration vector, p{Delta}WPRA, was constructed. This is a derivative of the E. coli Bluescript plasmid pBS. A 3.1-kb KpnI-BamHI fragment with the 2.7-kb wprA gene at the central portion of the fragment was generated by PCR using a pair of primers (WPRF, 5' GGGGTACCGGCTCTTTGATAGAGCTG 3'; WPRB, 5' GGGGATCCTGCAGCACTTGCACAGCTTC 3') with the B. subtilis 168 chromosomal DNA as template. A KpnI site and a BamHI site were introduced to the 5' end and the 3' end of the amplified fragment, respectively. Insertion of this fragment into the KpnI and BamHI sites in the polylinker region of pBS generated pBS-WPRA. wprA in pBS-WPRA was disrupted by a double digestion with BglII and EcoRV. This resulted in the deletion of a 465-bp fragment encoding part of WprA. The BglII site of the BglII-EcoRV-digested vector was converted to a blunt end by a fill-in reaction. A 1.5-kb blunt-ended fragment carrying the hygromycin resistance gene (55) was then inserted to the BglII (filled-in)-EcoRV-digested pBS-WPRA to generate p{Delta}WPRA. This vector which has a unique SphI site in the polylinker region of the parental Bluescript vector was linearized by a SphI digestion and transformed to WB700N to generate WB800 (Table 1). Disruption of chromosomal wprA was confirmed by a colony PCR method (52) using Taq DNA polymerase (Amersham Pharmacia Biotech, Baie d’Urfe, Canada). WB800HM was constructed using the same approach for the construction of WB700NHM.


View this table:
[in this window]
[in a new window]
 
TABLE 1. B. subtilis strains used and discussed in this study

 
Production and affinity purification of MH-1 SCA.
Plasmid pEPP (51) is a B. subtilis vector that allows overproduction of PrsA, an extracytoplasmic molecular chaperone (24, 25, 46). WB800HM[pMH-1, pEPP] was cultivated in super-rich medium containing kanamycin (10 µg/ml), erythromycin (5 µg/ml), and lincomycin (5 µg/ml) for 6 to 8 h at 37°C. Culture supernatant was separated from the cells by centrifugation at 8,000 x g for 15 min and passed through a 0.22-µm-pore-size Millipore filter. MH-1 SCA in the filtrate was affinity purified using protein L-agarose (Pierce) according to the manufacturer's instructions. Eluted fractions containing MH-1 SCA (as verified by sodium dodecyl sulfate [SDS]-polyacrylamide gel electrophoresis) were pooled and concentrated by ultrafiltration device (Millipore), and the buffer was changed to 0.05 M sodium phosphate and 0.01 M sodium chloride (pH 6.8). MH-1 SCA was further purified from dimeric and other oligomeric forms by size exclusion chromatography on a Bio-Prep SE-100/17 column (Bio-Rad) calibrated with the gel filtration standard (Bio-Rad) using a Bio-Rad biologic high-resolution protein chromatography system. Eluted fractions were analyzed by SDS-polyacrylamide gel electrophoresis. Fractions containing MH-1 SCA in the monomeric form were pooled and concentrated by ultrafiltration. Purity of the MH-1 SCA was further verified by SDS-polyacrylamide gel electrophoresis followed by staining of the gel with Coomassie blue. Purified MH-1 SCA was quantified spectrophotometrically at 280 nm by using a molar extinction coefficient of 56,140 M-1 cm-1 (15).

Immunospecificity study by ELISA.
The immunospecificity of MH-1 SCA to fibrinogen, non-cross-linked fibrin and cross-linked fibrin was assessed using standard ELISA protocols based on the method described by Gargan et al. (14) with modifications. Human fibrinogen (Sigma) was coated at 5 µg/well onto the surface of a microtiter plate (Falcon PRO-BIND polystyrene plate; Becton Dickinson). Cross-linked fibrin was formed by incubation with 100 µl of thrombin (10 NIH units/ml) in Tris-buffered saline (pH 7.4) containing 10 mM CaCl2 and 7 mM cysteine for 1 h at 37°C. Non-cross-linked fibrin was formed in a similar manner except that 12.5 mM EDTA was used in place of CaCl2. Nonspecific sites were blocked by adding, to each well, 200 µl of bovine serum albumin (3%) in PBST (0.1 M sodium phosphate, 0.15 M sodium chloride, pH 7.2; 0.1% Tween 20). Binding of MH-1 SCA to fibrinogen or fibrin was carried out in a final volume of 100 µl for 3 h at room temperature. Horseradish peroxidase-conjugated protein L (protein L-HRP; ACTIgen) was used as the detection agent. The amount of protein L-HRP that was bound was assessed using 1-Step ABTS (Pierce) as the HRP substrate. The rate of color development was monitored at 405 nm by using a microplate reader (CERES 900; Bio-Tek Instruments, Inc.).

