AEM
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Emlyn-Jones, D.
Right arrow Articles by Andrews, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Emlyn-Jones, D.
Right arrow Articles by Andrews, T. J.
Agricola
Right arrow Articles by Emlyn-Jones, D.
Right arrow Articles by Andrews, T. J.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, November 2003, p. 6427-6433, Vol. 69, No. 11
0099-2240/03/$08.00+0     DOI: 10.1128/AEM.69.11.6427-6433.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Nitrogen-Regulated Hypermutator Strain of Synechococcus sp. for Use in In Vivo Artificial Evolution

Daniel Emlyn-Jones, G. Dean Price, and T. John Andrews*

Molecular Plant Physiology, Research School of Biological Sciences, Australian National University, Canberra, Australian Capital Territory 2601, Australia

Received 4 April 2003/ Accepted 19 August 2003


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Artificially evolved variants of proteins with roles in photosynthesis may be selected most conveniently by using a photosynthetic organism, such as a cyanobacterium, whose growth depends on the function of the target protein. However, the limited transformation efficiency of even the most transformable cyanobacteria wastes much of the diversity of mutant libraries of genes produced in vitro, impairing the coverage of sequence space. This highlights the advantages of an in vivo approach for generating diversity in the selection organism itself. We constructed two different hypermutator strains of Synechococcus sp. strain PCC 7942 by insertionally inactivating or nutritionally repressing the DNA mismatch repair gene, mutS. Inactivation of mutS greatly increases the mutation rate of the cyanobacterium's genes, leading to an up-to-300-fold increase in the frequency of resistance to the antibiotics rifampin and spectinomycin. In order to control the rate of mutation and to limit cellular damage resulting from prolonged hypermutation, we placed the uninterrupted mutS gene in the cyanobacterial chromosome under the transcriptional control of the cyanobacterial nirA promoter, which is repressed in the presence of NH4+ as an N source and derepressed in its absence. By removing or adding this substrate, hypermutation was activated or repressed as required. As expected, hypermutation caused by repression in PnirA-mutS transformants led to an accumulation of spectinomycin resistance mutations during growth.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Artificial evolution (sometimes called directed or laboratory evolution) has, in recent years, been applied to a wide range of individual genes, successfully changing properties of encoded proteins ranging from thermotolerance, to catalytic specificity, to total activity (reviewed in references 3, 21, 29, 35, and 39). Using artificial evolution, whole organisms also can be evolved rapidly to exhibit new and complex traits (25, 40).

Techniques for artificial evolution typically entail a mutagenesis step, in which sequence diversity is generated in particular genes, and a step in which phenotypic expression of variant genes confers the desired characteristic that is selected. These techniques range from entirely in vitro procedures (for example, in vitro co-compartmentalization of an evolved gene and its protein product in aqueous droplets emulsified in oil [10]) to fully in vivo procedures. One of the major factors that limit the efficacy of artificial evolution is the number of permutations of a particular sequence that can be screened for the desired functional characteristic (sequence-space coverage). In many artificial evolution protocols, mutagenesis is performed in vitro and selection is performed in vivo. When the selection must be done in a photosynthetic organism, such as a cyanobacterium, to select variants of proteins with roles in photosynthesis, for instance, transformation efficiencies are typically low (8), and this wastes much of the generated sequence diversity. This loss can be avoided by generating the sequence diversity in vivo in the same organism that is to be used for selection. In such systems, the mutagenesis need not remain restricted to a single gene or group of genes, but can encompass the whole genome. Furthermore, selection in vivo ensures that the genes remain evolved to function in an in vivo environment.

Genetic methods for in vivo mutagenesis have largely replaced classical methods, such as treatment with chemicals or UV, since the latter are discontinuous, nonrandom, and can lead to significant cell damage. Such in vivo mutagenesis systems (hypermutator strains) have been developed in Escherichia coli and Escherichia blattae (9, 25). No such strains, however, have been constructed in a photosynthetic bacterium or can be applied specifically to photosynthetic genes. Here we describe construction of a novel hypermutator strain in the cyanobacterium Synechococcus sp. strain PCC 7942. Cyanobacteria such as Synechococcus sp. strain PCC 7942 are frequently chosen as model organisms to manipulate and study photosynthesis due to their amenability to molecular manipulation and the similarity of their photosynthetic apparatus to that of higher plants.

