Previous Article | Next Article ![]()
Applied and Environmental Microbiology, October 2003, p. 5793-5801, Vol. 69, No. 10
0099-2240/03/$08.00+0 DOI: 10.1128/AEM.69.10.5793-5801.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Jennifer Legac,
and Steven E. Lindow*
Department of Plant and Microbial Biology, University of California, Berkeley, California 94720
Received 20 March 2003/ Accepted 10 July 2003
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Methodologies that identify genes induced in a habitat- or host-specific manner, irrespective of whether those genes confer an essential phenotype, are complementary to loss-of-function strategies. These screens are based on "trapping" gene promoters in front of a gene conferring an essential and/or easily monitored phenotype. Osbourn et al. were the first to apply this type of positive selection by using chloramphenicol resistance as a selective reporter for Xanthomonas genes expressed during invasion of turnip seedlings (30). This approach was later developed into a general screening strategy termed in vivo expression technology (IVET) (25). A variety of related IVET strategies have since been reported, each with different selection criteria. Examples include the habitat- or host-specific complementation of nutritional auxotrophies (25, 31, 39); expression of selectable antibiotic resistance genes (14, 26); irreversible recombination by 
resolvase in a recombination-based IVET, leading to a genotypic change in cells (8, 9); or differential fluorescence induction (DFI), whereby cells are selected on the basis of enhanced green fluorescent protein (GFP) fluorescence (37, 38). The successes of IVET and related promoter-trapping strategies have recently been discussed in several comprehensive reviews (2, 10, 24, 32). Taken together, these screens have been effective in identifying genes expressed in a host- or habitat-specific manner. Many of these genes were later shown to be not essential and hence would have been missed by mutagenesis approaches. Furthermore, these approaches remain among the most comprehensive for identification of genes upregulated in environments where more recent technologies, such as DNA microarray transcriptional profiling, are presently not practical due to the presence of contaminating organisms and the low number of cells contained in each sample.
Our laboratory has previously applied both negative and positive screens to identify genes expressed by a plant-pathogenic strain of Pseudomonas syringae pv. syringae in its preferred habitat, the leaf surface or phyllosphere. Random Tn5 mutants of P. syringae with a reduced ability to grow and survive in the phyllosphere, i.e., with a reduced epiphytic fitness, were identified (21, 22). From that study it became apparent that epiphytic fitness is conferred not by a few genes with large individual effects but rather by many genes contributing incrementally to fitness. In a complementary approach to determine how many genes are expressed selectively on leaves and hence might contribute to fitness, a library of P. syringae mutants containing random fusions of a promoterless lux operon were examined for luciferase activity (11). That study revealed that approximately 2% of P. syringae genes are preferentially expressed in the phyllosphere, thus indicating that many traits contributing to epiphytic fitness may not be expressed in culture. These results indicated that many phyllosphere-specific genes might contribute to bacterial adaptations evolved to exploit this habitat. The use of a nonselective reporter such as luciferase, however, proved to be far too laborious a procedure to identify all of the many plant-induced genes in this species.
To efficiently identify P. syringae genes that are expressed specifically on leaves and hence have a likely role in epiphytic fitness, we have developed a new variant of the IVET system termed habitat-inducible rescue of survival (HIRS). This selection strategy differs from other IVET approaches in that it is based on the production of an endogenous factor required for complementation of a conditionally lethal phenotype in vivo. In this report, we present a HIRS strategy to enrich for phyllosphere-specific genes of P. syringae based on metXW, two genes which were previously determined to be cotranscribed from a single, unregulated promoter and which were required for methionine biosynthesis in P. syringae (1). Methionine auxotrophs of P. syringae have previously been shown to exhibit normal growth on moist plant leaves but were severely reduced in fitness when the plants were subsequently exposed to conditions of low relative humidity (1, 5). We characterize the metXW HIRS system, with an emphasis on its strengths and limitations as a genetic screen, and present evidence that this screen is a powerful way to detect weakly expressed genes that are active primarily on leaf surfaces.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Recombinant DNA techniques.