Dissociation constant determination of MH-1 SCA.
The dissociation constants of MH-1 SCA for both cross-linked and non-cross-linked fibrin were determined by Scatchard analysis following standard ELISA protocols. Immobilized fibrin was prepared as described above. Bovine serum albumin (3% in PBST) was used as the blocking agent. The concentrations of purified monomeric MH-1 SCA used in this study ranged from 0 to 6 µg/ml. The binding conditions were the same as those described above. After three washes with wash buffer (PBST) to remove the unbound MH-1 SCA, the amount of MH-1 SCA bound to fibrin at a particular MH-1 SCA concentration was determined in reference to a MH-1 SCA standard curve. This curve was generated by coating known amounts of MH-1 SCA directly onto a Falcon PRO-BIND plate and quantification of bound MH-1 SCA by protein L-HRP. Three independent experiments were carried out with cross-linked fibrin. A plot of [MH-1]bound/[MH-1]free to [MH-1]bound was found to be linear with a slope of -1/Kd, where Kd is the dissociation constant of MH-1 SCA for fibrin.

Matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry.
Purified MH-1 SCA fragment was prepared in 5 mM ammonium acetate, pH 7.5, at a concentration of 10 pmol/µl for molecular mass determination using a Perseptive Biosystems (Framingham, Mass.) Voyager-DE STR mass spectrometer calibrated with myoglobin (m/z 16952) and its dimer (m/z 33904). This instrument was operated in the linear mode, and the acquisition range was 3,000 to 40,000 Da. This analysis was performed at the National Research Council in Saskatchewan, Canada.

Other methods.
Vent DNA polymerase (New England BioLabs) was used for all DNA amplification reactions. The sequences of all PCR products were confirmed to be free of PCR errors by nucleotide sequencing based on the dideoxy method using a T7 sequencing kit from Amersham Pharmacia Biotech. SDS-polyacrylamide gel electrophoresis followed standard procedure based on the Laemmli system. Western blotting was done on a nitrocellulose membrane using protein L-HRP (ACTIgen) as the probing agent and 4-chloro-1-naphthol (Bio-Rad) as the color development agent. N-terminal sequencing of secreted MH-1 SCA transblotted to polyvinylidene difluoride (PVDF) membrane (31) was performed by the protein sequencing unit at the University of British Columbia. The production yield of MH-1 SCA in the culture supernatant was quantified using the approach previously described (51).


    RESULTS AND DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Design and construction of structural gene encoding MH-1 SCA.
The structural gene of the MH-1 SCA fragment was assembled by generating VL, linker, and VH sequences as individual modules (Fig. 1). Although it is quite common to have VH at the N-terminal position in many SCA constructs, it has been reported in several cases that the presence of VH at the N-terminal position can severely affect both the production yield and biological activities of SCA fragments (2, 4, 7, 45). Either mistranslation (32) or interference by the presence of a positively charged residue at the N terminus of VH (4) has been suggested to account for some of these observations. Therefore, the variable domains of MH-1 SCA were arranged in the order of VL-linker-VH. Since the first four (DIVL) and three (QVQ) amino acid residues at the N-terminal conserved framework regions of light and heavy chain variable domains, respectively, were missing in the original MH-1 SCA template, these residues were reintroduced back to the B. subtilis version of MH-1 SCA at the nucleotide level by PCR. A 19-amino-acid linker (PNGASESGSAPDTSSAPGS) with a nonrepetitive sequence was designed based on modifications of linker sequences reported by Hennecke et al. (17). Proline residues located close to the two ends introduce turns to link the variable domains while internal proline and glycine help generate random flexible structure in the linker region. Polar (Ser and Thr) and negatively charged (Asp and Glu) residues were introduced to increase the hydrophilicity of the linker. Lysine residues were avoided because residual proteases from the protease-deficient B. subtilis WB700 strain cleave lysine-rich linker sequences efficiently (Q. Lian and S.-L. Wong, unpublished data). Since SCA fragments with linker sequences shorter than 12 to 15 amino acids have a tendency to form oligomers (12), the linker sequence used in this study was extended from the traditional 15 amino acids to 19 amino acids. This version of MH-1 SCA fragment was inserted to pWB980 (50) to generate pMH-1 (Fig. 1). The P43 promoter and the B. subtilis levansucrase signal sequence in the vector were applied to mediate the transcription and secretion processes.

Construction of B. subtilis WB700NHM and its effect on MH-1 SCA production.
We have developed a new seven-extracellular-protease-deficient B. subtilis strain, WB700N (Table 1), for secretory production of foreign proteins (55). This strain was initially used as the expression host for MH-1 SCA production. To our surprise, analysis of both the culture supernatant and intracellular fraction revealed failure of WB700N[pMH-1] to produce a detectable level of MH-1 SCA fragments (data not shown). This result is very different from the case of secretory production of an anti-digoxin SCA fragment from a six-extracellular-protease-deficient B. subtilis strain, WB600B (51-53). In that study, the anti-digoxin SCA fragment was found to be secreted into the culture medium up to 5 mg/liter although a high percentage of the SCA fragments synthesized were accumulated in the cytoplasm as inclusion bodies. To determine whether enhanced coproduction of molecular chaperones can improve the production of MH-1 SCA, a WB700NHM strain was constructed to overproduce the intracellular molecular chaperones which include GroES/GroEL and DnaK/DnaJ/GrpE. Increased production of intracellular molecular chaperones is achieved by the inactivation of the chromosomal repressor gene (hrcA) which specifically controls the expression of the two operons encoding the intracellular molecular chaperones (56). WB700NHM was then transformed with pEPP (51), a high-copy-number plasmid carrying prsA which codes for the extracytoplasmic molecular chaperone, PrsA, to generate WB700NHM[pEPP]. Transformation of WB700NHM[pEPP] with pMH-1 generated a strain which showed a low but detectable level of MH-1 SCA (Fig. 2B, lane 3) by Western blot analysis. A degraded form of MH-1 SCA was also observed. The results suggest that coproduced molecular chaperones in WB700NHM[pEPP] can improve MH-1 SCA production although some of the secreted MH-1 SCA molecules can still be degraded.



