Previous Article | Next Article ![]()
Applied and Environmental Microbiology, December 2003, p. 7281-7288, Vol. 69, No. 12
0099-2240/03/$08.00+0 DOI: 10.1128/AEM.69.12.7281-7288.2003
Copyright © 2003, American
Society for
Microbiology. All Rights Reserved.
Arjan J. W. Hoekman,2 Florence Clier,1 Vincent Juillard,1 Hein J. Boot,2 and Jean-Christophe Piard1*
Useful Bacterial Surface Proteins, INRA-URLGA, 78352 Jouy-en-Josas Cedex, France,1 Department of Avian Virology, Institute for Animal Science and Health, Lelystad, The Netherlands2
Received 8 April 2003/ Accepted 10 September 2003
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
One of the most investigated and challenging new fields of application for LAB is their use as antigen delivery vehicles for mucosal immunization (29, 41, 49). The mucosa, which provides areas of contact with the outside environment, is the entry route of many pathogens, including viruses, bacteria, and parasites. Pathogen proliferation and/or penetration on or through mucosal surfaces is prevented by (i) the physical barrier provided by the mucosal epithelium itself and by the mucosal physicochemical environment (mucus layer, peristalsis, acidity, enzymes), (ii) the normal mucosal microflora that prevents development of exogenous microorganisms, and (iii) the mucosal immune system. While the first two mechanisms are nonspecific, the mucosal immune system is highly specialized and involves different types of cells that establish specific responses against pathogens (22). The mucosal immune response is characterized by the synthesis of large amounts of class A immunoglobulins (IgA) that are secreted onto the mucosal surfaces and have a major role in the clearance of pathogens (9). Mucosal (as well as systemic) immunization can be achieved by presenting antigens at mucosal sites. LAB are well suited for this purpose. They are organisms that are generally regarded as safe and are regularly and widely ingested by humans and animals through food products, and many LAB species are members of the normal gut microflora of humans and animals.
An intermediate step for the use of LAB in new applications, such as vaccine delivery, is the development of expression systems for stable production of heterologous proteins. We have recently designed a protein-targeting system that allows the targeting of a reporter protein to the cytoplasm, the cell wall, or the extracellular medium of various LAB species (10). With this system, we are investigating the potential of the best-characterized LAB, Lactococcus lactis, to be used as a live mucosal vaccine against chicken infectious bursal disease virus (IBDV). IBDV is the causative agent of a highly contagious chicken disease known as Gumboro (42). It belongs to the family of Birnaviridae, which consists of naked viruses characterized by a bisegmented, bistranded RNA genome (11). The largest double-stranded segment (segment A) harbors an open reading frame that encodes a precursor polyprotein. Its self-processing yields viral proteins VP2, VP3, and VP4 (21). VP2 and VP3 form the viral capsid of IBDV, and VP4 is the maturation protease of the polyprotein. IBDV infects young chickens through the digestive tract and massively destroys B cells in the bursa of Fabricius, a primary lymphoid organ, causing immunosuppression and death. Surviving birds are severely immunocompromised and more susceptible to other avian pathogens (38). IBDV is therefore of major concern in the poultry industry. Vaccination methods currently used in poultry industries consist of individual subcutaneous or intramuscular injection of inactivated IBDV into birds (1). A method that incorporates the vaccine in the drinking water also exists, but this method is only effective when live (attenuated) IBDV strains are used. Infection with these vaccine strains results in bursa damage. In the case of the more potent vaccine, severe depletion of B-lymphoid cells is observed, which results in immunosuppression, leading to an impaired immune response to other vaccinations and greater vulnerability to opportunistic infections (1, 31). Alternatively, both recombinant vaccines and DNA vaccines against IBDV are under investigation (6, 27).
Here we report the expression of the major IBDV antigens VP2 and VP3 in L. lactis. VP2 and VP3 were targeted to the cytoplasm, the cell wall, and the culture medium of L. lactis. The recombinant lactococci were used for oral immunization of chickens, and the immune response was monitored. In this first report of a trial that used antigens producing LAB in production animals such as chickens, possible improvements of this vaccination strategy are discussed.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
Cloning
of IBDV segment A cDNA.
We
used cDNA from highly virulent IBDV strain D6948
(5). Generation of the
full-length cDNA of segment A was previously described
(5). The cDNA was cloned
into a pGEM-T vector (Promega), and the resulting pHB22 plasmid was
established in E. coli
(5).