We targeted the mutS gene, which encodes a key protein in the DNA mismatch repair system (MMR), to construct our hypermutator strain because of previous suggestions that it suppressed hypermutation (23). One of the central roles of the MMR system is in the correction of postreplication DNA errors (11, 26). We show that disruption of this gene in Synechococcus sp. strain PCC 7942 leads to a hypermutator phenotype. In order to control the rate and duration of artificial evolution, we constructed a second hypermutator strain by placing the undisrupted mutS gene under the transcriptional control of the promoter of the nirA gene of Synechococcus sp. strain PCC 7942 (17, 33). This promoter controls transcription from the nirA operon. It is regulated by the NtcA protein (16), and therefore transcription from it is strongly repressed in the presence of NH4+ as an N source and derepressed when NO3- is the sole N source. Thus, by varying N nutrition, hypermutation can be modulated and suppressed before and after selection to minimize unwanted mutations unrelated to those conferring the selected characteristic.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Growth of Synechococcus sp. strain PCC 7942.
The unicellular cyanobacterium Synechococcus sp. strain PCC 7942 (also known as Synechococcus elongatus PCC 7942, Synechococcus leopoliensis, and Anacystis nidulans R2) was grown photoautotrophically at 30°C under continuous illumination provided by fluorescent lamps (30 µmol quanta m-2 s-1). Cultures of Synechococcus sp. strain PCC 7942 were maintained in BG11 medium, which contains 18 mM NaNO3 and no NH4+ (2). Where exclusively NH4+-containing or NO3--containing medium was required, BG11 was modified to exclude nitrogen (32), and 3.75 mM (NH4)2SO4 or 15 mM KNO3, respectively, was added to this basal medium. To transfer cultures between these modified media, cells were pelleted by centrifugation at 5,000 x g for 5 min at 25°C and washed three times by resuspension in new medium followed by recentrifugation. The same procedure was used to transfer cultures grown on solid medium to modified liquid medium, except that the cells were suspended in the liquid medium first. Cultures on plates were maintained in 2% (vol/vol) CO2 in air. Liquid cultures were sparged with air. Where appropriate, kanamycin was added to media at a final concentration of 30 µg ml-1, spectinomycin was added at 20 µg ml-1, and rifampin was added at 50 µg ml-1.

Isolation and analysis of DNA.
DNA manipulations and DNA blotting were performed according to standard protocols (24). Genomic DNA was prepared from Synechococcus sp. strain PCC 7942 by using a standard miniprep procedure (22). Plasmid DNA was prepared from E. coli by using a standard miniprep procedure based on Qiagen protocols (Qiagen booklet). Preparative PCR was performed with the high-fidelity enzyme Herculase DNA polymerase (Stratagene). Analytical PCRs were performed with recombinant Taq DNA polymerase (MBI Fermentas).

Isolation of sequence 3' to the known mutS fragment from Synechococcus sp. strain PCC 7942.
A 402-bp sequence with high homology to part of the protein-coding region of mutS was obtained previously from a random insertional mutant of Synechococcus sp. strain PCC 7942 (23) (GenBank accession no. U95756). To obtain sequence flanking this fragment, inverse PCR (36) was employed on ligated, BamHI-digested, genomic DNA from Synechococcus sp. strain PCC 7942 with the primers IPCRF (5'TATGCCAGCCAGTTAGTTGAG3') and IPCRR (5'TTCTTTCCCTGCTTCCTTGCT3'). Three products were obtained, only one of which contained mutS sequence detectable on DNA blots probed with a fragment of Synechococcus sp. strain PCC 7942 mutS amplified with the primers mutSPrF (5'GGGTTACGCGATCGCGATCTGCGAT3') and mutSPrR (5'GAGCTCCTGGGTCAGTCCCTCCAGA3') (data not shown). This 3.5-kb fragment was extracted from a gel, A-tailed, and cloned into pGEM-T Easy (Promega technical manual). Sequencing revealed that the inverse PCR product had been amplified from two BamHI fragments that had ligated together, rather than from a single circularized fragment. Primer IPCRR apparently had bound to an alternative, perhaps homologous, site outside mutS, and, therefore, only mutS sequence downstream of the previously known mutS fragment was obtained. This additional sequence (0.7 kb), together with the 0.4-kb sequence previously known, was sufficient for insertional inactivation of mutS.

Insertional inactivation of mutS.
The procedure used relied on double homologous recombination following transformation with a plasmid containing a partial mutS sequence interrupted and partly replaced by a Kmr gene encoding neomycin phosphotransferase, which confers resistance to kanamycin (Fig. 1A). Based on the sequence of the inverse-PCR product, a 1.08-kb region of mutS—subsequently found to encompass nucleotides +196 to +1277 of the protein-coding region (described below)—was PCR amplified from genomic DNA from Synechococcus sp. strain PCC 7942 with the primers {Delta}mutSF (5'GGCAAGCTTCCCGCGAGCTAGAGCTGGTGT3', HindIII site underlined) and {Delta}mutSR (5'GGCGAATTCATTGGGCACGATTGAGTAACT3', EcoRI site underlined). This fragment was cloned into the EcoRI-HindIII-digested pUC19, producing pUC19mutS. A 1.2-kb Kmr gene was excised from pUC4K by using HincII and cloned into SacI-PstI-digested, Klenow-blunted pUC19mutS, producing pUC19mutS{Delta}K. pUC19mutS{Delta}K was transformed into Synechococcus sp. strain PCC 7942, and {Delta}mutS::Kmr transformants (with a 130-bp fragment of mutS replaced by a Kmr gene) were selected on kanamycin-containing plates. After several rounds of restreaking on solid medium in the presence of antibiotic, complete segregation of the insertion (produced by double-homologous recombination) throughout all genome copies was established by PCR with primers {Delta}mutSF and {Delta}mutSR: the wild type gave a single 1.1-kb band, while the {Delta}mutS::Kmr transformants gave a single 2.3-kb band, as expected (Fig. 1B).



