Previous Article | Next Article ![]()
Applied and Environmental Microbiology, November 2003, p. 6620-6627, Vol. 69, No. 11
0099-2240/03/$08.00+0 DOI: 10.1128/AEM.69.11.6620-6627.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Unité d'Immuno-Allergie Alimentaire, INRA/CEA, CE de Saclay, DRM-SPI, 91191 Gif-sur-Yvette,1 Unité de Recherches Laitières et de Génétique Appliquée, INRA, 78352 Jouy en JosasFrance2
Received 7 April 2003/ Accepted 27 August 2003
|
|
|---|
|
|
|---|
Cow's milk allergy is an important problem in infants, affecting 1.9 to 2.8% of infants in the first 2 years of life in various countries of northern Europe (18, 19). ß-Lactoglobulin (Blg; 18 kDa) is the most abundant protein of the soluble fraction of cow's milk and is regarded as a dominant allergen. Major human IgE epitopes were shown to be fragments 41 to 60, 102 to 124, and 149 to 162 (41). Peptide 41-60 (Blg41-60) has also been described as a mouse and rat IgE epitope (2, 30) and as a mouse T-cell determinant (47, 48). Moreover, it can be detected easily by Western blot experiments and by a competitive enzyme immunoassay (EIA) developed in our laboratory that uses two monoclonal antibodies (MAbs), Blg-21R and Blg-31R (32), specific for Blg41-60 (8).
Lactococcus lactis, the model gram-positive lactic acid bacterium, is nonpathogenic and noninvasive and possesses both GRAS (generally regarded as safe) and food-grade status. L. lactis has been extensively engineered for the production of heterologous therapeutic proteins (4, 7, 11, 14, 24, 35, 44). L. lactis has already been used as an antigen delivery vehicle for vaccination against tetanus (52) and, more recently, for treatment of murine colitis (43).
L. lactis was already used to produce entire Blg protein, and recombinant strains were shown to be immunogenic after intranasal and oral administration in mice (7). More recently, Bernasconi et al. (5) showed that the Lactobacillus bulgaricus exported protease PrtB could enhance the export of both entire Blg and a poorly antigenic Blg peptide in L. lactis. Here, we constructed an L. lactis strain producing Blg41-60::Nuc, a recombinant fusion protein between Blg41-60 and the mature part of the staphylococcal nuclease (Nuc) (26), by use of the nisin-inducible expression system (9). Binding of anti-Blg41-60 MAbs to purified Blg41-60::Nuc or synthetic Blg41-60 was very similar. Four hours after induction, up to 75% of Blg41-60::Nuc is secreted and the amount of Blg41-60::Nuc produced reaches its maximum (32.5 mg/liter). In vivo studies showed that subcutaneous administration of the killed recombinant strain did not elicit anti-Blg41-60 antibodies, but a Blg41-60-specific response can be obtained after administration of purified Blg41-60::Nuc emulsified in complete Freund's adjuvant (CFA) or after coadministration with nonrecombinant killed L. lactis, mimicking the live recombinant secreting strain. The effect of oral administration of the live L. lactis strain secreting Blg41-60::Nuc was then tested, and the induction of a transitory mucosal IgA-specific immune response was observed.
|
|
|---|
General DNA techniques, PCR, and transformations.
Plasmid DNA was isolated essentially as previously described (6); for L. lactis, cells were incubated in TES buffer (50 mM Tris-HCl, 1 mM EDTA, 25% sucrose, pH 8) containing 10 mg of lysozyme per ml at 37°C for 10 min before alkaline lysis. Restriction enzymes and T4 DNA ligase were obtained from Gibco BRL or New England Biolabs and used according to the instructions of the suppliers. PCR was performed with a Perkin-Elmer (Norwalk, Conn.) Cetus thermocycler. Electroporation of L. lactis was performed as described previously (25), and transformants were plated on GM17 agar plates containing the required antibiotic.
Construction of expression plasmids carrying the Blg41-60::nuc gene.