Cloning
strategy in L. lactis.
We previously designed vectors that
allowed the targeting of Staphylococcus aureus
nuclease (Nuc) to the cytoplasm, the cell wall, and the medium of
L. lactis cultures
(10). In those vectors,
the nuc gene is flanked by unique SalI and
EcoRV sites at its 5' and 3' ends,
respectively. To clone genes encoding the IBDV antigens, we replaced
nuc in the targeting vectors with vp2 and
vp3 after SalI and EcoRV
digestion.
Cloning of
vp3.
The
vp3 gene was PCR amplified from pHB22
(5) with primers VP3a
(5' CGCGACTGTCGACCGTTTTCCTCACAATCCA)
and VP3b (5'
GCCAGTCGATATCTCCTCAAGGTCCTCATCAGA). The
latter unraveling of the exact cleavage site between VP3 and VP4
indicated that these primers actually amplify a portion of vp4
resulting in the addition of 33 amino acids from VP4 to the N terminus
of VP3 (25).
VP3a bears a SalI site (in bold) at the 5'
end of the sequence derived from the vp3 gene and a tail (in
italics) at its 5' terminus. VP3b harbors an EcoRV
site (in bold) adjacent to the sequence derived from the vp3
gene and a 5' tail (in italics). The PCR product was digested
with SalI and EcoRV and cloned into SalI-
and EcoRV-digested pVE5523 (secretion vector), pVE5524 (cell
wall anchoring vector), and pVE5529 (cytoplasmic vector) to yield
plasmids pVE5541, pVE5542, and pVE5543, respectively. These plasmids
were then used to transform L. lactis
cells.
Cloning of
vp2.
The
vp2 gene was PCR amplified from plasmid pHB22 with primers
VP2a
(5'GGTCGGAGTCGACTGGTTAGTAGAGATCAGACAAA
[the SalI site is shown in bold, and the
5' tail is in italics]) and VP2b
(5'GCCAGTCGATATCTCCCTTAGGGCCCGGATTA
[the EcoRV site is in bold, and the 5'
tail is in italics]). The PCR product was restricted with
SalI and EcoRV and cloned into pVE5529, pVE5523, and
pVE5524 digested with the same enzymes to yield plasmids pVE5588,
pVE5586, and pVE5587, respectively. To construct pVE5539, which harbors
the spUsp45-nuc-vp2, plasmid
pVE5586 was linearized with SalI and then treated with mung
bean nuclease. A second digestion with NheI generated a
4,071-bp fragment that was ligated to the 5,656-bp
EcoRV-NheI fragment of pVE5523. To construct pVE5540,
which harbors the
spUsp45-nuc-vp2-cwaM6
fusion, pVE5587 was linearized with SalI, treated with mung
bean nuclease, and digested with BsgI. The resulting 2,643-bp
fragment was ligated to the 7,618-bp EcoRV-BsgI
fragment from pVE5524.
Cell
fractionation, protein extraction, and Western blot analysis.
Medium, cell wall, and protoplast
fractionation and protein extractions were performed as previously
described (33). Briefly,
2 ml of exponential-phase cultures (optical density at 600 nm
[OD600], 0.6 to 0.8) was microcentrifuged at
4°C for 3 min at 15,000 x g. The supernatant
and the cell pellet were processed separately. The supernatant was
filtered through 0.2-µm-pore-size filters (low protein
retention; Millipore) for bacterial removal, and proteins from 1.6 ml
of the filtrate were precipitated with 400 µl of ice-cold
80% (wt/vol) trichloroacetic acid (16% final
concentration). The mixture was kept on ice for 20 min and then
microcentrifuged at 4°C for 15 min at 15,000 x
g. The resulting pellet was dissolved at 80 µl per
OD600 unit in 50 ml of NaOH containing
4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (AEBSF; 2 mM) as
a protease inhibitor. The cell pellet was washed once with TES (10 mM
Tris-HCl [pH 5.8], 1 mM EDTA, 25% sucrose) containing
chloramphenicol (50 µg/ml) as an inhibitor of protein
synthesis. The bacterial cell walls were digested with 500 µl
of TES containing lysozyme (0.5 mg/ml), mutanolysin (0.1 mg/ml), RNase
(0.1 mg/ml), and AEBSF (2 mM). After 1 h of incubation at
37°C, the protoplasts were recovered by a 3-min centrifugation
at 15,000 x g and 4°C and then washed with TES
plus chloramphenicol. The pellet was resuspended at 100 µl per
OD600 unit in Tris-HCl [pH 7.4]-1 mM EDTA
(TE) containing 1% sodium dodecyl sulfate (SDS) for protoplast
lysis. The digested cell walls were recovered from the supernatant of
the above-described centrifugation and filtered through
0.2-µm-pore-size filters, and proteins from 400 µl were
precipitated with 16% trichloroacetic acid as described above.