DNA isolation, PCR, and general recombinant DNA techniques were performed by standard methods (34). Restriction and modifying enzymes were obtained from New England Biolabs (Beverly, Mass.) and Roche Diagnostics Corp. (Indianapolis, Ind.). PCR was performed in a Perkin-Elmer/Cetus (Norwalk, Conn.) DNA thermal cycler. Reaction mixtures of 50 µl contained 50 ng of template DNA, 1 U of Pfu polymerase (Promega, Madison, Wis.), and 1 pmol of sequence-specific oligonucleotides (Oligos Etc., Wilsonville, Oreg.).
Plant inoculations.
Bean plants (Phaseolus vulgaris cultivar Bush Blue Lake 274) were grown on greenhouse benches in pots containing three to six seedlings. Once the primary leaves were fully emerged (12 days after planting), the aerial parts of the plants were briefly immersed in 2 liters of 1 mM potassium phosphate buffer (KPB) (pH 7.0) containing suspensions of either a single P. syringae strain, pools of P. syringae HIRS library clones, or 1:100 mixtures of P. syringae B728a and B7MX89. The last mixtures were applied to plants in order to simulate HIRS library pools, whereby it was expected that a maximum of 1 to 2% plant-inducible clones would be present among a predominance of methionine auxotrophs.
After inoculation, the plants were placed in an enclosed chamber maintained at 28°C and kept humid (relative humidity [RH] of near 100%) with water-soaked paper. After 24 h, plants were typically transferred to conditions of low RH (in a growth chamber maintained at 28 to 30°C and 40% RH). To estimate bacterial populations, three to five leaves were collected randomly for each treatment at different times following inoculation. Cells were typically liberated by macerating the leaves individually in 5 ml of KPB with a mortar and pestle. Alternatively, leaves were washed to collect the cells by first placing them into separate tubes containing 20 ml of washing buffer (21), followed by sonication for 7 min in a water bath (Branson Ultrasonics Corp., Danbury, Conn.) and then vortexing for 10 s. For those treatments in which the leaves were both washed and macerated, the leaves were first washed to remove exposed cells and then air dried prior to maceration. Numbers of viable P. syringae cells in all leaf samples were determined by plating serial dilutions of the bacterial suspension on the appropriate media by using a spiral diluter-plater (Spiral Systems, Bethesda, Md.).
Population size estimates for bacteria collected from individual leaves were log transformed to achieve normality (16). Mean population sizes among the treatments were compared by using Fisher's unprotected least-significant-difference test with SAS version 6.03 (SAS Institute, Cary, N.C.). This test controls the comparison-wise error rate.
Construction of the promoter-trapping vector pTrap.
A 1.8-kb, promoterless version of metXW was amplified in a PCR from a cosmid clone containing the entire B728a metXW operon (1) by using the primers Mar1 (5'GGATCCTCGAGTAACTAACTAACCTCATTTATGCGAGACAGG3') and Mar2 (5'GCAGATCTCTGTGGTCCGTCAGCCCG3'). The mar1 primer was designed to include a unique XhoI site (CTCGAG) followed by a three-way translational stop sequence (TAACTAACTAA). The PCR product was first cloned into pCR2.1 (TA cloning kit; Invitrogen, Carlsbad, Calif.) for sequence verification and was subsequently removed and ligated into the BamHI site of pPROBE-gfp[tagless] (28). Plasmid pPROBE-gfp[tagless] contains a promoterless gfp gene flanked by T1 terminators and confers resistance to kanamycin. The resulting plasmid was digested with ScaI and EcoRV and religated to give plasmid pTrap (Fig. 1). This step eliminated the possibility that the metXW-gfp cassette could be deleted by recombination between the upstream and downstream copies of the T1 terminators. Plasmid pMTXW is a derivative of pTRAP containing a functional, constitutive metXW promoter upstream from the metXW locus.
|
Approximately 700 transformants were pooled and used in a triparental mating to transfer plasmids into B7MX89 en masse. For this, exponentially growing cultures of B7MX89, E. coli HB101(pRK2013), and DH10B library pools were mixed at a ratio of 4:1:1 and concentrated onto a filter disk which was placed on a Luria agar plate and incubated at 28°C overnight. All cells were then collected from the filter, and appropriate dilutions were plated on KB plates containing kanamycin and rifampin. Transconjugants were replica plated onto M9 medium containing methionine, and at least 3,000 individual recipient colonies were pooled, washed two times in KPB, and prepared for inoculation onto plants.