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 1. Insertional inactivation of the mutS gene of Synechococcus sp. strain PCC 7942. (A) Strategy for inactivation by double-homologous recombination (represented by the crossed lines) with plasmid-borne, known mutS fragments (stippled boxes) flanking a Kmr gene. The boxes with jagged ends represent the unknown 5' and 3' regions of mutS. (B) Fluorograph of an ethidium bromide-stained agarose gel showing electrophoretic separation of the PCR products amplified from genomic DNA from the wild type (wt) and a {Delta}mutS::Kmr transformant by using the {Delta}mutSF and {Delta}mutSR primers (see Materials and Methods). The single band at 2.3 kb in the transformant confirms correct integration of the {Delta}mutS::Kmr construct and its segregation to homoplasmicity.

 
Isolation of sequence 5' to the known mutS fragment.
A modified plasmid-rescue strategy, adapted from previous procedures (12, 31), was used (Fig. 2). The complete plasmid pUC18Kan (12, 31), cleaved at its HincII site, was cloned into NaeI-cleaved pUC19mutS (described above) to produce pUC19mutSpUC18Kan. This hybrid plasmid contained two origins of replication but could still replicate. pUC19mutSpUC18Kan was sequenced to determine the orientation of the pUC18Kan sequence and then used to transform Synechococcus sp. strain PCC 7942 to kanamycin resistance. Double-homologous recombination resulted in the integration of the pUC18Kan sequence into mutS in the cyanobacterial genome. Plasmid rescue of the upstream region of mutS was then performed by ligating SacI-digested genomic DNA from a transformant. The rescued plasmid contained 690 bp of sequence upstream of the mutS fragment known previously. The initiation codon commencing the mutS open reading frame was assigned on the basis of homology with other mutS sequences.



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 2. Protocol used for plasmid rescue of the sequence upstream of the known mutS sequence (stippled boxes) (23). Double-homologous recombination of the entire pUC18Kan sequence into mutS in the cyanobacterial genome (depicted by the crossed lines) ensured no duplication of the mutS sequence and facilitated plasmid rescue following digestion of the genomic DNA of the transformant with SacI. The boxes with jagged ends represent the unknown 5' and 3' regions of mutS.

 
Fusion of the NH4+-repressible nirA promoter region to the mutS gene.
Nucleotides +1 to +523 of mutS were amplified by using primers nirA1 (5'GGCTCATGACAACTTCTGAGCTTCCGGAGC3', BspHI site underlined) and nirA2 (5'GGCGAATTCTAGTCACCAGTGGAGCTATCT3', EcoRI site underlined), producing the product mutSPCR. The nirA1 primer was designed to incorporate the codon for the N-terminal Met of mutS into the BspHI site. Nucleotides +4 to -553 of the promoter region of the nirA gene of Synechococcus sp. strain PCC 7942 were amplified with primers nirA3 (5'GGCCCATGGATTCATCTGCCTACAAAGCAG3', NcoI site underlined) and nirA4 (5'GGCGCATGCATAAATTTCTGTTTTGACCAA3', SphI site underlined), producing the product PnirAPCR. The natural NcoI site present in nirA3 contained the initiator Met codon of nitrite reductase. Nucleotides -8 to -510 of the mutS promoter region were amplified with primers nirA5 (5'GGCAAGCTTTATCACACTTGCATTGGGCAA3', HindIII site underlined) and nirA6 (5'GGCAAGTCCAGCTAGTAAGGCCAGCCATCG3', HindIII site underlined), producing the product mutS5'PCR. All three PCR products were extracted from gels, A-tailed, and cloned into pGEM-T Easy (Promega technical manual). PnirAPCR was excised from pGEM-T Easy by using SphI and SalI and cloned into the SphI and SalI sites of pGEM-3Zf(+), producing pGEM-3Zf(+)PnirAPCR. mutSPCR was excised from pGEM-T Easy by using BspHI and SacI and cloned into the NcoI and SacI sites of pGEM-3Zf(+)PnirAPCR, producing pGEM-3Zf(+)PnirAmutSPCR. mutS5'PCR was excised from pGEM-T Easy by using HindIII and cloned into the HindIII site of pGEM-3Zf(+)nirAmutSPCR in the correct orientation with respect to mutS, producing pGEM-3Zf(+)PnirAmutSmutS5'PCR. Finally, a Kmr gene excised from pUC4K by using HincII was cloned into the BalI sites of pGEM-3Zf(+)PnirAmutSmutS5'PCR present at positions -323 and -368 of the nirA promoter region, such that transcription of the Kmr gene occurred in the opposite orientation to mutS transcription. This minimized the possibility of transcriptional readthrough from the Kmr gene into mutS. The completed construct (Fig. 3A) was sequenced with primers nirA1 to nirA6 to verify that no errors had been introduced by PCR and that the nirA promoter was appropriately fused to the mutS gene.