View larger version (61K):
[in this window]
[in a new window]
 
FIG. 2. Importance of inactivation of wall-bound protease gene in MH-1 SCA production. Cells were cultured in super-rich medium for 6 h. Culture supernatants were trichloroacetic acid precipitated, and proteins were analyzed on an 11% polyacrylamide gel containing SDS. Amounts of samples loaded were normalized to cell density. (A) Coomassie blue-stained gel; (B) Western blot using protein L-HRP as the probing agent. Lane 1, molecular weight markers; lane 2, WB800HM[pWB980, pEPP] (this served as the negative control); lane 3, WB700NHM[pMH1, pEPP]; lane 4, WB800HM[pMH1, pEPP]. Shown are the positions of intact (*) and degraded (•) MH-1 SCA fragments, respectively.

 
Effect of wall-bound protease WprA on MH1-SCA production.
Margot and Karamata (30) have reported the cloning and characterization of a structural gene (wprA) encoding a cell wall-associated protease from B. subtilis. It would be of interest to determine the effect of this protease on MH-1 SCA production. Inactivation of the chromosomal wprA gene in WB700N and WB700NHM generated WB800 and WB800HM, respectively. In comparison with WB700NHM[pEPP, pMH1] (Fig. 2B, lane 3), WB800HM[pEPP, pMH1] (Fig. 2, lane 4) produced MH-1 SCA at a much higher level, in the range of 10 to 15 mg/liter. A single band with an apparent molecular mass of 34 kDa, which is larger than the expected molecular mass of 27 kDa, was detected by Western blot analysis probed with protein L-HRP. It is fairly common that SCA fragments tend to have a slower migration on SDS-polyacrylamide gel (7, 53). Thus, our data indicate that WprA can significantly affect the stability of MH-1 SCA. This observation is consistent with previous reports which demonstrate that WprA can degrade proteins heterologously expressed in B. subtilis, including staphylokinase (27) and {alpha}-amylase (44).

Intracellular and extracytoplasmic molecular chaperones act in sequential manner to enhance MH-1 SCA production.
Although WB800HM[pEPP, pMH-1] conspicuously improved secretory production of MH-1 SCA, it is interesting to note that no MH-1 SCA could be detected in both the culture supernatant (Fig. 3A and B, lanes 2) and the intracellular fraction of WB800[pMH-1] (data not shown). This indicates that coproduction of molecular chaperones also plays an important role in MH-1 SCA production. To determine whether both intracellular and extracytoplasmic molecular chaperones are required for enhanced MH-1 SCA production, production of MH-1 SCA in WB800HM[pMH-1] and WB800[pMH-1, pEPP], respectively, was monitored. As shown in Fig. 3B, even with the coproduction of the extracytoplasmic molecular chaperone PrsA in WB800[pEPP] (lane 4), no detectable MH-1 SCA could be observed in the culture supernatant. Neither was it detected in the intracellular fraction (data not shown). In contrast, coproduction of intracellular molecular chaperones alone (lane 3) could significantly increase the production of MH-1 SCA in the culture supernatant. This demonstrates that intracellular molecular chaperones clearly play a vital role in MH-1 SCA production. Further enhancement of MH-1 SCA production could be observed when WB800HM[pEPP, pMH-1] (lane 5) was used as the expression host. Thus, the extracytoplasmic molecular chaperone, acting in concert with the intracellular molecular chaperones, could also enhance the production of MH-1 SCA. Our data suggest that these molecular chaperones may act in a sequential order, with intracellular molecular chaperones acting in the first stage. These intracellular molecular chaperones may potentially assist MH-1 SCA to adopt loosely folded conformations that are compatible with the secretion apparatus and/or to attain configurations that are less susceptible to intracellular protease degradation. After membrane translocation, the secreted MH-1 SCA is presumably refolded. The rate of protein refolding has been shown to affect the final production yield of a secretory protein (43). Usually, a higher production yield can be attained for secretory proteins with a higher refolding rate. Although the exact mechanism of the PrsA action is still unknown, homology of PrsA to the parvulin family of peptidyl-prolyl cis-trans isomerases suggests that PrsA may catalyze the cis-trans isomerization of proline residues in secretory proteins (40, 51). Consistent with this idea, proline cis-trans isomerization can be a rate-limiting step in protein and SCA folding (18, 20, 28) and two conserved proline residues in SCA fragments are in the cis configuration (11, 20, 21). Slower folding of secreted MH-1 SCA in the presence of limited amounts of PrsA may lead to rapid degradation of the protein by the residual proteases in WB800 (22, 46).



View larger version (46K):
[in this window]
[in a new window]
 
FIG. 3. Effects of molecular chaperones on MH-1 SCA production from various strains with a WB800 background. (A) Coomassie blue-stained gel; (B) Western blot analysis. Lane 1, molecular weight markers; lanes 2 to 5, different WB800 hosts carrying the pMH1 plasmid; lane 2, WB800; lane 3, WB800HM; lane 4, WB800[pEPP]; lane 5, WB800HM[pEPP]; lane 6, WB800HM[pWB980, pEPP] (this served as the negative control). *, position of intact MH-1 SCA fragment. Experimental conditions are as described for Fig. 2.

