AEM
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Scholle, M. D.
Right arrow Articles by Vary, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Scholle, M. D.
Right arrow Articles by Vary, P. S.
Agricola
Right arrow Articles by Scholle, M. D.
Right arrow Articles by Vary, P. S.
Applied and Environmental Microbiology, November 2003, p. 6888-6898, Vol. 69, No. 11
0099-2240/03/$08.00+0     DOI: 10.1128/AEM.69.11.6888-6898.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Sequencing and Characterization of pBM400 from Bacillus megaterium QM B1551

Michael D. Scholle,{dagger} Christen A. White, Muthusamy Kunnimalaiyaan,{ddagger} and Patricia S. Vary*

Present address: Argonne National Laboratory, Bioscience Division, Argonne, IL 60439.,{dagger} Present address: Department of Surgery, K4/638 Comprehensive Cancer Center, University of Wisconsin—Madison, Madison, WI 53792.,{ddagger} Department of Biological Sciences, Northern Illinois University, DeKalb, Illinois 60115,{ddagger}

Received 26 June 2003/ Accepted 18 August 2003


   ABSTRACT
Top
 Abstract
Introduction
 Materials and METHODS
 Results
 Discussion
 References
 
Bacillus megaterium QM B1551 plasmid pBM400, one of seven indigenous plasmids, has been labeled with a selectable marker, isolated, completely sequenced, and partially characterized. A sequence of 53,903 bp was generated, revealing a total of 50 predicted open reading frames (ORFs); 33 were carried on one strand and 17 were carried on the other. These ORFs comprised 57% of the pBM400 sequence. Besides the replicon region and a complete rRNA operon that have previously been described, several interesting genes were found, including genes for predicted proteins for cell division (FtsZ and FtsK), DNA-RNA interaction (FtsK, Int/Rec, and reverse transcriptase), germination (CwlJ), styrene degradation (StyA), and heavy metal resistance (Cu-Cd export and ATPase). Three of the ORF products had high similarities to proteins from the Bacillus anthracis virulence plasmid pXO1. An insertion element with similarity to the IS256 family and several hypothetical proteins similar to those from the chromosomes of other Bacillus and Lactococcus species were present. This study provides a basis for isolation and sequencing of other high-molecular-weight plasmids from QM B1551 and for understanding the role of megaplasmids in gram-positive bacteria. The genes carried by pBM400 suggest a possible role of this plasmid in the survival of B. megaterium in hostile environments with heavy metals or styrene and also suggest that there has been an exchange of genes within the gram-positive bacteria, including pathogens.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and METHODS
 Results
 Discussion
 References
 
Bacillus megaterium is a spore-forming bacterium found in soil, seawater, sediments, rice paddies, dried food, honey, and milk (56). The economic importance of B. megaterium includes its production of vitamin B12 and penicillin amidase, its ability to express foreign proteins without degradation, and its use in AIDS diagnostics (56; C. Ginsburgh, D. Spaulding, G. Robey, M. A. Shivakumar, O. R. Vanags, L. Katz, and J. L. Fox, Abstr. Int. Conf. AIDS, abstr. 674, 1989). Recently, a strain of B. megaterium has been found that produces plasmid-borne oxetanocin, a potential antiviral agent (35). Plasmidless strains are used in industrial and research settings as hosts for efficient expression of foreign proteins. Most B. megaterium strains contain more than four plasmids (56), yet only a few of their plasmid genes are known. B. megaterium strain QM B1551 has an array of seven plasmids that have been shown to harbor germination, sporulation, megacin, and rRNA genes (23, 24, 51; D. M. Stevenson and P. S. Vary, Abstr. 11th Int. Spores Conf., abstr. 60, 1992).

Many plasmids in Bacillus and other gram-positive bacteria are cryptic in nature. While the small rolling circle replicating plasmids of gram-positive bacteria have been extensively studied (20, 22), only a few of the plasmid genes or replicons of the large theta plasmids have been characterized (for reviews, see references 10 and 16). Plasmids usually provide the host cell with a selective advantage, such as antibiotic resistance (17), resistance to toxic heavy metals (49), or degradation of unusual compounds (14, 44). In addition, some plasmids produce bacteriocins (for review, see reference 19). Bacteriocin (megacin) genes have been reported to be carried by a 47-kb plasmid of B. megaterium 216 (43), a 45-kb plasmid of ATCC 19213 (59), and a plasmid in strain QM B1551 (23). Gram-positive bacteria may also harbor plasmids that carry virulence genes, i.e., the insecticidal toxins of B. thuringiensis and B. sphaericus (46) and the anthrax toxins produced by B. anthracis from plasmids pXO1 and pXO2 (36, 42).

B. megaterium QM B1551 carries over 11% of its cellular DNA as stable plasmid DNA under laboratory conditions without known selection (23). The seven indigenous plasmids are 5.4, 9.1, 26.3, 54, 71, 108, and 165 kb (23) and are designated pBM100 to pBM700, respectively. A plasmidless derivative of QM B1551, strain PV361, has been isolated (58). The complexity of the array of plasmids in B. megaterium offers a unique opportunity to study plasmid interactions, replication, compatibility, plasmid-borne genes, and possible horizontal transfer. It also presents a challenge for the isolation and sequencing of plasmids with no known selectable markers and widely varying copy numbers within a multiplasmid array. When strain QM B1551 of B. megaterium is cured of its seven indigenous plasmids, there are few obvious phenotypic effects under laboratory conditions besides a defect in germination (52) and production of a megacin (23). QM B1551 is known to be very efficient at sporulation and germination (12). The plasmidless strain PV361 can grow normally on rich media, sporulate normally, and germinate on rich media but cannot germinate on single germination triggers because of a plasmid-borne germination gene (52). The plasmids are dispensable under laboratory conditions, yet they are fairly stable upon subculturing.

To begin to understand plasmid interactions and the role of plasmid genes in B. megaterium plasmid DNA, we cloned and sequenced fragments containing six of seven compatible replication origins. The two smallest plasmids have been completely sequenced and identified as rolling circle replicating plasmids with replicon similarities to the pTX14-3 plasmid of B. thuringiensis and the pXO1-89 plasmid gene of B. anthracis (G. Baisa, Y. Zhou, and P. Vary, unpublished data). The remaining four sequenced replicons on clones I, II, III, and IV are iteron-type theta replicons from the larger plasmids and are very similar in both Rep proteins and iterons (all five large plasmid replicons cross-hybridize) (24, 51, 57; M. Kunnimalaiyaan and P. Vary, unpublished data). The 12.3-kb replicating clone II fragment and its adjacent rRNA operon (6.3 kb), located just upstream from this replication clone, have been sequenced and characterized from pBM400 (54 kb) (24). To date, this is the only rRNA operon found in nonessential DNA, and its presence has considerable evolutionary significance. Since B. megaterium produces many unusual enzymes and is often found in contaminated environments along with degradative-plasmid-bearing pseudomonads (56), we are greatly interested to see if any similar metabolic genes are plasmid-borne. The complete sequencing of pBM400 and the larger cryptic plasmids of B. megaterium will enable comparative plasmid genomics and the study of plasmid horizontal transfer while expanding our understanding of plasmid genetics in gram-positive bacteria.