All plasmid constructions were performed in E. coli TG1 and then transferred into L. lactis NZ9000. To obtain the DNA fragment encoding the Blg41-60 epitope, two 79-base oligonucleotides (5'-ATGCATCAGTTTATGTTGAAGAACTTAAACCAACTCCTGAAGGAGATCTTGAAATTCTTCTTCAAAAAAATGCATGG and its complement) were annealed, blunted, inserted into SmaI-cut pBlueScript (pBS) II SK(+) vector, and cloned in E. coli TG1, resulting in pBS:Blg41-60. At both ends, an NsiI restriction site (underlined) was added. The BglII restriction site (italics), absent from pBS and from our expression vectors, allowed for screening and control of the insertion of the epitope among the candidates first selected by blue-white screening based on ß-galactosidase activity (39).
The Blg41-60 fragment was then produced by NsiI digestion to be inserted in an expression cassette composed of the nuc gene encoding the staphylococcal nuclease (Nuc) with its own signal peptide (SP) under the control of the nisin-inducible promoter carried by pSEC:Nuc1 plasmid (27). The presence of a unique NsiI restriction site in this expression cassette between SPNuc and nuc allows for the insertion of DNA encoding the epitope Blg41-60. The Blg41-60 fragment could be inserted in two possible orientations: the correct orientation results in translational fusion between Blg41-60 and nuc, whereas the opposite orientation results in a premature stop codon. By a Nuc activity plate test, clones expressing the hybrid active protein Blg41-60::Nuc were Nuc+, whereas clones with the opposite orientation were Nuc-. Among Nuc+ clones, the insertion of one (or more) Blg41-60 fragment between SPNuc and Nuc was confirmed by digestion by BglII. Selected constructs were then sequenced to determine the number of inserted Blg41-60 oligopeptides. The resulting plasmid (pSEC:Blg41-60::Nuc) carrying the Blg41-60::nuc gene was then introduced into L. lactis NZ9000, which contains the PnisA regulatory genes nisRK.
Preparation of cellular and supernatant protein fractions of L. lactis for Western blot analysis.
An overnight culture of each L. lactis strain was used to inoculate fresh medium at a dilution of 1:250. For induction of the promoter PnisA, strains were grown until an OD600 of 0.5 was reached, and then nisin was added at a final concentration of 1 ng/ml. For fractionation between cell (C) and supernatant (S) fractions, 2 ml of L. lactis culture was centrifuged for 5 min at 6,000 x g at 4°C. Protein extracts were then prepared as previously described (27).
Preparation of cytoplasmic and secreted protein extracts for immunoassays.
The induced cells were pelleted by centrifugation at 5,000 x g for 15 min at 4°C, and the culture supernatant (S) was stored at -20°C until assay. The soluble cytoplasmic (Cs) proteins were extracted by disruption of the bacteria with glass beads and resuspension in 1/10 the initial volume in 50 mM Tris-HCl, pH 7.4. These extracts were then centrifuged at 10,000 x g for 15 min at 4°C. The supernatant containing Cs proteins was stored at -20°C until assay. The pellet was resuspended in 1/10 the initial volume in 50 mM Tris-HCl (pH 7.4)-8 M urea-100 mM dithiothreitol for 1 h at room temperature (RT). After centrifugation at 10,000 x g for 15 min at RT, the supernatant containing resolubilized insoluble cytoplasmic (Ci) proteins was stored at -20°C until assay. Blg41-60::Nuc was assayed in the S, Cs, and Ci fractions by the competitive EIA described below. Before assays, the Ci fraction was dialyzed against 50 mM Tris-HCl, pH 7.4.
Immunodetection of purified Blg41-60::Nuc.
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis was performed with a Tricine buffer as previously described (40). Proteins were stained with Gelcode Blue stain reagent (Pierce, Rockford, Ill.). For immunoblot analysis, proteins were separated by SDS-PAGE (12% gel) and electroblotted (46) onto polyvinylidene difluoride membranes (Millipore, Bedford, Mass.). After blotting, treatment of the membranes depended on the antibodies used as follows.
(i) Specific anti-Blg41-60 MAbs.
Nonspecific protein binding sites were blocked with 1% bovine serum albumin in 50 mM Tris-HCl (pH 8)-150 mM NaCl-0.5% Tween 20. Membranes were then incubated overnight with a 1/1,000 dilution of Blg-21R MAb specific for Blg41-60 (8). After washing in 50 mM Tris-HCl (pH 8)-150 mM NaCl-0.5% Tween 20, the membranes were incubated for 1 h with alkaline phosphatase-conjugated anti-mouse antibody (1/5,000) (Jackson ImmunoResearch Laboratories, West Grove, Pa.). Color development was obtained according to the supplier's instructions.