 
Rapid purification and characterization of secreted MH-1 SCA.
Like protein A from Staphylococcus aureus and protein G from groups C and G streptococci, protein L, a cell wall protein from Peptostreptococcus magnus, can recognize and bind to certain antibodies (23). It binds specifically to the variable domain of {kappa} light chains in immunoglobulins with high affinity (1, 37). Most important, this binding does not interfere with the interaction between antibodies and their antigens (48). MH-1 SCA could be specifically recognized by protein L as shown in Fig. 2 and 3 where HRP-conjugated protein L was used as the probing agent in the Western blot studies. This binding of MH-1 SCA by protein L was applied for the purification of MH-1 SCA. Culture supernatant containing secreted MH-1 SCA was loaded directly to a protein L-agarose column. The bound MH-1 SCA was then eluted from the column using a 0.1 M glycine buffer at pH 2.5 (Fig. 4, lanes 5 and 6). This approach allows purification of MH-1 SCA to homogeneity in one step. The calculated molecular weight of MH-1 SCA is 27,188. Since MH-1 SCA had an apparent molecular mass of 34 kDa as determined by SDS-PAGE, purified MH-1 SCA was subjected to both N-terminal sequencing and MALDI-TOF mass spectrometry analyses. Sequence determination of the first six amino acid residues from MH-1 SCA was found to be DIVLTQ, which matches exactly that of the expected mature light chain sequence of MH-1. This demonstrates that the B. subtilis levansucrase signal sequence was properly processed. Through the MALDI-TOF mass spectrometry study, the molecular mass of MH-1 SCA was determined to be 27,185 Da which is in close agreement with the calculated value.



View larger version (101K):
[in this window]
[in a new window]
 
FIG. 4. Purification of MH-1 SCA by protein L-agarose. Proteins were separated on a 12% polyacrylamide gel containing SDS and stained by Coomassie blue. Lane 1, molecular weight markers; lane 2, culture supernatant; lane 3, flow-through; lane 4, wash; lanes 5 and 6, eluates. Samples in lanes 2 to 4 were concentrated by trichloroacetic acid precipitation.

 
MH-1 SCA retains comparable specificity and affinity as MH-1 MAb.
It has been well established that the length of the linker can greatly affect the oligomeric state of an SCA (3, 12, 26). Even with a linker of 15 amino acid residues or longer, a low percentage of SCA can exist in a dimeric or oligomeric form. Presence of these oligomeric forms can contribute to an increase in the apparent affinity of these molecules for their antigen (3, 7, 19). To avoid this complication, the affinity-purified MH-1 SCA fragments were passed through a gel filtration column to separate monomeric MH-1 SCA from other dimeric and oligomeric MH-1 SCA fragments. All functional characterizations of MH-1 SCA were performed with these purified monomeric MH-1 SCA fragments. MH-1 MAb has been shown to bind selectively to fibrin but not to fibrinogen (14). It also binds to cross-linked fibrin better than non-cross-linked fibrin (14). Fibrinogen is composed of two sets of three different polypeptide chains (36): A{alpha}, Bß, and {gamma}, with A and B designating the N-terminal fibrinopeptides A (16 amino acids) and B (14 amino acids) in the A{alpha} and Bß chains, respectively. As shown in Fig. 5A, lane 2, the apparent molecular masses of the human A{alpha}, Bß and {gamma} chains are 65, 56, and 49 kDa, respectively. There were some degrees of heterogeneity in the A{alpha} chain. By the action of thrombin, the fibrinopeptides A and B are cleaved off from fibrinogen to generate {alpha}, ß, and {gamma} chains in fibrin (36). Formation of non-cross-linked fibrin by thrombin in the presence of EDTA was observed (lane 3). Cross-linking of adjacent {gamma} chains in fibrin via a transamidation process is then catalyzed by activated factor XIII (29). This process is Ca2+ dependent. Lane 4 shows the formation of cross-linked fibrin. The disappearance of non-cross-linked {gamma} chains and the appearance of the cross-linked {gamma} chains with an apparent molecular mass around 97 kDa demonstrated the formation of cross-linked fibrin. MH-1 SCA retained similar specificity as MH-1 MAb (Fig. 5B). Even at high concentrations, MH-1 SCA retained a 13-fold discrimination between fibrin and fibrinogen. It also bound cross-linked fibrin better than the non-cross-linked form.



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 5. (A) SDS-PAGE analysis of fibrinogen and non-cross-linked and cross-linked fibrin. Gel was stained with Coomassie blue. Positions corresponding to {alpha}, ß, and {gamma} chains of fibrin are marked. Lane 1, molecular weight markers; lane 2, fibrinogen; lane 3, non-cross-linked fibrin; lane 4, cross-linked fibrin. Protein bands with an apparent molecular mass around 97 kDa are the cross-linked {gamma} chains. (B) Specificity of MH-1 SCA. Binding of MH-1 SCA to fibrinogen and fibrin immobilized on an ELISA plate was monitored with protein L-HRP. The initial rate of color development by measuring the absorbance change at 405 nm with time was used as an indication of MH-1 SCA specificity to the different antigens. {blacktriangleup}, fibrinogen; {blacksquare}, non-cross-linked fibrin; •, cross-linked fibrin.