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 3. Insertion of the nirA promoter (PnirA) into a position to control transcription of mutS. (A) {Phi}(PnirA-mutS) construct used to insert PnirA, showing the main restriction sites used for its construction and DNA blot analysis. The crossed lines depict insertion of the construct by double-homologous recombination into the wild-type locus. Stippling indicates the mutS sequence, cross-hatching indicates the PnirA sequence, and solid black indicates the Kmr sequence. (B) DNA blot of BamHI-BglII-digested genomic DNA from the wild type (wt) and a {Phi}(PnirA-mutS) transformant using the mutS probe (see Materials and Methods). The single band at 3.3 kb in the {Phi}(PnirA-mutS) transformant confirms correct integration of the {Phi}(PnirA-mutS) construct and its segregation to homoplasmicity.

 
The construct was linearized by digestion with ScaI and transformed into Synechococcus sp. strain PCC 7942, and transformants were selected with kanamycin [{Phi}(PnirA-mutS), a gene fusion construct containing mutS under the transcriptional control of the nirA promoter]. Ten transformants were selected for analysis. After several rounds of restreaking on solid medium in the presence of antibiotic, genomic DNA isolated from the transformants and the wild type was digested with BglII-BamHI and subjected to DNA blotting with the mutS probe described above. A single band of 1.4 kb was observed for the wild type, and a single band of 3.3 kb was observed for all transformants (Fig. 3B). This confirmed that, for all transformants, double-homologous recombination had resulted in correct insertion and complete segregation of the PnirA-Kmr-mutS sequence (Fig. 3A).

Measurement of relative mutation rate.
Wild-type, {Delta}mutS::Kmr, and {Phi}(PnirA-mutS) cells were grown in liquid medium (containing kanamycin for the insertional mutants, but not for the wild type) with NO3- as the nitrogen source [and also with NH4+ as a nitrogen source in the case of {Phi}(PnirA-mutS)]. The numbers of cells in mid-exponential-phase cultures were estimated by measuring the apparent A750. (Apparent absorbance was related to the number of cells per unit volume by calibration with a hemocytometer.) Concentrated cultures (~1010 cells) were plated onto solid media containing NO3- and rifampin or spectinomycin. After several weeks, antibiotic-resistant colonies were counted, and thus the frequency of antibiotic-resistant cells in the original culture was calculated. This frequency was taken as a measure of the relative mutation rate. Similar platings onto antibiotic-free media revealed that the plating efficiencies were similar for the wild type, {Delta}mutS::Kmr, and {Phi}(PnirA-mutS) strains grown on either NO3- or NH4+. Ninety to 120% of the cells plated (estimated as above) yielded colonies regardless of genotype or prior growth condition. A plating efficiency of 100% was assumed when calculating the mutation rate.

Nucleotide sequence accession number.
The sequence of the mutS fragment obtained by Ronen-Tarazi et al. (23) can be obtained from GenBank under accession no. U95756. The extended sequence determined in this publication has also been deposited in GenBank (accession no. AY191320).


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Phenotype of {Delta}mutS::Kmr transformant.
Using a combination of a novel plasmid-rescue procedure and inverse PCR, a 1.8-kb segment of the coding and 5' noncoding regions of mutS was isolated (see Materials and Methods). The mutS sequence isolated from Synechococcus sp. strain PCC 7942 was highly homologous to the mutS sequences of the other cyanobacteria, Synechocystis sp. strain PCC 6803 and Thermosynechococcus elongatus BP-1 (Cyanobase: http://www.kazusa.or.jp/cyano/cyano.html). To assess whether inactivation of mutS in Synechococcus sp. strain PCC 7942 resulted in a hypermutator phenotype, the relative rates of appearance of resistance to rifampin and spectinomycin were compared in three separate {Delta}mutS::Kmr transformants and in the wild type.