(ii) Polyclonal anti-Nuc antibodies.
After blotting, nonspecific protein binding sites were blocked with 1% bovine serum albumin in 50 mM Tris-HCl (pH 8.0)-150 mM NaCl-0.5% Tween 20. Membranes were incubated for 2 h with a 1/2,000 dilution of anti-Nuc antibodies (Eurogentec). After washing, membranes were incubated for 45 min with protein G-horseradish peroxidase conjugate (Bio-Rad) and signals were detected by use of an enhanced chemiluminescence kit (ECL; Dupont-NEN). After ECL detection, different nonsaturated film exposures were scanned by a Scanjet II (Hewlett Packard). For quantification, signals were compared to those of known amounts of purified Nuc.
Purification of Blg41-60::Nuc.
Blg41-60::Nuc was purified from the supernatant culture on an immunoaffinity column. The column was prepared by immobilizing the Blg-31R MAb (1 mg/ml of gel) on CNBr-activated Sepharose 4B, as described by the supplier (Pharmacia, Uppsala, Sweden). Expression of recombinant peptide was induced for 4 h as described above. Cells were pelleted by centrifugation. The culture supernatant (250 ml) was then added on 5 ml of gel and flowed through the column by gravity. The column was then washed with 50 ml of 50 mM Tris-HCl (pH 8)-150 mM NaCl-0.05% Tween 20. Blg41-60::Nuc was eluted in 5x column volume (elution buffer, 100 mM glycine-HCl, pH 2.5). Blg41-60::Nuc was usually eluted in the first two volumes. The elution was immediately neutralized by 1 M phosphate buffer, pH 7.4 (1/10 the elution volume). The column was regenerated by extensive washing with 50 mM Tris-HCl, pH 8. The solution containing Blg41-60::Nuc was dialyzed against 50 mM Tris-HCl, pH 8. The Blg41-60::Nuc concentration was measured by the BCA protein assay (Pierce) or the competitive EIA described below.
Preparation and purification of a synthetic peptide Blg41-60 and tracer Blg41-60 coupled to AChE.
Synthetic peptide Blg41-60 was synthesized by use of a Milligen 9050 apparatus (Millipore) and standard solid-phase synthesis by the 9-fluorenylmethoxycarbonyl continuous flow method. Synthetic peptide was purified by reversed-phase high-performance liquid chromatography with a Waters system (Milford) and a C18 Vydac column (250 by 10 mm; SFCC, Eragny, France). Tracer Blg41-60 coupled to acetylcholinesterase (Blg41-60-AChE) was obtained by reaction of thiol groups previously introduced in the synthetic peptide with maleimido groups incorporated into AChE as previously described (28).
Competitive EIA for Blg41-60.
Competitive EIAs were performed in 96-well microtiter plates coated with AffiniPure goat anti-mouse IgG plus IgM (heavy plus light chains) (Jackson ImmunoResearch). Blg-21R MAb (capture antibody) (50 µl), 50 µl of a dilution of standard (synthetic Blg41-60) or of samples (containing Blg41-60::Nuc), and 50 µl of tracer Blg41-60-AChE were added to wells. After an 18-h reaction at 4°C, the plates were washed and solid-phase-bound AChE was measured by Ellman et al.'s method (10).
Competitive ELISA.
Competitive enzyme-linked immunosorbent assays (ELISA) were performed in 96-well microtiter plates coated with purified Blg41-60::Nuc (5 µg/ml). Blg-21R MAb (50 µl) and 50 µl of a dilution of Blg41-60 or of purified Blg41-60::Nuc were added. After an 18-h reaction at 4°C, the plates were washed, and 100 µl of goat anti-Ig mouse antibody labeled with AChE was added for 4 h at RT. Plates were then washed, and solid-phase-bound AChE was measured by Ellman et al.'s method.
Immunizations. (i) Subcutaneous administrations.