 
To determine the binding constant of MH-1 SCA towards fibrin, binding of MH-1 SCA at different concentrations to immobilized fibrin was monitored. After extensive washings to remove the unbound MH-1 SCA, the amounts of the bound MH-1 SCA fragments were quantified using HRP-conjugated protein L. The dissociation constants were determined by the Scatchard plot analyses. In three independent analyses, the dissociation constant of MH-1 SCA to cross-linked fibrin was determined to be 1.37 x 10-9 ± 0.72 x 10-9 M. This represents approximately a twofold decrease in affinity (14) in comparison with that of the parental MH-1 MAb (Kd = 6.7 x 10-10 M). It is fairly common for SCA fragments to have a lower affinity (by two- to threefold) since SCA fragment is monovalent (9, 10, 34). The Kd of MH-1 SCA to non-cross-linked fibrin was found to be 6.4 x 10-9 M. The results indicate that MH-1 SCA retains similar properties as MH-1 MAb and can be used as a potential fibrin targeting agent.

Significance of the engineered B. subtilis system for SCA production.
Different SCAs have different properties that result in a lower production yield for these proteins. In the case of the 26-10 antidigoxin SCA fragment, it tends to aggregate and the rate of inclusion body formation is even faster than the rate of secretion (51). Consequently, inclusion bodies formed inside the cell represents 60% of the total antibody produced by the cell. In contrast, instead of forming inclusion bodies, the anti-fibrin MH-1 SCA fragment synthesized from WB700N is not even detectable in both extracellular and intracellular fractions, presumably because of its slow folding and sensitivity to proteases. The engineered WB800HM[pEPP] strain provides a solution to address all these situations. In the case of the anti-digoxin SCA fragment, even WB600BHM[pEPP] is sufficient to reduce the inclusion bodies down to 6% and to produce functional anti-digoxin SCA to 15 mg/liter (51). By addressing the two major concerns, protein folding and degradation by extracellular and wall-bound proteases, in B. subtilis protein secretion (5), this engineered WB800HM[pEPP] system can potentially be applied to produce not only SCA fragments but also other secretory proteins, especially those with folding and protease sensitivity problems. Although SCA fragments have been produced successfully from various expression systems including gram-positive and gram-negative bacteria, yeast (Saccharomyces, Schizosaccharomyces, and Pichia), filamentous fungi (Trichoderma reesei), insect, plant, and mammalian cells, the production yield of these fragments in their functional state can vary significantly (7). It is difficult to predict which system works the best for the production of a particular SCA fragment. The improvement of the B. subtilis system described here provides an attractive alternative for SCA fragment production.


    ACKNOWLEDGMENTS
 
We thank James McLinden from American Biogenetic Sciences, Inc., for providing plasmid TF77-7A1#46 carrying a structural gene encoding the MH-1 SCA fragment as a template used in this study.

This work was supported by a research grant from the Heart and Stroke Foundation of Canada (Alberta) and a strategic grant from Natural Sciences and Engineering Research Council of Canada. Jonathan C. Yeung was supported in part by summer studentships from both Alberta Heritage Foundation of Medical Research (AHFMR) and Natural Science and Engineering Research Council of Canada (NSERC).


    FOOTNOTES
 
* Corresponding author. Mailing address: Sui-Lam Wong, Department of Biological Sciences, University of Calgary, 2500 University Dr., N.W., Calgary, Alberta T2N 1N4, Canada. Phone: (403) 220-5721. Fax: (403) 289-9311. E-mail: slwong{at}ucalgary.ca. Back