This paper presents the recombinational labeling, isolation, and sequencing of the remaining 35 kb of pBM400. It reports the initial description of several interesting plasmid-borne genes, including a possible integrase, an insertion sequence (IS) element, unusual metabolic genes, and several large inverted and direct repeats (DRs).


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and METHODS
Results
 Discussion
 References
 
Bacterial strains, plasmids, and growth conditions.
The strains used for this study are shown in Table 1. Escherichia coli was grown in Luria-Bertani (LB) broth with appropriate selection at 37°C (45). B. megaterium was grown at 30°C in supplemented nutrient broth (SNB) or MC minimal glucose broth with appropriate selection as previously described (11). Antibiotics (Sigma-Aldrich, St. Louis, Mo.) used were kanamycin (Bacillus, 5 µg/ml; E. coli, 20 µg/ml), ampicillin (E. coli, 100 µg/ml), and chloramphenicol (Bacillus, 5 µg/ml; E. coli, 34 µg/ml).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Strains and plasmids used in this study

 
Plasmid DNA isolation and library construction.
Plasmid DNA was routinely isolated by the alkaline lysis method and was visualized by agarose gel electrophoresis as previously described (51). The relative size of pBM400 was routinely compared to the known size of the largest E. coli V517 plasmid (~55 kb). Large quantities of plasmid DNA were isolated by the method of Lovett and Keggins (29) after growth to an optical density at 600 nm of 1.0 in MC broth. Purification of plasmid DNA by CsCl-ethidium bromide gradient centrifugation and library construction were performed according to the methods of Sambrook et al. (45). Three restriction enzyme libraries as follows were constructed from the pBM400 plasmid: (i) a partial Sau3A library in pGEM3-Z f(+) (Promega, Madison, Wis.) was used for shotgun cloning and sequencing in E. coli DH10B, and (ii) EcoRI and (iii) PstI fragment libraries in pJM103 (39) were used for closing sequence gaps. B. megaterium was transformed by protoplast fusion based on the method of Von Tersch and Carlton (59) and regenerated in regeneration medium (43, 59) as described by English and Vary (11).

PCR.
PCR was performed by using Promega Taq polymerase (Promega) or cDNA polymerase (Clontech, Palo Alto, Calif.) according to the manufacturer's specifications with a Perkin-Elmer (Foster City, Calif.) 480 thermocycler. Primers derived from the sequence of clone II that were specific for pBM400 and used for the detection of integration of the kanamycin gene insertion were as follows: 5'-CGGGAAGATGGCAAAT-3' and 5'-GCCTGGCAACGTCCTACTC-3'.

Southern hybridization.
Southern hybridization and probe labeling was done by use of the NEBlot phototope kit (New England Biolabs, Beverly, Mass.) according to the manufacturer's instructions. The resulting membrane was processed and exposed to X-ray film for 3 to 12 min.

DNA sequencing.
DNA sequencing was performed in the core DNA sequencing facilities at Northern Illinois University (DeKalb, Ill.) and Integrated Genomics (Chicago, Ill.) by use of the DYEnamic ET terminator cycle sequencing kit (Amersham Biosciences, Piscataway, N.J.) and a 373 DNA sequencer (Applied Biosystems, Foster City, Calif.) or AB3700 sequencer (Perkin-Elmer). Universal primers were utilized for end sequencing of Sau3A, EcoRI, and PstI library clones. Sequence gaps were closed by primer walking and PCR, with custom primers from MWG Biotech (High Point, N.C.). Sequences were assembled by use of Sequencher (Gene Codes, Ann Arbor, Mich.). Approximately 120 oligonucleotides were designed for PCR and primer walking of pBM400 to close gaps and increase the overall coverage to an average of x3.

Construction of the integrative vector and integration.
A list of all plasmids utilized in vector construction is summarized in Table 1. An integrative plasmid was constructed that carried a kanamycin gene flanked by DNA homologous to pBM400, as shown in Fig. 1. The plasmid pKM31 harbors a 2.1-kb XbaI-to-KpnI subclone from the distal 3' end of clone II that is specific for pBM400 (24). This plasmid was cleaved with EcoRI to remove one of two ClaI sites, ligated, and transformed into E. coli DH5{alpha} cells. The resultant plasmid, pKM58, was cleaved with ClaI, and a kanamycin cassette from pDG792 (15), also digested with ClaI, was inserted (pKM59). Plasmid pLTV1 (7) was cut with EcoRI, and the 4-kb fragment harboring the temperature-sensitive replication origin (pE194ts) was ligated into pKM59 at the EcoRI site. The resulting temperature-sensitive pBM400-specific integrative plasmid for B. megaterium was designated pSM1 (Fig. 1). QM B1551 containing pSM1 was grown at 46°C in SNB-kanamycin, with subculturing at 6 and 14 h. Cultures were serially diluted, plated on SNB plates, grown overnight at 37°C, and replica plated on SNB-chloramphenicol and SNB-kanamycin plates to test for integration of the labeled fragment by double crossover and loss of pSM1.



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 1. Construction of an integrative-replicative vector. The figure shows the parental clone containing an EcoRI-KpnI clone II fragment specific to pBM400 (A), removal of a 1-kb fragment containing a ClaI site (in bold) (B), incorporation of a 1.5-kb kanamycin gene from pDG792 into the remaining ClaI site (C), and insertion of the 4-kb fragment with the origin of replication from pE194ts to yield pSM1 (D).

 
Computer analysis.
Identification of open reading frames (ORFs) and homology searches utilized the BLAST series of programs (2) provided by the National Center for Biotechnology Information (http://www.ncbi.nih.gov) and GeneMark.hmm (http://opal.biology.gatech.edu/GeneMark/hmmchoice.html). DNA and amino acid sequences were then analyzed by using PCGENE (Intelligenetics, Inc.), as well as the following Internet sites: MultiAlin (http://prodes.toulouse.inra.fr/multalin/multalin.html) for multiple alignments, EINVERTED (http://bioweb.pasteur.fr/seqanal/interfaces/einverted.html) for inverted repeats (IRs), REPuter (http://bibiserv.techfak.uni-bielefeld.de/reputer/) for degenerative repeats, and Promoter Predication by Neural Network (http://www.fruitfly.org/seq_tools/promoter.html). GC analysis was done by use of Artemis software provided on the Internet by the Sanger Center (www.sanger.ac.uk/Software/ACT/). Access to several Internet sites was made through the site of A. Kropinski, Queen's University, Ontario, Canada (http://molbiol-tools.ca).