Recombinant strain NZ9000(pSEC:Blg41-60::Nuc) and control strain NZ9000(pVE3655) (27) were grown as described above and induced for 4 h with nisin. Cells were washed and resuspended in sterile phosphate-buffered saline, divided into aliquots, and frozen at -80°C until subcutaneous administration. Yields of cellular Blg41-60::Nuc were determined by competitive EIA of 1 aliquot as described above. We considered only cellular Blg41-60::Nuc because administered bacteria were killed by freezing. Doses of 20 µg of purified Blg41-60::Nuc emulsified in CFA, the quantity of cells of NZ9000(pSEC:Blg41-60::Nuc) corresponding to 20 µg of Blg41-60, and the same quantity of cells of NZ9000(pVE3655) with or without 20 µg of purified Blg41-60::Nuc were administered subcutaneously in 200 µl of suspension to groups of five BALB/c female mice on days 1 and 21. Serum samples were taken on days 0, 18, and 32.
(ii) Oral administrations.
Control strain NZ9000(pVE3655) and two recombinant strains, NZ9000(pSEC:Blg) (7) and NZ9000(pSEC:Blg41-60::Nuc), were grown as described above and induced for 4 h with nisin to
109 bacteria/ml. Ten milliliters of each induced culture was pelleted, concentrated 30-fold in sterile phosphate-buffered saline, and immediately administered to mice. Groups of seven mice were intragastrically immunized for five consecutive days (day 1 to day 5) with induced recombinant and control strains. Serum samples and fecal pellets were collected on days 0, 21, 28, and 35 as previously described (7).
ELISA for detection of Blg41-60-specific antibody.
Ninety-six-well microtiter plates (Maxisorp; Nunc, Roskilde, Denmark) coated with 5 µg of synthetic Blg41-60 per ml were incubated overnight with serial dilutions of sera from immunized mice or with standards when available. Purified and quantified MAbs specific for Blg41-60 were used as standards as follows: a mixture of two IgG1 MAbs (Blg-8R and Blg-83R) or one IgG2a MAb (Blg-92R) was diluted from 2 to 0.001 µg/ml. After washing, IgE, IgG1, or IgG2a binding to Blg41-60 was revealed by incubation with an anti-IgE (Serotec, Oxford, England), anti-mouse IgG1, or anti-mouse IgG2a (Southern Biotechnology Associated, Birmingham, Ala.) antibody labeled with AchE (1). AChE activity was detected by Ellman et al.'s method. Specific IgA activity was assayed as previously described on Blg-coated plates (7) and on Blg41-60-coated plates.
|
|
|---|
![]() View larger version (23K): [in a new window] |
FIG. 1. Secretion of Blg41-60::Nuc fusion protein in L. lactis. (A) Expression cassettes for production and export of Nuc and fusion protein Blg41-60::Nuc. Schematic structures of Nuc and the fusion protein carried by the indicated plasmids are shown. For details of plasmid construction, see Materials and Methods. PnisA, nisin-inducible promoter; RBS, ribosomal binding site of usp45 gene; SPNuc, SP of staphylococcal Nuc; Nuc, DNA fragment encoding the mature protein. (B) Western blot analysis of L. lactis strains NZ9000(pSEC:Nuc1) and NZ9000(pSEC:Blg41-60:Nuc) using anti-Nuc antibodies. Blg41-60::Nuc production was estimated by Western blot analysis on exponential-phase-induced cultures of lactococcal strains containing pSEC:Nuc1 or pSEC:Blg41-60:Nuc. Protein extracts were prepared 1 h after nisin induction and separated into cellular (C) and supernatant (S) fractions. At an OD600 of 0.5, cultures were induced with 1 ng of nisin per ml of culture. C and S extracts of the induced cultures of NZ9000(pSEC:Nuc1) and NZ9000(pSEC:Blg41-60:Nuc) were hybridized with anti-Nuc antibodies. preNuc, precursor of Nuc; NucB and NucA, mature forms of Nuc; pre41-60:Nuc, precursor of the fusion protein Blg41-60::Nuc; 41-60:Nuc, mature form of Blg41-60::Nuc.
|
Purification and antigenic characterization of Blg41-60::Nuc.
To compare the antibody reactivity of Blg41-60::Nuc with that of synthetic Blg41-60, Blg41-60::Nuc was purified from the culture supernatant of the induced NZ9000(pSEC:Blg41-60::Nuc) recombinant strain by use of an immunoaffinity column, with Blg-31R MAb coupled to Sepharose gel. After Coomassie blue staining of the SDS-PAGE gel, the elution appeared to contain a single band, with a MW corresponding to that of Blg41-60::Nuc fusion protein (Fig. 2, lane 1). In a Western blot using Blg-31R MAb, elution also appeared as a unique band with the same MW after Coomassie blue staining (Fig. 2, lane 2). Under nonreducing conditions, the elution also showed a unique band, indicating that Blg41-60::Nuc is purified as a monomer, and no degradation bands were observed (data not shown).