{dagger} Present address: SemBioSys Genetics, Calgary, Alberta T1Y 7L3, Canada. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Akerstrom, B., B. H. Nilson, H. R. Hoogenboom, and L. Bjorck. 1994. On the interaction between single chain Fv antibodies and bacterial immunoglobulin-binding proteins. J. Immunol. Methods 177:151-163.[CrossRef][Medline]
  2. Anand, N. N., S. Mandal, C. R. MacKenzie, J. Sadowska, B. Sigurskjold, N. M. Young, D. R. Bundle, and S. A. Narang. 1991. Bacterial expression and secretion of various single-chain Fv genes encoding proteins specific for a Salmonella serotype B O-antigen. J. Biol. Chem. 266:21874-21879.[Abstract/Free Full Text]
  3. Atwell, J. L., K. A. Breheney, L. J. Lawrence, A. J. Mccoy, A. A. Kortt, and P. J. Hudson. 1999. scFv multimers of the anti-neuraminidase antibody NC10: length of the linker between V(H) and V(L) domains dictates precisely the transition between diabodies and triabodies. Protein Eng. 12:597-604.[Abstract/Free Full Text]
  4. Ayala, M., R. F. Balint, M. E. Fernández-de-Cossío, L. Canaán-Haden, J. W. Larrick, J. V. Gavilondo, L. Fernandez-de-Cossio, and J. W. Canaan-Haden. 1995. Variable region sequence modulates periplasmic export of a single-chain Fv antibody fragment in Escherichia coli. BioTechniques 18:832-842.[Medline]
  5. Bolhuis, A., H. Tjalsma, H. E. Smith, A. De Jong, R. Meima, G. Venema, S. Bron, and J. M. Van Dijl. 1999. Evaluation of bottlenecks in the late stages of protein secretion in Bacillus subtilis. Appl. Environ. Microbiol. 65:2934-2941.[Abstract/Free Full Text]
  6. Bos, R., G. H. Laterveer-Vreeswijk, D. Lockwood, K. Szewczyk, and W. Nieuwenhuizen. 1999. A new enzyme immunoassay for soluble fibrin in plasma, with a high discriminating power for thrombotic disorders. Thromb. Haemost. 81:54-59.[Medline]
  7. Breitling, F., and S. Dubel. 1999. Recombinant antibodies. John Wiley and Sons, Inc., New York, N.Y.
  8. Colcher, D., R. Bird, M. Roselli, K. D. Hardman, S. Johnson, S. Pope, S. W. Dodd, M. W. Pantoliano, D. E. Milenic, and J. Schlom. 1990. In vivo tumor targeting of a recombinant single-chain antigen-binding protein. J. Natl. Cancer Inst. 82:1191-1197.[Abstract/Free Full Text]
  9. Colcher, D., A. Goel, G. Pavlinkova, G. Beresford, B. Booth, and S. K. Batra. 1999. Effects of genetic engineering on the pharmacokinetics of antibodies. Q. J. Nucl. Med. 43:132-139.[Medline]
  10. Colcher, D., G. Pavlinkova, G. Beresford, B. J. Booth, A. Choudhury, and S. K. Batra. 1998. Pharmacokinetics and biodistribution of genetically-engineered antibodies. Q. J. Nucl. Med. 42:225-241.[Medline]
  11. Constantine, K. L., M. S. Friedrichs, W. J. Metzler, M. Wittekind, P. Hensley, and L. Mueller. 1994. Solution structure of an isolated antibody VL domain. J. Mol. Biol. 236:310-327.[CrossRef][Medline]
  12. Dolezal, O., L. A. Pearce, L. J. Lawrence, A. J. Mccoy, P. J. Hudson, and A. A. Kortt. 2000. ScFv multimers of the anti-neuraminidase antibody NC10: shortening of the linker in single-chain Fv fragment assembled in VL to VH orientation drives the formation of dimers, trimers, tetramers and higher molecular mass multimers. Protein Eng. 13:565-574.[Abstract/Free Full Text]
  13. Duet, M., S. Benelhadj, W. Kedra, D. Vilain, C. Ajzenberg, D. Elkharrat, L. Drouet, C. Soria, and O. Mundler. 1998. A new quantitative D-dimer assay appropriate in emergency: reliability of the assay for pulmonary embolism exclusion diagnosis. Thromb. Res. 91:1-5.[CrossRef][Medline]
  14. Gargan, P. E., P. J. Gaffney, J. R. Pleasants, and V. A. Ploplis. 1993. A monoclonal antibody which recognises an epitopic region unique to the intact fibrin polymeric structure. Fibrinolysis 7:275-283.[CrossRef]
  15. Gill, S. C., and P. H. Von Hippel. 1989. Calculation of protein extinction coefficients from amino acid sequence data. Anal. Biochem. 182:319-326.[CrossRef][Medline]
  16. Hayzer, D. J., I. M. Lubin, and M. S. Runge. 1991. Conjugation of plasminogen activators and fibrin-specific antibodies to improve thrombolytic therapeutic agents. Bioconjug. Chem. 2:301-308.[CrossRef][Medline]
  17. Hennecke, F., C. Krebber, and A. Pluckthun. 1998. Non-repetitive single-chain Fv linkers selected by selectively infective phage (SIP) technology. Protein Eng. 11:405-410.[Abstract/Free Full Text]
  18. Hurle, M. R., and C. R. Matthews. 1987. Proline isomerization and the slow folding reactions of the alpha subunit of tryptophan synthase from Escherichia coli. Biochim. Biophys. Acta 913:179-184.[CrossRef][Medline]
  19. Huston, J. S., A. J. T. George, M.-S. Tai, J. E. McCartney, D. Jin, D. M. Segal, P. Keck, and H. Oppermann. 2001. Single-chain Fv design and production by preparative folding, p. 185-227. In C. A. K. Borrebaeck (ed.), Antibody engineering. Oxford University Press, Inc., New York, N.Y.