Nucleotide sequence accession number.
Sequence data for the entire 53,903 bp of pBM400 have been submitted to GenBank databases under the accession number AF142677. The previously reported 18.6 kb corresponds to 8,003 bp before the BglII start site (nucleotide 45,900) to nucleotide 10,630 in the completed plasmid sequence.


   RESULTS
Top
 Abstract
 Introduction
 Materials and METHODS
 Results
Discussion
 References
 
Construction of an integrative-replicative vector.
To effectively study pBM400 and obtain its sequence, it was necessary to isolate it from the plasmid array. This was done by constructing an integrative plasmid using the distal KpnI-XbaI fragment of the 12.3-kb clone II that was specific for pBM400, as shown in Fig. 1 and described in Materials and Methods. The introduction of a temperature-sensitive replication origin then allowed an efficient two-step process of integration, in which B. megaterium was first transformed with pSM1 and then grown at 46°C to select for homologous recombination and curing of the vector. The transformation of QM B1551 by pSM1 with selection for Kmr colonies yielded a frequency of 10 transformants/µg of DNA (the positive control, pHV33, yielded 150 transformants/µg of DNA). The resulting transformants were restreaked onto antibiotic plates to confirm the presence of pSM1 in QM B1551. Several transformants were then subcultured at 46°C in SNB-kanamycin, and a single colony that was Kmr and Cms, designated QM B1551/pBM400::kan, was isolated.

Isolation of a B. megaterium strain containing only pBM400::kan.
Plasmid DNA from QM B1551/pBM400::kan was separated by electrophoresis, and a band corresponding to a size of approximately 54 kb was purified from agarose gels. Plasmidless strain PV361 was transformed with pBM400::kan DNA and selected for Kmr. Plasmid DNA was purified by CsCl-ethidium bromide gradient centrifugation from one of the transformants, designated PV627, and the presence of only one plasmid and its correct size were verified by agarose gel electrophoresis and hybridization. Plasmid DNA was probed with both a pBM400-specific probe (KpnI-XbaI fragment from pKM31) and a kanamycin gene probe (pDG792 1.5-kb ClaI fragment), as shown in Fig. 2. As expected, the kanamycin gene probe hybridized to the bands corresponding to a 54-kb plasmid in PV627 and QM B1551/pSM1, but not to QM B1551 plasmid DNA or chromosomal DNA from plasmidless PV361. The pBM400 probe from clone II produced a signal, as expected, for plasmid bands corresponding to approximately 54 kb, but not for an E. coli V517 plasmid standard or B. megaterium chromosomal DNA. These results verified pBM400 as the source plasmid for clone II and showed that double-crossover integration of the kanamycin gene had occurred. It was interesting that in QM B1551/pSM1, a band approximately 10 kb above 54 kb suggested that it contained a single-crossover integration as well as pSM1, which was confirmed by a chloramphenicol gene probe (data not shown). However, it is clear from the hybridization reactions with PV627 and QM B1551/pBM400::kan that the double crossover did occur during subculturing at 46°C.



View larger version (36K):
[in this window]
[in a new window]
  		FIG. 2. Southern hybridization with pBM400 and kanamycin gene probes to detect the integrated kanamycin gene. (A) Southern hybridization with a kanamycin gene DNA probe. Lane 1, E. coli V517 supercoiled standard; lane 2, QM B1551; lane 3, 54-kb plasmid pBM400::kan (from PV627); lane 4, QM B1551 containing pSM1 and a possible single crossover of pSM1 into pBM400; lane 5, pBM400::kan in the QM B1551 plasmid array following growth at 46°C; lane 6, PV361 chromosomal DNA. (B) Agarose gel electrophoresis of the same gel. (C) Southern hybridization with the pBM400-specific probe.

 
Sequence and analysis.
Isolation of pBM400 allowed restriction enzyme mapping, subcloning, and complete sequencing as described in Materials and Methods. As shown in Table 2 and Fig. 3, pBM400 is a circular plasmid of 53,903 bp with a total of 50 possible ORFs, 34 of which encode >100 amino acids, based on GeneMark and BLAST findings. Of the 50 ORFs, 39 have a Fickett score of >77% (PC Gene analysis). The criteria used for including possible ORFs were two or more of the following: Fickett scores of >70%, good Shine-Dalgarno sites, presence of an upstream putative promoter, and similarity with proteins in the databases. There were 16 predicted proteins with similarity to proteins with known functions, 23 with similarity to proteins of unknown function, and 11 with no similarity to known proteins. The plasmid also contains an rRNA operon with 18 previously described adjacent tRNA genes (24). Of the 50 putative proteins, 33 are coded for by one strand and 17 by the other. The entire putative coding sequence may account for up to 57% of the total pBM400 sequence. This is consistent with other studies that show a general tendency for plasmids to have large intergenic regions (36, 61). Analysis of the base composition of pBM400 reveals an overall G+C content of 36.5%, similar to the reported B. megaterium G+C content of 37 to 39% (41).


View this table:
[in this window]
[in a new window]
  		TABLE 2. Plasmid pBM400-carried genes

 


View larger version (38K):
[in this window]
[in a new window]
  		FIG. 3. Circular map of pBM400. The positions of genes are shown relative to a BglII start point of pBM400. Putative sigma A promoters (bent arrows), IRs (blue arrows), DRs (gray arrows), and possible rho-independent terminators are shown. The rRNA operon is shown in blue; the replicon region is shown in red. Names for gene products with similarity to proteins with known functions in the databases are in bold, and the ORFs are green. ORFs for gene products with similarity to known proteins but with unknown functions are yellow. Those with no similarity in the databases are white. Large bent arrows are sites of five tandem putative promoters. The 39-bp IRs flanking the transposase (ORF18) are red and are labeled IS. The large 127-bp IRs flanking the Int/Rec ORF (14) and 79-bp repeats (1) near the replicon are also red. ORFs shown on the outside of the circle are read in the forward direction (clockwise) and those on the inside are read in the reverse direction. All of the restriction sites of EcoRI and PstI and relevant BglII, KpnI, ClaI, and XbaI restriction sites are shown.