The resulting pellet was dissolved at 80 µl per
OD600 unit in 50 mM NaOH containing 2 mM AEBSF. Equal
volumes of 2x loading buffer were added to all samples.
Extracts were subjected to SDS-polyacrylamide gel electrophoresis
(12% acrylamide)
(23). Electroblotting on
polyvinylidene difluoride membranes (Millipore) and antibody reactions
and detection (enhanced chemiluminescence) were performed in accordance
with the manufacturer's recommendations. Relative amounts of VP2
and VP3 in the different fractions were determined by scanning Western
blots on a PhosphorImager (Amersham). Anti-NucA polyclonal antibodies
were kindly provided by James Miller. Preparation of 9.7 anti-VP3
monoclonal antibodies was done as described elsewhere
(5). Anti-VP2 monoclonal
antibodies were a kind gift of H.
Mueller.
Chicken immunization.
Six groups of 10
specific-pathogen-free chickens were housed separately. At the age of
28 days, each chicken in each group received orally 1 ml of M17
containing 109 viable lactococci for 5 consecutive days. At
the age of 42 days, each chicken of each group again received orally 1
ml of M17 containing the same 109 viable lactococci for 5
consecutive days. Blood samples were taken from each chicken when it
was 28, 42, and 49 days old. Group 1 received VE5611 (secreted NucA),
group 2 received VE5612 (cell wall-anchored NucA), group 3 received
VE5662 (secreted VP3), group 4 received VE5663 (cell wall-anchored
VP3), group 5 received VE5670 (secreted Nuc-VP2 fusion), and group 6
received VE5671 (cell wall-anchored Nuc-VP2). Sera of the collected
samples were stored at -20°C and analyzed for the
presence of IgG antibodies against NucA, IBDV (IDEXX), and VP3 by
enzyme-linked immunosorbent
assay.
| RESULTS |
|---|
|
|
|---|
|
(i) Cytoplasmic-fraction
targeting.
One band with the
expected size of VP3 (33 kDa) was detected in the protoplast fraction
(Fig.
2A). As expected, no signal was revealed in either the cell wall or the
supernatant fraction. This validates the protocol used for protein
fractionation in that no cytoplasmic proteins leak into the cell wall
and supernatant fractions.
|
(iii) Cell wall
targeting.
Cell wall
targeting of VP3 was assessed in L. lactis expressing
the spUsp45-vp3-cwaM6
fusion. CWAM6 comprises (i) 35 amino acids that are
necessary for anchoring and are cleaved off upon tethering of the
protein to the peptidoglycan and (ii) a 105-residue upstream sequence
used as a spacer to display the protein of interest outside of the cell
wall layer (10). Western
blot analysis revealed bands in the cell wall fraction in the range of
35 to 47 kDa; very little VP3 protein was detected in the supernatant
(Fig. 2C). The higher band
in the cell wall fraction is likely to correspond to the full-length
anchored VP3 fusion (theoretical molecular mass, 49 kDa);
the other bands might result from proteolysis, as previously observed
when Nuc was expressed at the surface of L. lactis
(10). This result shows
that some proportion of VP3 could be targeted to the L.
lactis cell wall. Nevertheless, the majority (about
80%) of signals were present in the protoplast fraction (Fig.
2C). These bands probably
correspond to the SPUsp45-VP3-CWAM6 precursor
(the higher band) and to degradation products. Comparison of the
secreted (Fig. 2B) and
anchored (Fig. 2C) forms
of VP3 indicates that a smaller proportion of total VP3 is cell wall
anchored than secreted.