  20. Jager, M., and A. Pluckthun. 1997. The rate-limiting steps for the folding of an antibody scFv fragment. FEBS Lett. 418:106-110.[CrossRef][Medline]
  21. Jeffrey, P. D., R. K. Strong, L. C. Sieker, C. Y. Chang, R. L. Campbell, G. A. Petsko, E. Haber, M. N. Margolies, and S. Sheriff. 1993. 26-10 Fab-digoxin complex: affinity and specificity due to surface complementarity. Proc. Natl. Acad. Sci. USA 90:10310-10314.[Abstract/Free Full Text]
  22. Jensen, C. L., K. Stephenson, S. T. Jorgensen, and C. Harwood. 2000. Cell-associated degradation affects the yield of secreted engineered and heterologous proteins in the Bacillus subtilis expression system. Microbiology 146:2583-2594.[Abstract/Free Full Text]
  23. Kastern, W., E. Holst, E. Nielsen, U. Sjobring, and L. Bjorck. 1990. Protein L, a bacterial immunoglobulin-binding protein and possible virulence determinant. Infect. Immun. 58:1217-1222.[Abstract/Free Full Text]
  24. Kontinen, V. P., P. Saris, and M. Sarvas. 1991. A gene (prsA) of Bacillus subtilis involved in a novel, late stage of protein export. Mol. Microbiol. 5:1273-1283.[Medline]
  25. Kontinen, V. P., and M. Sarvas. 1993. The PrsA lipoprotein is essential for protein secretion in Bacillus subtilis and sets a limit for high-level secretion. Mol. Microbiol. 8:727-737.[Medline]
  26. Kortt, A. A., R. L. Malby, J. B. Caldwell, L. C. Gruen, N. Ivancic, M. C. Lawrence, G. J. Howlett, R. G. Webster, P. J. Hudson, and P. M. Colman. 1994. Recombinant anti-sialidase single-chain variable fragment antibody—characterization, formation of dimer and higher-molecular-mass multimers and the solution of the crystal structure of the single-chain variable fragment/sialidase complex. Eur. J. Biochem. 221:151-157.[Medline]
  27. Lee, S. J., D. M. Kim, K. H. Bae, S. M. Byun, and J. H. Chung. 2000. Enhancement of secretion and extracellular stability of staphylokinase in Bacillus subtilis by wprA gene disruption. Appl. Environ. Microbiol. 66:476-480.[Abstract/Free Full Text]
  28. Lilie, H., K. Lang, R. Rudolph, and J. Buchner. 1993. Prolyl isomerases catalyze antibody folding in vitro. Protein Sci. 2:1490-1496.[Abstract]
  29. Lorand, L. 2001. Factor XIII: structure, activation, and interactions with fibrinogen and fibrin. Ann. N. Y. Acad. Sci. 936:291-311.[Medline]
  30. Margot, P., and D. Karamata. 1996. The wprA gene of Bacillus subtilis 168, expressed during exponential growth, encodes a cell-wall-associated protease. Microbiology 142:3437-3444.[Medline]
  31. Matsudaira, P. 1987. Sequence from picomole quantities of proteins electroblotted onto polyvinylidene difluoride membranes. J. Biol. Chem. 262:10035-10038.[Abstract/Free Full Text]
  32. Merk, H., W. Stiege, K. Tsumoto, I. Kumagai, and V. A. Erdmann. 1999. Cell-free expression of two single-chain monoclonal antibodies against lysozyme: effect of domain arrangement on the expression. J. Biochem. (Tokyo) 125:328-333.[Abstract/Free Full Text]
  33. Merlino, G., A. Soluri, F. La Torre, M. Ciavolella, O. Schillaci, M. Ierardi, G. De Vincentis, R. Tavolaro, A. De Paola, E. Sardelli, and F. Scopinaro. 1997. 99mTc anti-D-dimer MoAb detects venous thrombi in man. G. Chir. 18:653-654.[Medline]
  34. Milenic, D. E., T. Yokota, D. R. Filpula, M. A. J. Finkelman, S. W. Dodd, J. F. Wood, M. Whitlow, P. Snoy, and J. Schlom. 1991. Construction, binding properties, metabolism, and tumor targeting of a single-chain Fv derived from the pancarcinoma monoclonal antibody CC49. Cancer Res. 51:6363-6371.[Medline]
  35. Morris, T. A., J. J. Marsh, R. Fagnani, M. Hagan, and K. M. Moser. 1997. Degree of polymer organization decreases the binding of a monoclonal antibody raised against the beta-chain amino terminus of fibrin. Thromb. Haemost. 77:704-709.[Medline]
  36. Mosesson, M. W., K. R. Siebenlist, and D. A. Meh. 2001. The structure and biological features of fibrinogen and fibrin. Ann. N. Y. Acad. Sci. 936:11-30.[Medline]
  37. Nilson, B. H., A. Solomon, L. Bjorck, and B. Akerstrom. 1992. Protein L from Peptostreptococcus magnus binds to the kappa light chain variable domain. J. Biol. Chem. 267:2234-2239.[Abstract/Free Full Text]
  38. Pavlinkova, G., G. W. Beresford, B. J. Booth, S. K. Batra, and D. Colcher. 1999. Pharmacokinetics and biodistribution of engineered single-chain antibody constructs of MAb CC49 in colon carcinoma xenografts. J. Nucl. Med. 40:1536-1546.[Abstract/Free Full Text]
  39. Procyk, R., B. Kudryk, S. Callender, and B. Blomback. 1991. Accessibility of epitopes on fibrin clots and fibrinogen gels. Blood 77:1469-1475.[Abstract/Free Full Text]
  40. Rahfeld, J. U., K. P. Rucknagel, B. Schelbert, B. Ludwig, J. Hacker, K. Mann, and G. Fischer. 1994. Conformation of the existence of a third family among peptidyl-prolyl cis/trans isomerases. Amino acid sequence and recombinant production of parvulin. FEBS Lett. 352:180-184.[CrossRef][Medline]