 
Possible functions of plasmid genes.
Genes for replication, cell division, recombination, heavy metal resistance, and transposition were found on pBM400. The replicon region (RepM400, ORFB, and ORFC) and the surprising presence of an rRNA operon have been described and functionally characterized previously (24). RepM400 alone is sufficient for replication, but ORFB is required for stability. The function of ORFC has not been determined. Recent database searches confirmed that the three replicon proteins do not resemble any other gene products except those from the pBM500 replicon of the same plasmid array. RepM400 is also very similar to RepM300 and RepM700 (57; Kunnimalaiyaan and Vary, unpublished data). ORF6 seems to be a conserved gene product encoded by plasmids from many gram-positive bacteria and is present on at least five other QM B1551 plasmids. It is similar to possible DNA binding proteins encoded by other plasmids, including ORF2C by B. subtilis plasmids pTA1060 and pTA1040 (33), Ptr by p1414 (54), and ORF 68 by B. anthracis virulence plasmid pXO2 (36).

The predicted ORF22 protein was highly similar to a cadmium-copper ATPase of the oral bacterium Fusobacterium nucleatum that is a component of heavy metal transport across the bacterial membrane. The adjacent ORF (ORF20) product was also similar to a hypothetical protein in the same position in the same organism. The cadmium-copper ATPase encoded by pBM400 was also similar to the first cadmium ATPase found for gram-positive organisms, encoded by Staphylococcus plasmid pI258 (49). Cadmium resistance genes have been reported for other gram-positive bacterial plasmids, including pXU5 in Staphylococcus aureus (55), pND302 in Lactococcus lactis (26), and other soil bacilli (18). However, initial tests for copper and cadmium resistance in B. megaterium QM B1551 yielded ambiguous results (data not shown). Another cation-transporting ATPase gene (ORF19) is located just upstream on pBM400. Plasmid pBM400 also carries a possible zinc-binding dehydrogenase gene (ORF24) in the same region.

Interestingly, the predicted ORF25 protein showed significant similarity to a styrene monooxygenase from Pseudomonas that is involved in the biodegradation of styrenes. In Pseudomonas fluorescens ST, four genes, designated styA, styB, styC, and styD, are required for the oxidation of styrene to phenylacetic acid (5, 32). The protein encoded by pBM400 is similar to the styA gene product, which forms epoxystyrene from styrene (5). Chiral epoxides are valuable intermediates in several optically active drugs. Homologues to other genes for styrene degradation were not found on pBM400, but there seem to be several pathways for styrene utilization found in different organisms, including one that has only the monooxygenase with oxidation to ß-phenylethanol (50). Styrene utilization often requires a consortium of organisms. To our knowledge, there has been only one report of styrene utilization in Bacillus, by thermophilic isolates that were not further identified (50). The role of the monooxygenase is also of interest since three other P450 cytochrome oxygenases are present in strains of B. megaterium and have been intensely studied (40, 47).

Possible cell division proteins FtsZ and FtsK (SpoIIIE), encoded by ORFs 44 and 27, respectively, were not expected to be carried by a plasmid. FtsZ is a key division protein that has been shown to form the signature Z-ring at the septum during cell division in E. coli (1). In B. subtilis, FtsZ is required for both vegetative septation and asymmetric septation during sporulation (4). Although FtsZ is essential for normal cell division, excess FtsZ has the same effect as its absence, so that its presence on a multicopy plasmid is puzzling. The ORF44 product is similar to FtsZ from two Archaea, Pyrococcus horikoshii and Methanocaldococcus jannaschii, but not to B. subtilis or E. coli FtsZ. However, a motif for GTPase activity of FtsZ was found in pBM400 FtsZ (GGGSGGG) that was similar to the functional motif GGGTGTG reported for E. coli (9). A 1.1-kb PCR probe was therefore made to recognize plasmid FtsZ and was hybridized to DNA from B. megaterium, E. coli, and B. subtilis as shown in Fig. 4. This probe hybridized only to plasmid DNA from QM B1551 and not to B. subtilis, E. coli, or genomic B. megaterium DNA (PV361). Since the plasmidless strain PV361 divides normally, there must be an unrelated gene for FtsZ on the chromosome as well. To test this, a 1.1-kb PCR probe was also made for the B. subtilis FtsZ gene (25) with the following primers: forward, 5'-CATTCGGCAGATTAGGAGG-3', and reverse, 5'-GATTTTGTCCTTTACATTAGC-3'. There was evidence of hybridization to appropriate PstI fragments (11.4 and 5.8 kb) and an EcoRI fragment (10.8 kb) in the B. subtilis genomic lanes. There was also faint binding to PV361 and QM B1551 in the chromosomal DNA lanes at 4.8 kb, but not to plasmid DNA (data not shown).



View larger version (52K):
[in this window]
[in a new window]
  		FIG. 4. Hybridization of pBM400 FtsZ (ORF44) with genomic and plasmid DNA of E. coli, B. subtilis, and B. megaterium. A 1.1-kb PCR product from ORF44 (FtsZ) of pBM400 was used as a probe to test for similarity to genes on E. coli, B. subtilis, and B. megaterium chromosomes. The primers were forward, 5'-AGGTTGAGGTACCATGATAGGTA-3', and reverse, 5'-ATACTAAAAAGAATTCACGATTCTG-3'. Lanes 1, 11, and 19, biotinylated 1-kb standard; lanes 2, 3, and 4, E. coli DH5{alpha} total DNA cut with PstI, EcoRI, and ClaI, respectively; lanes 5, 6, and 7, B. subtilis total DNA cut with PstI, EcoRI, and ClaI, respectively; lanes 8, 9, and 10, PV627 plasmid DNA cut with PstI, EcoRI, and ClaI, respectively; lanes 12, 13, and 14, QM B1551 total DNA cut with PstI, EcoRI, and ClaI, respectively; lanes 15, 16, and 17, PV361 (plasmidless) total DNA cut with PstI, EcoRI, and ClaI, respectively; lane 18, pSM3 cut with EcoRI.

 
FtsK is associated with cell division and chromosomal translocation in E. coli. Like FtsZ, FtsK is essential for cell division and is localized at the Z-ring. Liu et al. (27) have shown that the N terminus of the E. coli FtsK protein is required for cell division, while the C terminus is involved in chromosomal segregation. FtsK is an ATP-dependent DNA translocase which also activates XerCD-dependent recombination at the dif site to resolve chromosomal dimers. No FtsK gene has been found in B. subtilis, but a smaller protein, SpoIIIE, is a DNA translocase involved in mother cell-prespore transport across the division septum (60). The pBM400 ORF27 product is small (265 amino acids) and most resembles an FtsK gene product from Thermoanaerobacter tengcongensis. Both the 787-amino-acid B. subtilis SpoIIIE and ORF27 have similarity only to the carboxy-terminal chromosomal segregation region of 1,329-amino-acid E. coli FtsK.