Resistance to rifampin and spectinomycin results from spontaneous point mutations in genes encoding RNA polymerase and ribosomal components, respectively. With both antibiotics, a greater mutation rate was observed in the mutants (Table 1). In different experiments, the increases ranged from 30- to 300-fold (mean, 132 ± 124) for rifampin and 6- to 30-fold (mean, 15 ± 11) for spectinomycin. The difference between the two antibiotics may reflect differences in the frequency of resistance-conferring mutable sites in the target genes. For the {Delta}mutS::Kmr strain, the variability between experiments is likely to be caused by variation in the number of generations that the cells had passed through between the transformation event that caused insertional inactivation of mutS and plating on rifampin- or spectinomycin-containing medium. Since many of these generations will have occurred during growth of the first colony of the single initial transformant cell, this variation is not controllable. This lack of control is an inherent problem when hypermutation derives from insertional inactivation. Nevertheless, we concluded that disruption of mutS does cause a hypermutator phenotype and that this gene can be used as a basis of a hypermutator strain.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Frequencies of antibiotic-resistant cells in wild-type and {Delta}mutS::Kmr cultures

 
We do not know what genes flank mutS in the Synechococcus sp. strain PCC 7942 genome, or whether mutS is monocistronic. However, in fully sequenced cyanobacterial genomes, mutS is flanked by seemingly unrelated genes (analysis not shown). Therefore, it seems unlikely that disruption of another transcriptionally linked gene contributes to the phenotype of {Delta}mutS::Kmr. Despite the hypermutator phenotype, {Delta}mutS::Kmr grew photoautotrophically at a rate similar to that of the wild type (described below).

Phenotype of the {Phi}(PnirA-mutS) transformants.
To control the expression of mutS, and thus the degree of hypermutation, the mutS gene was placed under the transcriptional control of the promoter of the nirA operon of Synechococcus sp. strain PCC 7942. This promoter has been well characterized. Repression in the presence of 7.5 mM NH4+ results in a dramatic reduction in transcript abundance (17, 20, 33). Three {Phi}(PnirA-mutS) transformants, which had been maintained on NO3--containing solid medium, were inoculated into liquid cultures of NH4+-replete and NO3--replete medium (containing kanamycin). These cultures grew at similar rates (described below) and were diluted each week with the same medium to a final A750 of 0.05 to 0.1. The frequency of spectinomycin-resistant cells was measured every 2 weeks.

After transfer of NO3--grown inocula to NH4+-replete media, the cells grew more slowly for approximately 1 week before normal growth commenced. This lag period, which was observed in the wild type as well as in the {Phi}(PnirA-mutS) strain (data not shown), may be an adaptation phase, and no increase in the frequency of spectinomycin resistance occurred during it (Fig. 4). Subsequently, the frequency of resistant mutants in the {Phi}(PnirA-mutS)(NH4+) culture increased by approximately 4-fold at week 3 and 20-fold at week 5. Meanwhile, no increase was observed in the {Phi}(PnirA-mutS)(NO3-) culture, which maintained a mutation rate within the range observed for the wild type (Fig. 4 and Table 1). This demonstrates that control of hypermutation when using the {Phi}(PnirA-mutS) system is effective. It also establishes that the nirA promoter drives expression of mutS at an adequate level in the presence of NO3-.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 4. Frequencies of spectinomycin-resistant cells (left ordinate, solid lines) in {Phi}(PnirA-mutS) cultures after transfer in triplicate from NO3--replete solid medium to either NH4+-replete ({circ}) or NO3--replete (•) liquid medium. Each point is an average of the three measurements (± standard deviation). The frequency of resistant cells in NO3--replete medium was in the range observed for wild-type cultures (Table 1). The numbers of doublings since the transfer, estimated from the measured growth rates (see Results), are plotted on the right ordinate (dashed lines): {square}, NH4+; {blacksquare}, NO3-. The arrows indicate the times at which the cultures were diluted.

 
Relationship between growth and hypermutation.
The three genotypes grew at similar rates in liquid culture with kanamycin, regardless of nitrogen source. The doubling times were as follows: wild type (no kanamycin), 33.4 ± 1.6 h; {Delta}mutS::Kmr, 30.4 ± 1.7 h; {Phi}(PnirA-mutS)(NO3-), 29.7 ± 6.0 h; {Phi}(PnirA-mutS)(NH4+), 27.9 ± 3.9 h. With {Phi}(PnirA-mutS), the growth lag during the first week after switching the nitrogen source from NO3- to NH4+ increased the average doubling time during this period to 66 ± 7 h. For this strain, the frequency of spectinomycin-resistant mutations correlated roughly with the number of cell doublings since repression of mutS (Fig. 4).


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Under unchanging conditions, bacterial populations typically maintain a very low mutation rate to suppress the mostly deleterious effects of random mutations (5). In times of change, however, natural hypermutator strains often can arise in such populations (15, 18, 27, 34). Such hypermutator strains are thought to play a role in evolutionary adaptation to a new environment, and many have disruptions in the MMR pathway. By placing the mutS gene of the MMR pathway of Synechococcus sp. strain PCC 7942 under the N-regulated control of the nirA promoter, we have made this process experimentally controllable in a cyanobacterium suitable for selecting genes for photosynthesis-related proteins with specified altered properties.