  41. Runge, M. S., C. Bode, G. R. Matsueda, and E. Haber. 1987. Antibody-enhanced thrombolysis: targeting of tissue plasminogen activator in vivo. Proc. Natl. Acad. Sci. USA 84:7659-7662.[Abstract/Free Full Text]
  42. Song, Z., Y. Cai, D. Song, J. Xu, H. Yuan, L. Wang, X. Zhu, H. Lin, F. Breitling, and S. Dübel. 1997. Primary structure and functional expression of heavy- and light-chain variable region genes of a monoclonal antibody specific for human fibrin. Hybridoma 16:235-241.[Medline]
  43. Stephenson, K., N. M. Carter, C. R. Harwood, M. F. Petit-Glatron, and R. Chambert. 1998. The influence of protein folding on late stages of the secretion of alpha-amylases from Bacillus subtilis. FEBS Lett. 430:385-389.[CrossRef][Medline]
  44. Stephenson, K., and C. R. Harwood. 1998. Influence of a cell-wall-associated protease on production of alpha-amylase by Bacillus subtilis. Appl. Environ. Microbiol. 64:2875-2881.[Abstract/Free Full Text]
  45. Tsumoto, K., Y. Nakaoki, Y. Ueda, K. Ogasahara, K. Yutani, K. Watanabe, and I. Kumagai. 1994. Effect of the order of antibody variable regions on the expression of the single-chain HyHEL10 Fv fragment in E. coli and the thermodynamic analysis of its antigen-binding properties. Biochem. Biophys. Res. Commun. 201:546-551.[CrossRef][Medline]
  46. Vitikainen, M., T. Pummi, U. Airaksinen, E. Wahlstrom, H. Wu, M. Sarvas, and V. P. Kontinen. 2001. Quantitation of the capacity of the secretion apparatus and requirement for PrsA in growth and secretion of alpha-amylase in Bacillus subtilis. J. Bacteriol. 183:1881-1890.[Abstract/Free Full Text]
  47. Wasser, M. N., P. W. Koppert, J. W. Arndt, J. J. Emeis, R. I. Feitsma, E. K. Pauwels, and W. Nieuwenhuizen. 1989. An antifibrin monoclonal antibody useful in immunoscintigraphic detection of thrombi. Blood 74:708-714.[Abstract/Free Full Text]
  48. Wikstrom, M., U. Sjobring, T. Drakenberg, S. Forsen, and L. Bjorck. 1995. Mapping of the immunoglobulin light chain-binding site of protein L. J. Mol. Biol. 250:128-133.[CrossRef][Medline]
  49. Wong, S.-L., X.-C. Wu, L.-P. Yang, S.-C. Ng, and N. Hudson. 1995. Production and purification of antibody using Bacillus subtilis as an expression host, p. 100-107. In H. Y. Wang and T. Imanaka (ed.), Antibody expression and engineering. American Chemical Society, Washington, D.C.
  50. Wu, S.-C. and S.-L. Wong. 1999. Development of improved pUB110-based vectors for expression and secretion studies in Bacillus subtilis. J. Biotechnol. 72:185-195.[CrossRef][Medline]
  51. Wu, S.-C., R. Ye, X.-C. Wu, S.-C. Ng, and S.-L. Wong. 1998. Enhanced secretory production of a single-chain antibody fragment from Bacillus subtilis by coproduction of molecular chaperones. J. Bacteriol. 180:2830-2835.[Abstract/Free Full Text]
  52. Wu, X.-C., W. Lee, L. Tran, and S.-L. Wong. 1991. Engineering a Bacillus subtilis expression-secretion system with a strain deficient in six extracellular proteases. J. Bacteriol. 173:4952-4958.[Abstract/Free Full Text]
  53. Wu, X.-C., S.-C. Ng, R. I. Near, and S.-L. Wong. 1993. Efficient production of a functional single-chain antidigoxin antibody via an engineered Bacillus subtilis expression-secretion system. Bio/Technology (N. Y). 11:71-76.[CrossRef][Medline]
  54. Wylie, F. G., and T. P. Walsh. 1995. Variable immunoreactivity of D-dimer preparations for monoclonal antibody DD-3B6/22. Blood Coagul. Fibrinolysis 6:738-742.[Medline]
  55. Ye, R., L. P. Yang, and S.-L. Wong. 1996. Construction of protease deficient Bacillus subtilis strains for expression studies: inactivation of seven extracellular proteases and the intracellular LonA protease, p. 160-169. In S. K. Hong and W. J. Lim (ed.), Proceedings of the International Symposium on Recent Advances in Bioindustry. The Korean Society for Applied Microbiology, Seoul, Korea.
  56. Yuan, G., S.-L. Wong, and S. L. Wong. 1995. Isolation and characterization of Bacillus subtilis groE regulatory mutants: evidence for orf39 in the dnaK operon as a repressor gene in regulating the expression of both groE and dnaK. J. Bacteriol. 177:6462-6468.[Abstract/Free Full Text]


Applied and Environmental Microbiology, July 2002, p. 3261-3269, Vol. 68, No. 7
0099-2240/02/$04.00+0     DOI: 10.1128/AEM.68.7.3261-3269.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, S.-C.
Right arrow Articles by Wong, S.-L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, S.-C.
Right arrow Articles by Wong, S.-L.
Agricola
Right arrow Articles by Wu, S.-C.
Right arrow Articles by Wong, S.-L.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. Microbiol. Mol. Biol. Rev. Eukaryot. Cell All ASM Journals