Other genes carried by pBM400 include those for ORF26, coding for a protein similar to a cell wall hydrolase, CwlJ, from B. subtilis that is one of two proteins necessary to hydrolyze the spore cortex during germination. A cell wall lytic enzyme has been purified and characterized from B. megaterium KM by Foster and Johnstone (13), but to our knowledge the gene has not been sequenced. CwlJ has recently been determined to localize to the spore coat of B. subtilis (3, 8). In addition to the germination and cell division genes, several ORFs showed similarity to B. subtilis genomic gene products of unknown function (YcnI, YcgR, and YpiB). Four small ORFs, ORF46 to -50, were also found within the rRNA operon. Small genes within the rRNA operon have been shown to be expressed in E. coli, but their functions are unknown (6).

Possible virulence plasmid gene exchanges.
Three ORF products had significant similarities to proteins from the B. anthracis virulence plasmid pXO1. ORF34 was 60% similar to B. anthracis pXO1-07, encoding a reverse transcriptase, while ORF40 was similar to pXO1-103, encoding an integrase-recombinase (see below). The ORF41 product was similar to pXO1-101, which has been reported to have considerable nucleotide homology with the virulence factor bceT from B. cereus (37). ORF41 has a motif similar to the HTH-XRE group of transcriptional regulators that include the lambda repressor.

Possible mobile elements.
A putative insertion sequence (IS) element was found in which 39-bp IRs (74% identical) flank ORF18. ORF18 codes for a protein that is highly similar to transposase ISEf1 of vancomycin-resistant Enterobacter faecalis V583 (38) and to transposases from IS1201 of Lactobacillus helveticus and IS905 of Lactococcus lactis. Both IS1201 and IS905 belong to the IS256 family of transposons (31), which have 24- to 41-bp IRs. IS1201 is a 1,387-bp IS that carries a single ORF coding for a putative transposase (53). While the pBM400 IS, designated ISBm400, has a similar transposase, its 39-bp IRs (5'AACTGAGAAAAATTAATACATTTAGTTTTTCCATTTCTT 3' and 5'AAGAGAATGAAAAACTAGTTGAATTAATTATTTTAAATT 3') (labeled IS in Fig. 3) have no significant homology to any known IS element. It is also large (2,653 bp) but contains no obvious ORF other than that for the transposase.

ORF40 exhibited 48% similarity to the integrase-recombinase gene (pX01-103) of B. anthracis virulence plasmid pXO1. Plasmid pXO1 carries two putative integrase-recombinase ORFs similar to Methanobacterium thermoautotrophicum Int/Rec and B. subtilis RipX, the homolog of E. coli XerD required for chromosomal dimer resolution (36). ORF40 of pBM400 is more similar to the pXO1 RipX integrase-recombinase and is flanked by large IRs of 127 bp (Fig. 3) with 79% identity (see below). The possible pBM400 integron also contained two other predicted ORFs (38 and 39) with unknown functions. Its intervening sequence was about 1.5kb. On pXO1, the integrase-recombinase gene is flanked by IRs and is part of a region with several IS elements, integrases, and transposases within the 44.8-kb pathogenicity island. The presence on pBM400 of integrase-recombinase and transposase genes flanked by IRs strongly suggests the possibility of DNA mobility.

GC Analysis.
To test the possibility of horizontal transfer, the entire pBM400 sequence was analyzed by use of Artemis software (see Materials and Methods). Horizontal transfer can sometimes be identified by one or more anomalies in GC content, GC deviation, and dinucleotide usage (21). As can be seen in Fig. 5, the rRNA operon showed typical high GC content (52%). Most of the rest of the plasmid was near 36.5% GC, except for a few regions that were very AT-rich, including the possible integron, the copper export gene, and the styrene monooxygenase. The copper and integrase regions also showed Karlin signature differences. There was a smaller GC-rich region near or within the IS region, which also exhibits a Karlin signature peak. (The transposase gene is 40.4% GC.) The FtsK gene is 44% GC, but it is in a region with no obvious anomalies. Interestingly, the conserved plasmid ORF2C gene has the highest Karlin signature difference peak and a small region of GC deviation.



View larger version (55K):
[in this window]
[in a new window]
  		FIG. 5. Whole plasmid GC analysis of pBM400. The entire plasmid was analyzed for possible alien genes or regions (pAs) by use of Artemis software for three different parameters: GC content, GC deviation, and Karlin signature difference. The line in the GC content graph is at 36.5%. Possible regions of sequence anomalies in one or more graphs are labeled. rrn, rRNA operon; Cu, copper export gene region; Sty, styrene monooxygenase region; Int, integron; 2C, ORF2C (ORF6); IS, ISBm400.

 
DNA sequence structure.
Several other IRs and DRs were evident. Overall, there were 25 DRs, ranging from 18 to 39 bp, which had <3 kb of intervening DNA. IRs and DRs of >14 bp are shown in Fig. 3. In addition, a large IR (79 and 80 bp; no. 1) flanking 640 bp has previously been described upstream from the replication gene in a region of almost 2,500 bp with no obvious ORFs (24). Large rho-independent terminators were found downstream of ORF6, ORF23, ORF28, ORF29, ORF42, and ORF44. There were also four IRs that did not resemble rho-independent terminators. An area consisting of >13 DRs, some overlapping, was present within the 18 tRNA genes and probably reflects their secondary structure. A region in and around ORF29 also contained four DRs in close proximity to each other.

Potential sigma A promoters were found based on sequence similarity to the sigma A consensus of B. subtilis: -10, TATAAT, and -35, TTGACA (34). There were five possible promoter sequences found in close proximity to each other upstream of the small ORF21, the product of which has no similarity to those in the databases. Five adjacent putative promoters were also found upstream of ORF41, coding for the putative integrase-recombinase. Overall, there were 76 sequences that showed significant similarity to the Bacillus sigma A consensus sequence. However, actual promoter predictions from sequences have not proved reliable.