![]() View larger version (42K): [in a new window] |
FIG. 2. Purification of Blg41-60::Nuc fusion protein. Blg41-60::Nuc was purified from the supernatant of an induced culture of NZ9000(pSEC:Blg41-60:Nuc) by use of an immunoaffinity column. Lane 1, purified Blg41-60::Nuc stained by Coomassie blue; lane 2, purified Blg41-60:Nuc detected by immunoblotting with anti-41-60 Blg-21R MAb.
|
![]() View larger version (12K): [in a new window] |
FIG. 3. Determination of Blg41-60::Nuc antibody reactivity. (A) Competitive EIA. Anti-41-60 Blg-21R MAb, synthetic Blg41-60 labeled with AChE, and increasing concentrations of synthetic Blg41-60 ( ) or recombinant Blg41-60::Nuc ( ) were added to a microtiter plate that was previously coated with anti-mouse antibody. (B) Competitive ELISA. Blg-21R MAb labeled with AChE and increasing concentrations of Blg41-60 or Blg41-60::Nuc were added to microtiter plates that were previously coated with Blg41-60::Nuc. For both experiments, concentrations of both competitors are expressed as picomoles of Blg41-60 per milliliter. Data are means of duplicate determinations. Absorbance was measured at 414 nm.
|
Expression kinetics of Blg41-60::Nuc.
Production of Blg41-60::Nuc was assayed at different times after induction by competitive EIA specific for Blg41-60, as allowed by the previous results. Blg41-60::Nuc was assayed in supernatant (S), soluble cytoplasmic protein (Cs), and insoluble cytoplasmic protein (Ci) fractions. Four hours after induction, the total amount of Blg41-60::Nuc produced reached its maximum, 32.5 ± 0.12 mg/liter, and remained stable until 18 h after induction (Fig. 4). Similar results were obtained by densitometry analysis of Western blot experiments (data not shown). Four hours after induction, 70 to 75% of the total production of Blg41-60::Nuc was secreted, corresponding to 25 mg/liter. The remainder was found preferentially in the Cs fraction.
![]() View larger version (13K): [in a new window] |
FIG. 4. Kinetics of Blg41-60::Nuc expression. L. lactis strain NZ9000(pSEC:Blg41-60:Nuc) was grown to an OD600 of 0.5, and then Blg41-60::Nuc expression was induced with nisin. Blg41-60::Nuc was assayed by competitive EIA at different times postinduction (1, 2, 3, 4, and 18 h) in supernatant ( ), cytoplasmic soluble proteins ( ), and cytoplasmic insoluble proteins ( ). Results are expressed as concentrations of Blg41-60::Nuc. Values given represent the means ± standard deviations for three independent experiments.
|
![]() View larger version (19K): [in a new window] |
FIG. 5. Immunogenicity of Blg41-60::Nuc fusion protein. Control strain NZ9000(pVE3655) (L-), control strain plus 20 µg of purified Blg41-60::Nuc [L- + (Blg41-60::Nuc)], 20 µg of purified Blg41-60::Nuc emulsified in CFA [CFA + (Blg41-60::Nuc)], or recombinant strain NZ9000(pSEC:Blg41-60::Nuc) (L+) was administrated subcutaneously to mice on days 1 and 21. Serum samples were taken on day 32. Specific IgG1 (A) and IgG2a (B) levels were quantified as described in Materials and Methods. Values for each mouse were determined in duplicate (; five mice per group), and group means are shown. Statistical analyses were performed by one-way analysis of variance and Tukey's multiple comparison test. P values on the graph are precise.
|
![]() View larger version (20K): [in a new window] |
FIG. 6. Specific IgA response elicited after oral administration of live recombinant L. lactis strain to mice. Groups of seven mice were intragastrically administered live recombinant strain NZ9000(pSEC:Blg41-60:Nuc) (hatched bars) or NZ9000(pSEC:Blg) (black bars) (7) or nonrecombinant control strain NZ9000(pVE3655) (gray bars) for five consecutive days. Results for naïve mice are also shown (white bars). Three weeks after J1, anti-Blg41-60 and anti-Blg IgA levels were assayed in fecal pellets as described in Materials and Methods.