Cyanobacteria, such as Synechococcus sp. strain PCC 7942, grow much more slowly than E. coli: >6-h doubling time even under optimal conditions (19). Therefore, generation of mutations takes weeks (Fig. 4) rather than the days required with similar E. coli hypermutators (9), but this does not cause serious difficulty. The cyanobacterial hypermutator that we have constructed is not as sophisticated as some hypermutator strains of E. coli, in which a variety of genes involved in the MMR pathway and other genes as well as mutS have been altered to enhance the rate of mutation (9, 25). Future cyanobacterial hypermutator strains may be engineered by using analogous target genes, a task now made easier by the availability of complete genome sequences for some cyanobacteria.

Our observations that disruption (Table 1) or controlled repression (Fig. 4) of mutS causes a hypermutator phenotype support the previous inference by Ronen-Tarazi et al. (23) that the high-CO2-requiring phenotype of the IL-7 mutant of Synechococcus sp. strain PCC 7942 is caused by a secondary point mutation resulting from a primary insertional disruption of the mutS gene. They also indicate that there is a single functional copy of the mutS gene in this cyanobacterium, consistent with the single restriction fragment detected on DNA blots by using the mutS probe (Fig. 3B) and the available whole-genome sequences of other cyanobacteria (Cyanobase). Ronen-Tarazi et al. (23) observed that IL-7 cells sometimes became elongated—up to 5 to 15 times the length of wild-type cells. We found this elongated-cell phenotype to be quite common in various strains of wild-type Synechococcus sp., including strain PCC 7942, when grown on solid media and are unsure of its physiological significance.

Our data (Fig. 4) are consistent with the expectation that growth is required for hypermutation, presumably because DNA synthesis must occur for the defect caused by lack of the MutS protein to be expressed. This requirement must be incorporated into selection protocols. Selection conditions that do not permit growth of unmutated cells will need to follow a period of growth under permissive conditions during which mutations can accumulate. Such a strategy is illustrated schematically in Fig. 5.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 5. Schematic diagram illustrating artificial evolution using the {Phi}(PnirA-mutS) system in Synechococcus sp. strain PCC 7942. In the presence of NO3-, the nirA promoter drives mutS expression at a level sufficient to maintain a wild-type mutation rate. On transfer to NH4+-containing medium, mutS expression is repressed, inducing hypermutation, and with growth, mutations accumulate. Mutations that confer a desired trait are then selected under a selection condition that restricts growth of wild-type cells. After selection of the desired mutants, the wild-type mutation rate is restored by transfer to medium lacking NH4+. Mutations (*) are shown accumulating in the cyanobacterial chromosome, but would also be introduced into foreign genes borne upon shuttle vectors, if desired.

 
The {Phi}(PnirA-mutS) system will make a useful addition to the toolbox of molecular genetic techniques available for the study and manipulation of cyanobacteria (6, 13, 38). Completion of the genome-sequencing projects currently in progress on Synechococcus sp. strain PCC 7942 (Synechococcus elongatus PCC 7942 Functional Genomics Project: http://www.bio.tamu.edu/synecho/index.html) and its close relative, Synechococcus sp. strain PCC 6301 (Anacystis nidulans 6301 Genome Project: http://www.bio.nagoya-u.ac.jp:8001/~gene/CGR6301gp.html), will enhance this utility. Among other benefits, the genome sequence will facilitate location of mutation sites in the {Phi}(PnirA-mutS) transformants evolved under specific conditions, using techniques such as genomic mapping by functional complementation (14). The biotechnological uses of cyanobacteria are numerous and wide ranging and include directed mutation of genes related to photosynthesis, bioremediation (28), and industrial hydrogen production (37). Systems such as {Phi}(PnirA-mutS) could play a key role in adapting cyanobacteria to perform optimally in these tasks. Systems for the expression of foreign proteins also exist for Synechococcus sp. strain PCC 7942 (1, 7), allowing the artificial evolution of foreign genes in vivo.

Combination of the respective strengths of different techniques may also be a useful way of enhancing artificial evolution. For example, DNA shuffling in vitro (reassembly of genes from random fragments of a single gene or family of related genes) (4, 30) could be used to generate starting diversity in a library of target genes. Although much of this diversity will be lost when the library is transformed into a selection organism, such as {Phi}(PnirA-mutS), this would nevertheless introduce a powerful combinatorial element to complement the wide sequence-space coverage and whole-genome approach of the subsequent in vivo mutagenesis.