   DISCUSSION
Top
 Abstract
 Introduction
 Materials and METHODS
 Results
 Discussion
References
 
To sequence large low-copy-number cryptic plasmids within a varied plasmid array is a challenge. Since attempts to label the pBM400 plasmid by transposition were not successful, pBM400::kan was constructed by recombination and transformed into the plasmidless strain PV361. This method of inserting an antibiotic resistance gene into a high-molecular-weight plasmid of QM B1551 to allow isolation and complete sequencing was successful. Several genes were carried by pBM400 that were unexpected. In addition to the rRNA operon, a gene for a possible styrene monooxygenase and ORFs with products similar to proteins involved in cell division (FtsZ and FtsK) were found. The dynamic state of the plasmid was suggested by the presence of a possible integrase-recombinase, a reverse transcriptase, an ISBm400 with a transposase of the IS256 family, and two very large IRs, one with 79- to 80-bp repeats flanking a 2.5-kb region near the replicon and another with 127 bp flanking the Int/Rec ORF. Horizontal transfer was suggested by the presence of putative alien genes or regions including ISBm400 and the integron as well as the predicted styrene monooxygenase and copper export ORFs. ORFs were found for possible degradative or heavy metal resistance, DNA translocation, dimer resolution, and germination proteins, and several encoded products similar to hypothetical proteins of unknown function on the genomes of B. subtilis, B. halodurans, and L. lactis (and presumably, to some also present on the unsequenced B. megaterium genome). However, no obvious mob genes or genes involved in plasmid transfer were observed. The types of genes found on pBM400 suggest a possible role for this plasmid in the survival of B. megaterium in hostile environments where heavy metals or styrene are present and possible advantages by increased gene dosage of cell division, germination, and rRNA genes for growth and sporulation. They also suggest that considerable exchange of genes has occurred within the gram-positive bacteria, and perhaps Archaea, and include ORFs with products similar to those encoded by the pathogenicity island of pXO1. The lack of clear phenotypes in the plasmidless strain is partly explained by the data. Many of the genes discovered on this plasmid could not easily be distinguished by phenotype, would be expressed under unusual conditions, or had genomic counterparts, thus making their presence or absence difficult to detect. Sequencing of the larger plasmids of QM B1551 greatly adds to our understanding of this plasmid gene pool in the bacilli. This study also provides a basis for isolation and sequencing of other high-molecular-weight plasmids in the QM B1551 family of plasmids by recombinational labeling, so that we may better understand the role of megaplasmids of B. megaterium and of other gram-positive bacteria.


   ACKNOWLEDGMENTS
 
We thank Scott Grayburn in the NIU Core Facility and Integrated Genomics (Chicago, Ill.) for automated sequencing and advice. We also thank Barbara Ball for graphics support.

This research was supported in part by NIH grant IR 155GM59599-01/G12401R.


   FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biological Sciences, Northern Illinois University, DeKalb, IL 60115. Phone: (815) 753-7421. Fax: (815) 753-0461. E-mail: pvary{at}niu.edu. Back


   REFERENCES
Top
 Abstract
 Introduction
 Materials and METHODS
 Results
 Discussion
 References
 