Restriction digest and sequence analysis of the P. syringae library DNA inserts.
Changes in the genotypic diversity of the B7MX89(pTRAP) library were monitored by PCR before, during, and after enrichment on bean plants. Library inserts contained in pTrap were amplified with primers Mar3 (5'CAATTGCCAGGAATTGGGGATCGGAAGCTTGC3') and Mar4 (5'TCGACCCTGTCTCGCATAAATGAGGTTAGTTAGTTAC3'). These primers are complementary to the DNA regions flanking the XhoI site. The products were digested with RsaI, an enzyme that recognizes the 4-bp sequence GTAC, and analyzed on a 1% agarose gel containing Tris-acetate-EDTA. Gels were viewed with an Eagle Eye imaging system (Stratagene, La Jolla, Calif.).
The PCR amplification products from those clones that were most highly enriched during HIRS selection on leaves were cloned into the SmaI site of pUC18 (34) for sequencing. DNA sequencing was performed at the University of California, Berkeley, Sequencing Facility (mcb.berkeley.edu/barker/dnaseq) with standard M13 forward and reverse primers. Both ends of the cloned PCR products were analyzed, typically allowing us to obtain the entire sequence contained in the chromosomal DNA insert. For gap closure and sequence confirmation, the results from one HIRS library clone were then compared to those from a second clone which exhibited an identical RsaI restriction digest pattern. Basic bioinformatic analysis and annotation were accomplished by using DNAMAN (Lynnon Biosoft, Vaudreuil, Quebec, Canada). Open reading frames (ORFs) were identified by using the ORF finder program (http://www.ncbi.nlm.nih.gov), and BlastX and BlastN functions were used for protein and nucleotide sequence similarity searches. Comparisons to the P. syringae pv. syringae B728a genome sequence were made by using the BlastN function at the U.S. Department of Energy Joint Genomes Institute (http://www.jgi.doe.gov).
Determination of GFP fluorescence.
Bacterial growth was estimated from the turbidity of cultures at 600 nm with a Perkin-Elmer 3A UV-visible spectrophotometer. GFP fluorescence in the bacterial cultures was determined in a Perkin-Elmer LS50B luminescence spectrometer with an excitation wavelength of 490 nm, an emission wavelength of 510 nm, and a slit width of 8 nm in both cases.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
The remaining colonies collected after the wet-dry cycle on leaves had a Met- phenotype in minimal medium. We can assume that these clones either lacked a promoter or contained promoter sequences conferring only low levels of transcription in culture. If the latter promoters were more active and conferred a Met+ phenotype on plants, they should have been enriched along with the constitutive promoters. To confirm the selection for any such plant-inducible promoters, we monitored the genetic diversity of the DNA inserts contained in the Met- clones throughout the selection process. Between 20 and 40 colonies randomly collected from each pool before, during, and after two sequential wet-dry cycles on plants were subjected to PCR amplification of their pTrap DNA insert. Restriction analysis of these PCR products revealed that the starting pools contained a high level of diversity among the genomic DNA library inserts (shown for one pool in Fig. 6A). This diversity was reduced to five predominant restriction patterns after a single wet-dry cycle on leaves (Fig. 6B). A second wet-dry cycle in which the inoculum consisted of only those colonies exhibiting a Met- phenotype in minimal medium resulted in the collection of clones consisting of primarily three restriction patterns (Fig. 6C). In a second library pool that was screened, restriction mapping of the pTrap DNA insert revealed that predominantly two clonal types were enriched (data not shown). These results suggest that there was strong selection for certain clones with a Met- phenotype in minimal medium; thus, it seems likely that those Met- clones harbor promoters which are induced during growth on leaves.
|
|
The predicted product of a gene initiated in clone 17.15 was most similar to the C4-dicarboxylate transport response regulator DctD (79% identity to Pseudomonas stutzeri DctD, accession no. CAC44170). Although dctD appears to be constitutively expressed in organisms such as Rhizobium meliloti (40), we were unable to find the appropriate conditions in culture medium for expression of the P. syringae dctD homologue contained in clone 17.15 (data not shown). Furthermore, the promoter region of the P. syringae dctD homologue contained a putative
54 consensus sequence (CTGGGCGG[cgaa]TTGCT), suggesting that this gene is expressed in a manner similar to that of other P. syringae
54-regulated genes, including those involved in virulence (15).