    FOOTNOTES
 
* Corresponding author. Mailing address: Research School of Biological Sciences, Australian National University, P.O. Box 475, Canberra, ACT 2601, Australia. Phone: 61 0 2 6125 5072. Fax: 61 0 2 6125 5075. E-mail: John.Andrews{at}anu.edu.au. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Asada, Y., Y. Koike, J. Schnackenberg, M. Miyake, I. Uemura, and J. Miyake. 2000. Heterologous expression of clostridial hydrogenase in the cyanobacterium Synechococcus PCC7942. Biochim. Biophys. Acta 1490:269-278.[Medline]
  2. Castenholz, R. W. 1988. Culturing methods for cyanobacteria. Methods Enzymol. 167:68-93.
  3. Cohen, N., S. Abramov, Y. Dvor, and A. Freeman. 2001. In vitro enzyme evolution: the screening challenge of isolating the one in a million. Trends Biotechnol. 19:507-510.[CrossRef][Medline]
  4. Crameri, A., S. A. Raillard, E. Bermudez, and W. P. C. Stemmer. 1998. DNA shuffling of a family of genes from diverse species accelerates directed evolution. Nature 391:288-291.[CrossRef][Medline]
  5. Drake, J. W. 1991. A constant rate of spontaneous mutation in DNA-based microbes. Proc. Natl. Acad. Sci. USA 88:7160-7164.[Abstract/Free Full Text]
  6. Elhai, J. 1994. Genetic techniques appropriate for the biotechnological exploitation of cyanobacteria. J. Appl. Phycol. 6:177-186.[CrossRef]
  7. Emlyn-Jones, D., S. M. Whitney, G. D. Price, and T. J. Andrews. 2001. Substitution of foreign Rubiscos in the cyanobacterium, Synechococcus PCC7942 (article S16-015). In Proceedings of the 12th International Congress on Photosynthesis. CSIRO Publishing, Melbourne, Australia. [Online.] http://www.publish.csiro.au/ps2001.
  8. Golden, S. S., and L. A. Sherman. 1984. Optimal conditions for genetic transformation of the cyanobacterium Anacystis nidulans R2. J. Bacteriol. 158:36-42.[Abstract/Free Full Text]
  9. Greener, A., and M. Callahan. 1994. XL1-Red: a highly efficient random mutagenesis strain. Strategies 7:32-34.
  10. Griffiths, A. D., and D. S. Tawfik. 2003. Directed evolution of an extremely fast phosphotriesterase by in vitro compartmentalization. EMBO J. 22:24-35.[CrossRef][Medline]
  11. Harfe, B. D., and S. Jinks-Robertson. 2000. DNA mismatch repair and genetic instability. Annu. Rev. Genet. 34:359-399.[CrossRef][Medline]
  12. Klughammer, B., D. Sültemeyer, M. R. Badger, and G. D. Price. 1999. The involvement of NAD(P)H dehydrogenase subunits, NdhD3 and NdhF3, in high-affinity CO2 uptake in Synechococcus sp. PCC7002 gives evidence for multiple NDH-1 complexes with specific roles in cyanobacteria. Mol. Microbiol. 32:1305-1315.[CrossRef][Medline]
  13. Koksharova, O. A., and C. P. Wolk. 2002. Genetic tools for cyanobacteria. Appl. Microbiol. Biotechnol. 58:123-137.[CrossRef][Medline]
  14. Kufryk, G. I., and W. F. J. Vermaas. 2001. A novel protein involved in the functional assembly of the oxygen-evolving complex of Photosystem II in Synechocystis PCC6803. Biochemistry 40:9247-9255.[CrossRef][Medline]
  15. LeClerk, J. E., B. Li, W. L. Payne, and T. A. Cebula. 1996. High mutation frequencies among Escherichia coli and Salmonella pathogens. Science 274:1208-1211.[Abstract/Free Full Text]
  16. Luque, I., E. Flores, and A. Herrero. 1994. Molecular mechanism for the operation of nitrogen control in cyanobacteria. EMBO J. 13:2862-2869.[Medline]
  17. Maeda, S.-I., Y. Kawaguchi, T.-A. Ohe, and T. Omata. 1998. cis-Acting sequences required for NtcB-dependent, nitrite-responsive positive regulation of the nitrate assimilation operon in the cyanobacterium Synechococcus sp. strain PCC 7942. J. Bacteriol. 180:4080-4088.[Abstract/Free Full Text]
  18. Mao, E. F., L. Lane, J. Lee, and J. H. Miller. 1997. Proliferation of mutators in a cell population. J. Bacteriol. 179:417-422.[Abstract/Free Full Text]
  19. Mori, T., B. Binde, and C. Hirschie Johnson. 1996. Circadian gating of cell division in cyanobacteria growing with average doubling times of less than 24 hours. Proc. Natl. Acad. Sci. USA 93:10183-10188.[Abstract/Free Full Text]