  1. Addinall, S. G., E. Bi, and J. Lutkenhaus. 1996. FtsZ ring formation in fts mutants. J. Bacteriol. 178:3877-3884.[Abstract/Free Full Text]
  2. Altschul, S. F., W. Gish, W. Miller, E. W. Meyers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410.[CrossRef][Medline]
  3. Bagyan, I., and P. Setlow. 2002. Localization of the cortex lytic enzyme CwlJ in spores of Bacillus subtilis. J. Bacteriol. 184:1219-1224.[Abstract/Free Full Text]
  4. Beall, B., and J. Lutkenhaus. 1991. FtsZ in Bacillus subtilis is required for vegetative septation and for asymmetric septation during sporulation. Genes Dev. 5:447-455.[Abstract/Free Full Text]
  5. Beltrametti, F., A. M. Marconi, G. Bestetti, C. Colombo, E. Galli, M. Ruzzi, and E. Zennaro. 1997. Sequencing and functional analysis of styrene catabolism genes from Pseudomonas fluorescens ST. Appl. Environ. Microbiol. 63:2232-2239.[Abstract]
  6. Berg, K. L., C. L. Squires, and C. Squires.1987 . In vivo translation of a region within the rrnB 16S rRNA gene of Escherichia coli. J. Bacteriol. 169:1691-1701.[Abstract/Free Full Text]
  7. Camilli, A., D. Portnoy, and P. Youngman. 1990. Insertional mutagenesis of Listeria monocytogenes with a novel Tn917 derivative that allows direct cloning of DNA flanking transposon insertions. J. Bacteriol. 172:3738-3744.[Abstract/Free Full Text]
  8. Chirakkal, H., M. O'Rourke, A. Atrih, S. J. Foster, and A. Moir. 2002. Analysis of spore cortex lytic enzymes and related proteins in Bacillus subtilis endospore germination.Microbiology 148:2383-2392.[Abstract/Free Full Text]
  9. de Boer, P., R. Crossley, and L. Rothfield. 1992. The essential bacterial cell-division protein FtsZ is a GTPase.Nature 359:254-256.[CrossRef][Medline]
  10. del Solar, G., R. Giraldo, M. J. Ruiz-Echevarria, M. Espinosa, and R. Diaz-Orejas. 1998. Replication and control of circular bacterial plasmids. Microbiol. Mol. Biol. Rev. 62:434-464.[Abstract/Free Full Text]
  11. English, J. D., and P. S. Vary. 1986. Isolation of recombination-defective and UV-sensitive mutants of Bacillus megaterium. J. Bacteriol. 163:155-160.
  12. Foerster, H. F., and J. W. Foster. 1966. Response of Bacillus spores to combinations of germinative compounds. J. Bacteriol. 91:1168-1177.[Abstract/Free Full Text]
  13. Foster, S. J., and A. K. Johnstone. 1987. Purification and properties of a germination-specific cortex-lytic enzyme from spores of Bacillus megaterium KM. Biochem. J. 242:573-579.[Medline]
  14. Frantz, B., and A. M. Chakrabarty. 1987. Organization and nucleotide sequence determination of a gene cluster involved in 3-chlorocatechol degradation. Proc. Natl. Acad. Sci. USA 84:4460-4464.[Abstract/Free Full Text]
  15. Guerout-Fleury, A. M., K. Shazand, N. Frandsen, and P. Stragier.1995 . Antibiotic-resistance cassettes for Bacillus subtilis. Gene 167:335-336.[CrossRef][Medline]
  16. Helinski, D. R., A. E. Toukdarian, and R. P. Novick. 1995. Replication control and other stable maintenance mechanisms of plasmids, p.2295 -2324. In F. C. Neidhardt (ed.), Bacillus subtilis and other gram positives. American Society for Microbiology, Washington, D.C.
  17. Iordanescu, S. 1976. Three distinct plasmids originating in the same Staphylococcus aureus strain. Arch. Roum. Pathol. Exp. Microbiol. 35:111-118.
  18. Ivey, D. M., A. A. Guffanti, Z. Shen, N. Kudyan, and T. A. Krulwich. 1992. The cadC gene product of alkaliphilic Bacillus firmus OF4 partially restores Na+ resistance to an Escherichia coli strain lacking an Na+/H+ antiporter (NhaA). J. Bacteriol. 174:4878-4884.[Abstract/Free Full Text]
  19. Jack, R. W., J. R. Tagg, and B. Ray.1995 . Bacteriocins of gram-positive bacteria.Microbiol. Rev. 59:171-200.[Abstract/Free Full Text]
  20. Janniere, L., A. Gruss, and S. Ehrlich. 1993. Plasmids, p.625 -645. In A. Sonenshein, J. Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive bacteria. American Society for Microbiology, Washington, D.C.
  21. Karlin, S. 2001. Detecting anomalous gene clusters and pathogenicity islands in diverse bacterial genomes. Trends Microbiol. 9:335-343.[CrossRef][Medline]
  22. Khan, S. A. 2000. Plasmid rolling-circle replication: recent developments. Mol. Microbiol. 37:477-484.[CrossRef][Medline]
  23. Kieselburg, M. K., M. Weickert, and P. S. Vary.1984 . Analysis of resident and transformant plasmids in Bacillus megaterium. Biotechnology 2:254-259.[CrossRef]
  24. Kunnimalaiyaan, M., D. M. Stevenson, Y. Zhou, and P. S. Vary.2001 . Analysis of the replicon region and identification of an rRNA operon on pBM400 of Bacillus megaterium QM B1551.Mol. Microbiol. 39:1010-1021.[CrossRef][Medline]
  25. Kunst, F., N. Ogasawara, I. Moszer, A. M. Albertini, G. Alloni, V. Azevedo, M. G. Bertero, P. Bessieres, A. Bolotin, S. Borchert, R. Borriss, L. Boursier, A. Brans, M. Braun, S. C. Brignell, S. Bron, S. Brouillet, C. V. Bruschi, B. Caldwell, V. Capuano, N. M. Carter, S. K. Choi, J. J. Codani, I. F. Connerton, A. Danchin, et al.1997 . The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390:249-256.[CrossRef][Medline]
  26. Liu, C. Q., N. Khunajakr, L. G. Chia, Y. M. Deng, P. Charoenchai, and N. W. Dunn. 1997. Genetic analysis of regions involved in replication and cadmium resistance of the plasmid pND302 from Lactococcus lactis.Plasmid 38:79-90.[CrossRef][Medline]
  27. Liu, G., G. C. Draper, and W. D. Donachie.1998 . FtsK is a bifunctional protein involved in cell division and chromosome localization in Escherichia coli.Mol. Microbiol. 29:893-903.[CrossRef][Medline]
  28. Louis, J., and J. Szulmajster. 1985. Biocidal gene(s) of Bacillus sphaericus cloned and expressed in Escherichia coli, p. 241-245. In J. A. Hoch and P. Setlow (ed.), Molecular biology of microbial differentiation. American Society for Microbiology, Washington, D.C.
  29. Lovett, P. S., and C. M. Keggins. 1979. Bacillus subtilis as a host for molecular cloning.Methods Enzymol. 68:342-357.[Medline]
  30. Macrina, F. L., D. J. Kopecko, K. R. Jones, D. J. Ayers, and S. M. McCowen.1978 . A multiple plasmid-containing Escherichia coli strain: convenient source of size reference plasmid molecules. Plasmid 1:417-420.[CrossRef][Medline]
  31. Mahillon, J. 1998. Transposons as gene haulers.APMIS 106:29-36.
  32. Marconi, A. M., F. Beltrametti, G. Bestetti, F. Solinas, M. Ruzzi, E. Galli, and E. Zennaro. 1996. Cloning and characterization of styrene catabolism genes from Pseudomonas fluorescens ST. Appl. Environ. Microbiol. 62:121-127.[Abstract]
  33. Meijer, W. J., G. B. Wisman, P. Terpstra, P. B. Thorsted, C. M. Thomas, S. Holsappel, G. Venema, and S. Bron. 1998. Rolling-circle plasmids from Bacillus subtilis: complete nucleotide sequences and analyses of genes of pTA1015, pTA1040, pTA1050 and pTA1060, and comparisons with related plasmids from gram-positive bacteria. FEMS Microbiol. Rev. 21:337-368.[CrossRef][Medline]
  34. Moran, C. P., Jr. 1993. RNA polymerase and transcription factors, p. 653-667. In A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive bacteria. American Society for Microbiology, Washington, D.C.