|
|
|
|---|
SE (up to 75%) and quantities (
30 mg/liter) of Blg41-60::Nuc are higher than those previously observed for Nuc (
60% and
15 mg/ml) (24, 27). These differences could be due to the total net charge of -1 in the first 10 amino acids (VYVEELKPTP) of the 41-60 sequence, with two negative charges at positions 4 and 5 (underlined; positive charge is in italics). The presence of negative charges just after the cleavage site of the SP is known to be favorable for efficient protein secretion (50). The same results were previously demonstrated by using LEISSTCDA synthetic propeptide, which enhances both SE and the quantity of Nuc (24, 35).
Reactivities with anti-Blg41-60 MAbs of synthetic Blg41-60 peptide and recombinant fusion protein Blg41-60::Nuc are similar in competitive EIA and identical in competitive ELISA. In EIA, the signal followed is the binding of the tracer Blg41-60-AChE. In solution, synthetic or recombinant peptide does not compete with tracer in the same way. Blg41-60 binds with more affinity to MAbs than Blg41-60::Nuc, in which Blg41-60 could be less accessible for MAbs. This difference in reactivity between the two peptides in EIA could result in an underestimation of Blg41-60::Nuc. These problems disappear when the plate is directly coated with the recombinant peptide. It is known that direct coating of wells elicits a total or partial denaturation of the protein (1, 42, 51). Therefore, denaturation of Blg41-60::Nuc can enhance the accessibility to the Blg41-60 epitope.
L. lactis has been previously described as an antigen delivery system (52; see reference 29 for a review). Preliminary experiments on mice of subcutaneous administration of the killed Blg41-60::Nuc-producing L. lactis strain were performed, and anti-Blg41-60 IgG1, IgG2a, and IgE levels were monitored. After administration of this L. lactis strain, we could not detect a significant specific immune response compared to control mice. In contrast, a Th1-type specific response was induced after two injections of the purified Blg41-60::Nuc protein coadministered with killed control strain or with CFA. The IgG1/IgG2a ratio, weaker with lactococci than with CFA, suggests a Th1-type response (12), confirmed by the lack of IgE. This result shows that (i) subcutaneously administered lactococci are a potent adjuvant, preferentially inducing a nonallergic response, and (ii) Nuc is a good carrier for the Blg41-60 peptide, inducing a specific immune response against this major IgE epitope. In our experiments, lysis of subcutaneously administered killed lactococci is probably insufficient to allow induction of a specific immune response, while subcutaneous administration of a recombinant strain expressing tetanus toxin fragment C (TTFC) has been shown to elicit a specific IgG response (33). This could be due to a stronger immunogenicity of TTFC. Our hypothesis could explain the discrepancy observed between the present results and our previous experiments in which oral administration of the recombinant strain producing whole Blg led to the lysis of lactococci in the gastrointestinal tract and consequently to the release of Blg, allowing the induction of a specific mucosal IgA response (7). Indeed, for the present study, mice intragastrically administered the live recombinant strain developed a specific IgA response detected in fecal pellets, demonstrating a mucosal immune response. Nasal and oral immunization with a strain expressing TTFC elicits specific IgA in mucosa and specific IgG1 and IgG2a in serum (34, 36). This difference also is probably due to a higher immunogenicity of TTFC.
Peptides of Der p 1 (a house dust mite allergen) were produced as fusion proteins in E. coli, and they induced oral tolerance once administered to mice by feeding (20). A recombinant fusion protein containing multiple linked T-cell epitopes from chain 1 of Fel d 1 (a major cat allergen) can also induce peripheral T-cell tolerance in mice when delivered subcutaneously (37). Our food-grade recombinant strain could also be tested for immunotherapy by using the high IgE-responder mouse model of allergy to bovine Blg that has already been developed (1).
We are grateful to the members of URLGA and UIAA groups for helpful discussions during the course of this work.
Sébastien Nouaille was the recipient of a MENRT grant from the French government.
Present address: Laboratoire de Microbiologie, INRA ENSAR UMR1055, 35042 Rennes, France. |
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»