  20. Omata, T., G. D. Price, M. R. Badger, M. Okamura, S. Gohta, and T. Ogawa. 1999. Identification of an ATP-binding cassette transporter involved in bicarbonate uptake in the cyanobacterium Synechococcus sp. strain PCC7942. Proc. Natl. Acad. Sci. USA 96:13571-13576.[Abstract/Free Full Text]
  21. Petrounia, I. P., and F. H. Arnold. 2000. Designed evolution of enzymatic properties. Curr. Opin. Biotechnol. 11:325-330.[CrossRef][Medline]
  22. Porter, R. D. 1988. DNA transformation. Methods Enzymol. 167:703-714.[Medline]
  23. Ronen-Tarazi, M., V. Shinder, and A. Kaplan. 1998. A mutant of Synechococcus PCC7942 impaired in HCO3- uptake. FEMS Microbiol. Lett. 159:317-324.[Medline]
  24. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  25. Selifonova, O., F. Valle, and V. Schellenberger. 2001. Rapid evolution of novel traits in microorganisms. Appl. Environ. Microbiol. 67:3645-3649.[Abstract/Free Full Text]
  26. Sixma, T. K. 2001. DNA mismatch repair: MutS structures bound to mismatches. Curr. Opin. Struct. Biol. 11:47-52.[CrossRef][Medline]
  27. Sniegowski, P. D., P. J. Gerrish, and R. E. Lenski. 1997. Evolution of high mutation rates in experimental populations of E. coli. Nature 387:703-705.[CrossRef][Medline]
  28. Sorkhoh, N., R. Al-Hasan, S. Radwan, and T. Hopner. 1992. Self-cleaning the gulf. Nature 359:109.
  29. Soumillion, P., and J. Fastrez. 2001. Novel concepts for selection of catalytic activity. Curr. Opin. Biotechnol. 12:387-394.[CrossRef][Medline]
  30. Stemmer, W. P. C. 1994. Rapid evolution of a protein in vitro by DNA shuffling. Nature 370:389-391.[CrossRef][Medline]
  31. Sültemeyer, D., B. Klughammer, M. Ludwig, M. R. Badger, and G. D. Price. 1997. Random insertional mutagenesis used in the generation of mutants of the marine cyanobacterium Synechococcus sp. strain PCC7002 with an impaired CO2 concentrating mechanism. Aust. J. Plant Physiol. 24:317-327.
  32. Suzuki, I., H. Kikuchi, S. Nakanishi, Y. Fujita, T. Sugiyama, and T. Omata. 1995. A novel nitrite reductase gene from the cyanobacterium Plectonema boryanum. J. Bacteriol. 177:6137-6143.[Abstract/Free Full Text]
  33. Suzuki, I., T. Sugiyama, and T. Omata. 1993. Primary structure and transcriptional regulation of the gene for nitrite reductase from the cyanobacterium Synechococcus PCC7942. Plant Cell Physiol. 34:1311-1320.[Abstract/Free Full Text]
  34. Taddei, F., M. Radman, J. Maynard-Smith, B. Toupance, P. H. Gouyon, and B. Godelle. 1997. Role of mutator alleles in adaptive evolution. Nature 387:700-702.[CrossRef][Medline]
  35. Tobin, M. B., C. Gustafsson, and G. W. Huisman. 2000. Directed evolution: the ‘rational’ basis for ‘irrational’ design. Curr. Opin. Struct. Biol. 10:421-427.[CrossRef][Medline]
  36. Triglia, T., M. G. Peterson, and D. J. Kemp. 1988. A procedure for in vitro amplification of DNA segments that lie outside the boundaries of known sequences. Nucleic Acids Res. 16:8186.[Free Full Text]
  37. Tsygankov, A. A., V. B. Borodin, K. K. Rao, and D. O. Hall. 1999. H2 photoproduction by batch culture of Anabaena variabilis ATCC 29413 and its mutant PK84 in a photobioreactor. Biotechnol. Bioeng. 64:709-715.[CrossRef][Medline]
  38. Vermaas, W. 1996. Molecular genetics of the cyanobacterium Synechocystis sp. PCC6803: principles and possible biotechnological applications. J. Appl. Phycol. 8:263-273.
  39. Wahler, D., and J.-L. Reymond. 2001. Novel methods for biocatalyst screening. Curr. Opin. Chem. Biol. 5:152-158.[CrossRef][Medline]
  40. Zhang, Y.-X., K. Perry, V. A. Vinci, K. Powell, W. P. C. Stemmer, and S. B. del Cardayre. 2002. Genome shuffling leads to rapid phenotypic improvement in bacteria. Nature 415:644-646.[CrossRef][Medline]


Applied and Environmental Microbiology, November 2003, p. 6427-6433, Vol. 69, No. 11
0099-2240/03/$08.00+0     DOI: 10.1128/AEM.69.11.6427-6433.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Emlyn-Jones, D.
Right arrow Articles by Andrews, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Emlyn-Jones, D.
Right arrow Articles by Andrews, T. J.
Agricola
Right arrow Articles by Emlyn-Jones, D.
Right arrow Articles by Andrews, T. J.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. Microbiol. Mol. Biol. Rev. Eukaryot. Cell All ASM Journals