  35. Morita, M., K. Tomita, M. Ishizawa, K. Takagi, J. Kawamura, H. Takahashi, and T. Morino. 1999. Cloning of oxetanocin A biosynthetic and resistance genes that reside on a plasmid of Bacillus megaterium strain NK84-0128. Biosci. Biotechnol. Biochem. 63:563-566.[CrossRef][Medline]
  36. Okinaka, R. T., K. Clound, O. Hampton, A. R. Hoffmaster, K. K. Hill, P. Keim, T. M. Koehler, G. Lamke, S. Kumano, J. Mahillon, D. Manter, Y. Martinez, D. Ricke, R. Svensson, and P. J. Jackson. 1999. Sequence and organization of pX01, the large Bacillus anthracis plasmid harboring the anthrax toxin genes. J. Bacteriol. 181:6509-6515.[Abstract/Free Full Text]
  37. Pannucci, J., R. T. Okinaka, R. Sabin, and C. R. Kuske.2002 . Bacillus anthracis pXO1 plasmid sequence conservation among closely related bacterial species. J. Bacteriol. 184:134-141.[Abstract/Free Full Text]
  38. Paulsen, I. T., L. Banerjei, G. S. Myers, K. E. Nelson, R. Seshadri, T. D. Read, D. E. Fouts, J. A. Eisen, S. R. Gill, J. F. Heidelberg, H. Tettelin, R. J. Dodson, L. Umayam, L. Brinkac, M. Beanan, S. Daugherty, R. T. DeBoy, S. Durkin, J. Kolonay, R. Madupu, W. Nelson, J. Vamathevan, B. Tran, J. Upton, T. Hansen, J. Shetty, H. Khouri, T. Utterback, D. Radune, K. A. Ketchum, B. A. Dougherty, and C. M. Fraser.2003 . Role of mobile DNA in the evolution of vancomycin-resistant Enterococcus faecalis.Science 299:2071-2074.[Abstract/Free Full Text]
  39. Perego, M., G. B. Spiegelman, and J. A. Hoch.1988 . Structure of the gene for the transition state regulator, abrB: regulator synthesis is controlled by the spo0A sporulation gene in Bacillus subtilis.Mol. Microbiol. 2:689-699.[Medline]
  40. Peterson, J. A., and S. S. Boddupalli. 1992. P450Bm-3 reduction of NADPH and sodium dithionite. Arch. Biochem. Biophys. 294:654-661.[CrossRef][Medline]
  41. Priest, F. G., M. Goodfellow, and C. Todd. 1981. The genus Bacillus: a numerical analysis, p.91 -103. In R. C. W. Berkeley and M. Goodfellow (ed.), The aerobic endospore-forming bacteria, vol. 4. Academic Press, London, United Kingdom.
  42. Read, T. D., S. L. Salzberg, M. Pop, M. Shumway, L. Umayam, L. Jiang, E. Holtzapple, J. D. Busch, K. L. Smith, J. M. Schupp, D. Solomon, P. Keim, and C. M. Fraser. 2002. Comparative genome sequencing for discovery of novel polymorphisms in Bacillus anthracis.Science 296:2028-2033.[Abstract/Free Full Text]
  43. Rostas, K., S. V. Dobritsa, A. P. Dobritsa, C. S. Konez, and L. Alfoldi. 1980. Megacinogenic plasmid from Bacillus megaterium 216. Mol. Gen. Genet. 180:323-329.[CrossRef][Medline]
  44. Rothmel, R. K., T. L. Aldrich, J. E. Houghton, W. M. Coco, L. N. Ornston, and A. M. Chakrabarty. 1990. Nucleotide sequencing and characterization of Pseudomonas putida catR: a positive regulator of the catBC operon is a member of the LysR family.J. Bacteriol. 172:922-931.[Abstract/Free Full Text]
  45. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed., vol. 1. Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
  46. Schnepf, E., N. Crickmore, J. Van Rie, D. Lereclus, J. Baum, J. Feitelson, D. R. Zeigler, and D. H. Dean.1998 . Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 62:775-806.[Abstract/Free Full Text]
  47. Shaw, G. C. 1998. Evidence against the Bm1P1 protein as a positive transcription factor for barbituate-mediated induction of cytochrome P450BM-1 in Bacillus megaterium. J. Biol. Chem. 273:7996-8002.
  48. Shivakumar, A. G., R. I. Vanags, D. R. Willcox, L. Katz, P. S. Vary, and J. L. Fox. 1989. Gene dosage effect on the expression of the delta-endotoxin genes of Bacillus thuringiensis subsp. kurstaki in Bacillus subtilis and Bacillus megaterium. Gene 79:21-31.[CrossRef][Medline]
  49. Silver, S., and L. T. Phung. 1996. Bacterial heavy metal resistance: new surprises. Annu. Rev. Microbiol. 50:753-789.[CrossRef][Medline]
  50. Srivastava, K. C. 1990. Biodegradation of styrene by thermophilic Bacillus isolates, p.53 -58. In L. G. Copping, R. E. Martin, J. A. Pickett, C. Bucke, and A. W. Bunch (ed.), Opportunities in biotransformations. Elsevier, London, United Kingdom.
  51. Stevenson, D. M., M. Kunnimalaiyaan, K. Müller, and P. S. Vary. 1998. Characterization of a theta plasmid replicon with homology to all four large plasmids of Bacillus megaterium QM B1551. Plasmid 40:175-189.[CrossRef][Medline]
  52. Stevenson, D. M., D. Lach, and P. S. Vary.1993 . A gene required for germination in Bacillus megaterium is plasmid-borne, p.197 -207. In E. Balla and G. Berencsie (ed.), DNA transfer and gene expression in microorganisms. Intercept, Budapest, Hungary.
  53. Tailliez, P., S. D. Ehrlich, and M. C. Chopin.1994 . Characterization of IS1201, an insertion sequence isolated from Lactobacillus helveticus. Gene 145:75-79.[CrossRef][Medline]
  54. Thorsted, P. B., C. M. Thomas, E. U. Poluektova, and A. A. Prozorov. 1999. Complete sequence of Bacillus subtilis plasmid p1414 and comparison with seven other plasmid types found in Russian soil isolates of Bacillus subtilis. Plasmid 41:274-281.[CrossRef][Medline]
  55. Udo, E. E., L. E. Jacob, and B. Mathew.2000 . A cadmium resistance plasmid, pXU5, in Staphylococcus aureus, strain ATCC 25923. FEMS Microbiol. Lett. 189:79-80.[CrossRef][Medline]
  56. Vary, P. S. 1994. Prime time for Bacillus megaterium. Microbiology 140:1001-1013.[Abstract]
  57. Vary, P. S., M. Kunnimalaiyaan, and M. S. Scholle.2002 . Comparison of sequences of four homologous theta replicons from B. megaterium QM B1551 and progress in complete sequencing of the seven plasmid array. Plasmid 48:249.
  58. Vary, P. S., and Y.-P. Tao. 1988. Development of genetic methods in Bacillus megaterium, p.403 -407. In A. T. Ganesan and J. A. Hoch (ed.), Genetics and bio/technology of bacilli, vol. 2. Academic Press, New York, N.Y.
  59. Von Tersch, M. A., and B. C. Carlton.1983 . Megacinogenic plasmids of Bacillus megaterium. J. Bacteriol. 155:872-877.[Abstract/Free Full Text]
  60. Wu, L. J., and J. Errington. 1994. Bacillus subtilis spoIIIE protein required for DNA segregation during asymmetric cell division. Science 264:572-575.[Abstract/Free Full Text]
  61. Zhong, Z., A. Toukdarian, D. Helinski, V. Knauf, S. Sykes, J. E. Wilkinson, C. O'Bryne, T. Shea, C. DeLoughery, and R. Caspi.2001 . Sequence analysis of a 101-kilobase plasmid required for agar degradation by a Microscilla isolate. Appl. Environ. Microbiol. 67:5771-5779.[Abstract/Free Full Text]

Applied and Environmental Microbiology, November 2003, p. 6888-6898, Vol. 69, No. 11
0099-2240/03/$08.00+0     DOI: 10.1128/AEM.69.11.6888-6898.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Scholle, M. D.
Right arrow Articles by Vary, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Scholle, M. D.
Right arrow Articles by Vary, P. S.
Agricola
Right arrow Articles by Scholle, M. D.
Right arrow Articles by Vary, P. S.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. Microbiol. Mol. Biol. Rev. Eukaryot. Cell All ASM Journals