Putative plant-inducible genes were more difficult to identify among the other metXW HIRS-selected clones. The P. syringae chromosomal DNA sequence enriched in clone 17.4 encoded a putative 146-amino-acid protein that was 28% identical to a hypothetical protein of unknown function in Burkholderia thailandensis (accession number AAL47566.1). Clone 16.8 contained a 312-bp ORF for which no significant matches in the DNA and protein databases could be found. Clone 17.1 contained a putative ppkB gene encoding a putative protein product that was 64% identical to Pseudomonas aeruginosa PpkB (AAD22550). However, this gene was found to be in the opposite orientation with respect to metXW in the pTrap plasmid. Although two additional ORFs (450 and 1,008 bp), in the same orientation as metXW, were contained in the chromosomal DNA insert of clone 17.1, it is not clear whether these sequences encode expressed transcripts in P. syringae.
Relatively low promoter activity is sufficient to confer methionine prototrophy in the HIRS system.
The gfp reporter gene was included in pTrap as a convenient way to monitor promoter activity from any upstream promoter sequences (Fig. 1). Analysis of the GFP fluorescence of pS clones revealed that the plant-inducible promoters conferred only very low levels of expression in minimal medium, typically only slightly higher than those for B7MX89(pTrap) (16 fluorescence units) (Table 1). In contrast, the pPROT clones, which were Met+ in culture, exhibited significantly higher levels of GFP fluorescence, ranging from 35 to 157 fluorescence units. However, the lowest GFP fluorescence observed in pPROT strains was only slightly higher than that of the pS clones. This suggests that even very low promoter activity was sufficient to complement methionine auxotrophy in minimal medium.
To determine the threshold level of in vitro complementation of methionine auxotrophy, we examined the GFP fluorescence of 140 library clones. Fluorimeter measurements revealed that GFP fluorescence among the strains varied by over 100-fold (Fig. 7). Those strains with a normalized GFP fluorescence value below about 30 flourescence units were unable to grow in minimal medium lacking methionine. Most of the clones that conferred a Met+ phenotype exhibited only low to moderate levels of GFP fluorescence (Fig. 7). Often these values were below that conferred by the native metXW promoter (83 fluorescence units), which itself is considered to have only a low to moderate level of transcription (1). Apparently, many P. syringae promoters confer relatively low levels of gene expression, but this level of activity is adequate to produce sufficient MetXW to complement methionine auxotrophy in the pTrap system. This result implies that the metXW HIRS selection strategy is biased toward genes in B728a that have very low expression levels in culture media but which are activated on plants to an extent that permits survival and growth of P. syringae during desiccation stress.
|
| DISCUSSION |
|---|
|
|
|---|
The strength of the metXW HIRS strategy is best demonstrated by the decrease in the diversity of pTrap genomic DNA inserts among the P. syringae library clones following enrichment (Fig. 6). Following two cycles of enrichment on bean leaves, most colonies with a Met- phenotype in culture medium represented primarily five different clones, each of which restored wild-type survival and growth to B7MX89 under dry conditions on leaves. We expected approximately 266 clones out of the 1,400 HIRS clones tested in these pools to contain a P. syringae promoter oriented properly for transcription of metXW (i.e., assuming an average pTrap genomic DNA insert size of 900 bp, random orientation of inserts relative to metXW, and an average P. syringae gene size of 1 kb). The five unique pS clones with selectable plant-inducible activity therefore constituted 1.8% of those clones that were expected to contain a promoter. This theoretical value is remarkably similar to the frequency of plant-inducible genes which was observed earlier by Cirvilleri and Lindow (11). If this proportion of plant-inducible promoters is an accurate representation of P. syringae B728a gene expression patterns, we project that there are at least 120 plant-inducible loci in the 6-Mbp genome of this strain. An efficient selection scheme such as metXW HIRS will thus prove to be invaluable in further work to identify the plant-dependent transcriptome of P. syringae.