In summary, IBDV VP3 antigen can be targeted to three cell compartments in L. lactis. VP3 could be stably produced in the cytoplasm. When fused to suitable signals, about 80% of the VP3 could be secreted and about 20% could be anchored to the cell wall, although some proteolysis occurred in both cases. The protocol used for protein fractionation appeared efficient, as each VP3 species that was targeted to a defined cell compartment provided a typical pattern that was not found in the other fractions. This demonstrates that no contamination between the different fractions occurred.
VP2 failed to be secreted in
L. lactis.
The vp2 gene was cloned in
frame into cytoplasmic and secretion vectors, and its expression in
L. lactis was analyzed by Western blotting of
fractionated samples with antibodies raised against VP2. As expected,
cells harboring the cytoplasmic vector generated a unique band in the
protoplast fraction (data not shown). However, in cells harboring the
secretion vector, the only detected band was in the protoplast fraction
as well (Fig.
3A); it migrated at the expected position of SPUsp45-VP2 (54
kDa). No signal was present in either the cell wall or the supernatant
fraction. This result suggests that VP2 could not be exported in
L. lactis. As VP2 is naturally expressed in a
cytoplasmic context in IBDV, one can imagine that despite the addition
of SPUsp45, VP2 remained in a state incompetent for membrane
translocation.
|
For assessment of VP2
targeting to the L. lactis cell wall, we constructed
the
spUsp45-nuc-vp2-cwaM6
fusion. Its expression product was analyzed in L.
lactis by Western blotting with antibodies against Nuc. The
protoplast fraction produced one strong band that corresponds to the
86-kDa precursor protein SPUsp45-Nuc-VP2-CWAM6
(Fig. 3C). The cell wall
fraction displayed a strong band of the size expected for the anchored
species (84 kDa), which represented
20% of the signals
detected in the three cell compartments. This proportion is the same as
that of secreted Nuc-VP2 obtained as described above, which suggests
that, once translocated across the membrane, the Nuc-VP2 fusion is
efficiently targeted to the cell wall of L. lactis.
Interestingly, anchored Nuc-VP2 appears to be more stable than the
secreted fusion since its migration corresponds to the full-size
protein. Possibly, the addition of CWAM6 partly protects VP2
against proteolysis. However, some cell surface proteolysis may occur,
as suggested by the presence of a low-molecular-weight compound in the
supernatant fraction. Three factors suggest that this proteolysis
occurs within theVP2 sequence. First, this sequence is, as shown above,
highly susceptible to proteolysis. Second, the degradation compound
still reacts with Nuc antibodies. Third, the topology of the
Nuc-VP2-CWAM6 fusion strongly suggests that its release into
the supernatant results from C-terminal degradation as it is anchored
to the cell wall by its C terminus. Since little proteolysis within
CWAM6 occurred in the above-described studies with VP3 (Fig.
2C), VP2 was probably the
major target for proteolysis.
Chicken
immune response to recombinant lactococci.
The immunogenicity of recombinant
L. lactis strains expressing IBDV antigens or Nuc was
evaluated after oral administration to chickens. The birds received
109 cells daily for 5 successive days, and the same
administration protocol was repeated 2 weeks later. Specific serum IgG
production was analyzed at days 0, 14, and 21 following the first
administration. The strain expressing the cell wall-anchored Nuc-VP2
fusion induced a weak but significant IgG response against Nuc (Fig.
4). This response appeared at day 14 after the first administration
(P < 0.02) and increased at day 21 postimmunization
(P < 0.016), which corresponds to 1 week after the
booster immunization (Fig.
4). However, we did not
detect any serum IgG response against VP2 (data not shown). Also, no
immune response was detected after immunization of chickens with
L. lactis expressing the other antigens tested in
this study (data not
shown).
|
| DISCUSSION |
|---|
|
|
|---|
Targeting of IBDV antigens in
L. lactis. (i) VP2 and VP3 are stable in the
cytoplasm of L. lactis.
VP2 and VP3 were successfully produced
in the cytoplasm and appeared as unique bands of the expected sizes,
suggesting that no proteolysis occurred. We attribute this stability of
VP2 and VP3 in the cytoplasm to their rapid folding, which would
provide them with a structure resistant to cytoplasmic proteases.
Indeed, the compact conformational structure and multimerization of VP2
and VP3 are supported by studies with yeast
(45). However, as
previously observed with other proteins in L. lactis,
VP2 and VP3 were produced at a lower yield than their secreted and cell
wall-anchored counterparts (Fig.