Although the primary aim of this report was to demonstrate the potential of the HIRS approach, we have analyzed the P. syringae library DNA sequences that were found to have plant-inducible activity. Sequence analysis of the metXW HIRS-selected clones revealed that at least two of the five clones harbored genes in their pTrap DNA inserts for which putative plant-inducible activity could be assigned. These genes, encoding XerD and DctD homologues, are involved in recombination and transcriptional regulation, respectively. Although more thorough analysis of these genes is necessary to determine their function in P. syringae, they also highlight regions of the chromosome and transcriptional regulons for which new insights into P. syringae adaptations for epiphtyic growth could be found.
The remaining clones contained ORFs for which there are presently no characterized homologues in the databases. This result suggests that bioinformatic analysis alone is not sufficient to identify all plant-inducible genes of P. syringae and that any promoter activity initiating from these sequences should also confirmed by independent methods. For example, initial transcriptional activity measurements performed with fusions of the selected pTrap chromosomal DNA inserts to an inaZ reporter gene suggest that these sequences confer 5- to 25-fold-higher levels of transcription on plants relative to growth in culture medium (data not shown).
A gfp reporter gene was included in pTrap in order to directly assess the relative level of transcriptional activity conferred by P. syringae promoters selected by the HIRS procedure. As expected, the plant-inducible promoters selected in this study conferred only very low levels of GFP fluorescence in minimal medium. Alternatively, clones harboring promoters that were active in minimal medium exhibited slight to very high levels of GFP fluorescence (Table 1). All of these clones also had wild-type growth characteristics on plants. Therefore, it is unlikely that high expression levels of GFP are detrimental to P. syringae stress tolerance on plants and could interfere with the selection of any highly expressed plant-inducible genes. This result also suggests that complementation of methionine auxotrophy on bean leaves is a qualitative (all-or-nothing) effect. In other words, once P. syringae attains a threshold level of methionine biosynthesis (indirectly measured as a GFP fluorescence of over 30 florescence units), the cells are able to adequately respond to desiccation stress and no benefit is gained from a higher threshold level of expression.
The low GFP fluorescence of a collection of pTrap transformants exhibiting a Met+ phenotype in minimal medium revealed that the overall level of transcriptional activity of most P. syringae genes is relatively low (Fig. 7). Similarly, it is also likely that only a small fraction of genes of other bacteria are highly expressed in a given environment. For example, Wei et al. found that fewer than 10% of E. coli genes represent approximately 50% of all mRNA transcripts when the cells were grown in various media (41). Furthermore, transcripts encoded by at least 20% of predicted and known E. coli genes could not be detected reliably by microarray experiments, even when the cells were grown in minimal medium (33, 36, 41). If it is indeed true that the transcriptome of bacteria can be characterized as containing many transcripts with low levels of abundance, then the methionine-based selection strategy will be a powerful way to select for such weakly expressed genes. Because even low levels of metXW expression are sufficient to confer a Met+ phenotype in minimal medium, we should be able to select only those genes that are essentially "off" in culture. In this respect, the high sensitivity of our metXW-based HIRS system is probably most similar to that of the recombination-based IVET, which requires only low levels of or transient gene expression to enable selection (9, 19). The types of genes identifiable by these two methods would probably have been overlooked in most other, less sensitive, IVET systems. For example, DFI selection systems are dependent on at least moderate levels of GFP fluorescence to enable selection of induced cells. In our experience, the majority of plant-inducible genes of P. syringae found by the HIRS selection did not exhibit sufficient transcriptional activity on plants for the GFP levels to be analyzed by fluorescence microscopy or flow cytometry, yet they could be detected by more a sensitive reporter gene such as inaZ (data not shown).