2 and
3)
(3,
10,
12,
37). No explanation for
this finding has been found.
(ii)
Secretion of NNSP versus their degradation.
Naturally nonsecreted proteins (NNSP)
are known to be difficult to secrete. This is attributed to their
tendency to fold rapidly in the cytoplasm, which prevents their
translocation across the cytoplasmic membrane
(35). A first way to
delay their folding and keep them in the unfolded state required for
translocation is to fuse them with a signal peptide. In an attempt to
drive secretion of the two NNSP VP2 and VP3, we used the signal peptide
from Usp45 (the most-secreted protein in L. lactis),
followed by negatively charged amino acids downstream of the cleavage
site. This combination has previously been shown to be the most
efficient in LAB for secretion of heterologous naturally secreted
proteins (10). With this
system, efficient secretion of VP3 (80%) was obtained. This is a
particularly high level for an NNSP compared with other viral proteins
that were secreted much less in L. lactis
(12,
37). On the other hand,
fusion of VP3 with SPUsp45 also induced VP3 degradation both
at the precursor level in the protoplast and at the mature-protein
level in the extracellular medium. As native VP3 was stable in the
cytoplasm of L. lactis (Fig.
2A), we attribute the
cytoplasmic degradation to the addition of SPUsp45, which
would impede VP3 folding, rendering it more susceptible to proteolysis.
It is likely that cytoplasmic and extracellular degradation is mediated
by ClpP and HtrA, two housekeeping proteases located in the cytoplasm
and on the outer side of the membrane of L. lactis,
respectively (14,
34).
Fusion of VP2 to SPUsp45 failed to drive VP2 secretion (Fig. 3A). This suggests that this Usp45 signal peptide is not sufficient to prevent VP2 folding and/or multimerization in the cytoplasm of L. lactis. It has been shown in both Escherichia coli and Bacillus subtilis that the protein-folding process can be further delayed (and protein secretion can be improved) by overexpression of chaperones proteins (40, 51). We first chose another strategy, which consisted of fusing VP2 to the C terminus of naturally secreted S. aureus Nuc. Our rationale was based on the postulate that addition of Nuc might delay the folding of VP2, thus maintaining the fusion protein in an export-competent state. To a certain extent, this strategy appeared successful, allowing a secretion efficiency of 20% for the Nuc-VP2 fusion. This suggests that an NNSP such as VP2 that is totally recalcitrant to translocation in its native form can be partly carried through the secretion machinery when it is fused to a naturally secreted protein such as Nuc. This may find many applications in the development of protein delivery by LAB, as some candidate proteins, including antigens and enzymes, are not naturally secreted in their native organism. An adverse effect of the partial secretion of Nuc-VP2 was observed in protein degradation that concerned the VP2 moiety of the fusion. Altogether, these results show that there are conflicting interests in retarding protein folding; i.e., translocation may occur, but the unfolded protein is more prone to proteolysis.
(iii) Cell wall anchoring of
NNSP and protection against proteolysis.
Both Nuc-VP2 and VP3 could be anchored
to the cell wall of L. lactis. Although the
proportion of precursor processed to the cell wall (20%) was the
same for both antigens, we believe that the respective bottlenecks
hampering cell wall anchoring of VP2 and VP3 are different. In the case
of Nuc-VP2, we observed the same level of processing in the case of
secretion and cell wall anchoring. As membrane translocation is a
prerequisite for cell wall anchoring, we believe that, in the case of
Nuc-VP2, the limiting step for cell wall anchoring is translocation of
the precursor through the membrane. In contrast, in the case of VP3,
the secretion level was 80% and the cell wall-anchoring level
was 20%. This is reminiscent of the observation previously made
with Nuc (10). In this
case, we showed that the defect in cell wall anchoring is due not to a
translocation defect but rather to too low an activity of sortase, the
transpeptidase tethering the protein to the cell wall. We believe that
the same phenomenon explains why some VP3 cannot anchor to the cell
wall. Probably, the sortase level in L. lactis is
sufficient to anchor the low level of exported Nuc-VP2 but insufficient
to anchor VP3, which is exported at a higher
level.
Interestingly, cell wall anchoring of Nuc-VP2 allowed its partial protection against proteolysis. Whereas all of the Nuc-VP2 secreted had the VP2 portion truncated, most of the cell wall-anchored fusion appeared as the entire Nuc-VP2 fusion. Although we have no explanation for this observation, it could be valuable to stabilize proteins that are highly susceptible to proteolysis when they are exported outside the cell.
Serum antibody
response to oral administration of IBDV antigen-producing L.
lactis.
IBDV
antigen-producing lactococci were used to investigate the potential of
L. lactis for vaccine delivery into chickens. This
represents a first step toward the development of a new strategy for
vaccination against IBDV. Such a vaccination strategy, with LAB as the
vehicle for oral administration of the vaccine through food or water,
would be highly attractive because of its low cost, its safety, and the
absence of immunosuppression.
We chose VP2 and VP3 as antigens to be expressed in L. lactis as these proteins are constituents of the IBDV capsid and represent 90% of the total IBDV proteins (11). VP2 contains the major epitopes that elicit neutralizing antibodies (13), while VP3 has been reported to bear minor neutralizing sites (20).
The lactococcal strains designed and characterized as described above were used for oral vaccination of 28-day-old specific-pathogen-free chickens. It is noteworthy that strains expressing exported forms (secreted or cell wall anchored) of VP2 and VP3 also accumulated significant amounts of antigen in their protoplast. Consequently, antigens were, in fact, located in two cell compartments. Following oral vaccination of chickens, only bacteria producing an anchored Nuc-VP2 fusion induced a systemic and specific response against Nuc but not against VP2. This is the first demonstration that oral administration of antigen-producing LAB can promote an immune response in production animals such as chickens, as the few studies performed in this field have been conducted with mice (29). However, these results raise two questions. (i) Why did only Nuc fused to VP2 and cell wall anchored induce an immune response, and (ii) why did only Nuc, and not VP2 or VP3, induce an immune response? It has been shown previously that cell wall-anchored antigens are more immunogenic in mice than are their cytoplasmic or secreted counterparts (36, 50). A hypothesis is that the expression level of the designed fusion genes is situated at the threshold required to elicit an immune response. Therefore, only the most immunogenic form, i.e., the cell wall-anchored form, of Nuc-VP2 would have allowed an immunological response of the chickens. A parameter other than the expression level did occur as lactococci expressing cell wall-anchored Nuc on its own with the same expression system were not immunogenic. Possibly, this may be due to the topology of the Nuc-VP2 fusion at the cell wall. As the fusion is anchored by its C terminus, VP2 could have a spacer role allowing the Nuc moiety to be displayed outside the peptidoglycan. This would allow better contact with immune cells. In this case, it would also explain why no response against VP2 and VP3 was observed as these antigens would be buried in the bacterial peptidoglycan layer.
Another possible explanation is that the absence of serum antibody reflects differential mucosal and systemic immune responses. This hypothesis is based on recent observations in mice after oral administration of L. lactis cells expressing bovine ß-lactoglobulin (7). Significant levels of specific anti ß-lactoglobulin IgA were found in feces, while all of the Ig classes tested (IgA, IgG1, IgG2a, and IgE) were absent in serum. A similar imbalance toward an IgA response might account for our results.
In the emerging field of antigen delivery by LAB, further work is needed to better understand and improve the mechanisms governing chicken immune responses. Several lines of improvement exist, including (i) antigen stabilization in LAB by down regulation of housekeeping protease genes (15, 34), (ii) better protein export by overexpression of chaperones, and (iii) improvement of protein anchoring to the cell wall by sortase overexpression. Also, improvements in the interactions between the bacteria and the host immune system will consist of (i) coexpression of both antigens and adjuvants in LAB as L. lactis is able to produce fully active cytokines (2, 43, 44) and (ii) the use of LAB able to colonize the chicken gut (17, 18). Probably, a combination of improvements along these lines will be necessary to make LAB serious candidates for live-vaccine development.
| ACKNOWLEDGMENTS |
|---|
This work was supported by a Van Gogh program. Y.D. was the recipient of a joint grant from ID-DLO, INRA, and Fondation pour la Recherche Médicale (Paris, France).
| FOOTNOTES |
|---|
Present
address: Department of Microbiology, The Ohio State University,
Columbus, OH 43210. ![]()
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | Microbiol. Mol. Biol. Rev. | Eukaryot. Cell | All ASM Journals |
|---|