The choice of metXW for the HIRS strategy was based upon the previous finding that methionine auxotrophs of P. syringae were severely impaired in epiphytic fitness. However, it remains unclear why methionine biosynthesis is critical for epiphytic fitness during the transition to low RH on plants. Methionine can be found on leaf surfaces but only in very small amounts (29, 42). In culture, the growth rate and cell yield of B7MX89 decreased at methionine concentrations of less than 7.5 µg/ml (data not shown). Because B7MX89 grows at similar rates and to similar population sizes as wild-type B728a on leaves at high RH, it appears that at least this amount of methionine is available to cells on leaves. Upon exposure to dry conditions, methionine auxotrophs seem to lack either the metabolic versatility or a specific factor dependent upon methionine biosynthesis to tolerate the transition to dry leaf environments and to resume growth. This defect cannot be complemented on leaves either by cross-feeding with wild-type B728a cells (5, 6) or by topical applications of methionine to the leaves (1, 6). Methionine plays a central role in many biochemical reactions, most prominently in translational initiation and methylation reactions (35). The inability to synthesize methionine could have an impact on one or more of these processes and, consequently, on the expression of traits required for desiccation stress tolerance.
By increasing the level of dryness on leaves, we were able to modulate the enrichment of cells with a Met+ phenotype. However, irrespective of the stress levels to which plants were exposed, enrichment was consistently greater for cells located in protected sites on the leaf than for cells in more exposed locations (Fig. 4). Calculations of mortality revealed that wild-type P. syringae populations in protected sites were apparently less vulnerable to stress than those cells in exposed areas, and the surviving populations were also able to rapidly resume growth. Surprisingly, protected sites did not afford any protection to the metXW mutant, and cells quickly succumbed to desiccation in both protected and exposed sites on the leaf (Fig. 3B). One possible explanation for this result is that methionine auxotrophy prevents P. syringae from modifying protected sites on the leaf to allow growth during periods of desiccation stress. Nonpathogenic strains of P. syringae also fail to tolerate extended periods of desiccation stress on plants (43). These bacteria are apparently unable exploit the interior of the plant for growth as extensively as pathogenic strains and therefore may be more exposed to the more environmentally stressful conditions on the surface of the leaf. As a result of this differential behavior at various leaf sites, the strong enrichment for P. syringae with a Met+ phenotype in mixtures with Met- P. syringae on leaves resulted from both a lack of survival of Met- cells and the growth of Met+ cells primarily in protected sites.
Clearly, several factors influence the type and number of genes identified by a promoter trap strategy. The choice of laboratory media and screening approaches set the background limit for those genes considered "off" in vitro. Detection of induction in vivo is dependent on the complementarity of the selectable system to the location, extent, and duration of habitat-inducible gene expression. This effect was illustrated by an IVET strategy recently designed by Boch et al. to isolate virulence genes of P. syringae pv. tomato (7). Their approach was based on an in vivo complementation of hrcC, a plant-inducible gene required for the type III secretory system. Interestingly, many of the virulence genes identified are in the same regulon as hrcC. Genes induced prior to or following the requirement for HrcC may have gone undetected by this scheme. Because pathogenesis occurs only during a discrete phase of the interaction of P. syringae with plants, a complementary approach such as metXW HIRS should identify an additional set of genes involved in the early steps of colonization and adaptation to the leaf surface. While metXW HIRS may not identify all potential plant-inducible traits, its extreme sensitivity, as described by this study, is well suited for identifying those many weakly expressed genes that are overlooked in other IVET procedures. It should be possible to identify all plant-induced genes by coupling the metXW HIRS protocol with a complementary approach, such as DFI, which has a lower sensitivity and thus can detect genes with higher basal and induced levels of expression. We are currently performing a thorough application of the metXW HIRS system to examine plant-specific gene expression in P. syringae. The plant-inducible genes that are identified by metXW HIRS are likely to confer incremental contributions toward establishing and maintaining large epiphytic population sizes during the harsh environmental regimens to which plants are typically exposed.
| ACKNOWLEDGMENTS |
|---|
We thank J. H. J. Leveau for critical reviews of the manuscript.
| FOOTNOTES |
|---|
Present address: Wageningen Centre for Food Sciences, 6700 AN Wageningen, and NIZO Food Research, 6710 BA Ede, The Netherlands. ![]()
Present address: University of California General Hospital, San Francisco, CA 94110. ![]()
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | Microbiol. Mol. Biol. Rev. | Eukaryot. Cell | All ASM Journals |
|---|