This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Frazier, C. L.
Right arrow Articles by Mills, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Frazier, C. L.
Right arrow Articles by Mills, D. A.
Agricola
Right arrow Articles by Frazier, C. L.
Right arrow Articles by Mills, D. A.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, February 2003, p. 1121-1128, Vol. 69, No. 2
0099-2240/03/$08.00+0     DOI: 10.1128/AEM.69.2.1121-1128.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Genetic Manipulation of Lactococcus lactis by Using Targeted Group II Introns: Generation of Stable Insertions without Selection

Courtney L. Frazier,1 Joseph San Filippo,2 Alan M. Lambowitz,2 and David A. Mills1*

Department of Viticulture and Enology, University of California at Davis, Davis, California 95616-8749,1 Institute for Cellular and Molecular Biology, Department of Chemistry and Biochemistry, and Section of Molecular Genetics and Microbiology, School of Biological Sciences, University of Texas at Austin, Austin, Texas 787122

Received 3 October 2002/ Accepted 21 November 2002


arrow
ABSTRACT
 
Despite their commercial importance, there are relatively few facile methods for genomic manipulation of the lactic acid bacteria. Here, the lactococcal group II intron, Ll.ltrB, was targeted to insert efficiently into genes encoding malate decarboxylase (mleS) and tetracycline resistance (tetM) within the Lactococcus lactis genome. Integrants were readily identified and maintained in the absence of a selectable marker. Since splicing of the Ll.ltrB intron depends on the intron-encoded protein, targeted invasion with an intron lacking the intron open reading frame disrupted TetM and MleS function, and MleS activity could be partially restored by expressing the intron-encoded protein in trans. Restoration of splicing from intron variants lacking the intron-encoded protein illustrates how targeted group II introns could be used for conditional expression of any gene. Furthermore, the modified Ll.ltrB intron was used to separately deliver a phage resistance gene (abiD) and a tetracycline resistance marker (tetM) into mleS, without the need for selection to drive the integration or to maintain the integrant. Our findings demonstrate the utility of targeted group II introns as a potential food-grade mechanism for delivery of industrially important traits into the genomes of lactococci.


arrow
INTRODUCTION
 
The lactic acid bacteria (LAB) are a broad group of gram-positive bacteria that possess similar morphological, metabolic, and physiological characteristics (33). The LAB have been the subject of considerable research and commercial development, given their significance in fermentation, bioprocessing, agriculture, food, and medicine (12, 13). An impediment to fundamental studies on the LAB is the lack of facile genetic tools for manipulation of chromosomal genes (19). Moreover, public concern over the use of genetically engineered cultures for food production has prompted a search for "self-cloning" methods, whereby genetic manipulation is achieved using DNA solely from food-grade microorganisms, preferably from within the same genus (6).

Mobile group II introns are catalytic RNA elements present in a wide range of prokaryotic and eukaryotic organisms (18). Some of these introns can mobilize autonomously at a high frequency to allelic sites in a process known as homing (3). Mobile group II introns possess an intron-encoded protein (IEP) that has reverse transcriptase, RNA splicing ("maturase"), and DNA endonuclease activities (3). Mobility initiates when the IEP helps the intron RNA fold into the catalytically active RNA structure to promote splicing, resulting in ligated exons and an intron lariat-IEP ribonucleoprotein (RNP) complex. The RNP complex recognizes specific DNA target sites and promotes integration by reverse splicing of the intron RNA directly into one strand of the target DNA. The IEP then cleaves the opposite strand and uses it as a primer for target DNA-primed reverse transcription of the inserted intron RNA (16, 34, 36, 37). The resulting cDNA copy of the intron is integrated into genomic DNA by cellular recombination or repair mechanisms (5, 7, 8).

DNA target site recognition by the RNP complex involves the base pairing of intron sequences denoted EBS1 and -2 (exon binding sites 1 and 2) and {delta} to sequences denoted IBS1 and -2 (intron binding sites 1 and 2) and {delta}' in the DNA target site (Fig. 1 and 2) (9-11). In the case of the Lactococcus lactis Ll.ltrB intron, the IBS and {delta}' sequences are located between target site positions -12 and +3. The IEP recognizes a small number of additional nucleotide residues in the 5' and 3' flanking regions of the target site (positions -26 to +9) and promotes local DNA unwinding, enabling the intron RNA to base pair to the IBS and {delta}' sequences for reverse splicing (22, 27).



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 1. Schematic of intron homing into chromosomal mleS and tetM genes. Intron DNA and RNA are represented as thick lines. Introns flanked by donor exons E1 and E2 are expressed from a nisin-inducible promoter (Pnis). The IEP, denoted LtrA, cloned downstream of E2 is cotranscribed, allowing splicing and homing to occur. Intron and exon binding sequences (dIBS1 and -2, EBS1 and -2, and tIBS1 and -2) as well as {delta} and {delta}' are shown. EBS1, -2, & {delta} are designated by striped boxes above or below the intron to indicate sense or antisense strand orientation. Expression of donor M1083s-opt, M1107s-opt, M1083s-opt::tetM, or M1083s-opt::abiD introns results in formation of an RNP containing the IEP and excised intron lariat RNA. Invasion of the mleS is mediated, in part, by base pairing between RNA EBS1, -2, and {delta} and target IBS1, -2, and {delta}' sequences. M1083s-opt, M1107s-opt, M1083s-opt::tetM, or M1083s-opt::abiD introns integrated within mleS are shown. The antisense strand of the tetM gene within the M1083s-opt::tetM integrant was targeted for disruption by a second intron, T942a. PCR primers used to assay intron invasion or splicing are indicated by small arrows, with sizes of expected PCR products shown in parentheses. BsaJI (B) and HindIII (H) restriction sites that flank the intron insertion site are shown.



View larger version (58K):
[in this window]
[in a new window]
  		FIG. 2. Retargeted Ll.ltrB introns showing donor intron and mleS target sequences and base-pairing interactions. Nucleotide residues matching the WT ltrB sequence are shaded. Potential base pairs between the intron RNA and DNA target site are indicated by vertical lines. %CITJ, percentage of colonies that possess intron-target junctions, as determined by colony PCR using the MleS-1 and BsrGI primers and Tetjctn-F and Tetjctn-R primers, respectively. %CSCI, percentage of colony segregants that contain the intron. Five randomly selected colonies that exhibited mleS-intron or tetM-intron 5' junctions were washed and replated. The presence of the M1083s-opt and M1107s-opt introns in mleS was then scored by using a 2.4-kb amplicon with primers MleS-1 and MleS-2 flanking the mleS gene and a lack of the WT 1.6-kb amplicon (Fig. 1). The M1083s-opt::tetM and M1083s-opt::abiD introns were scored by amplification of the mleS-intron junction in addition to lack of amplification of the WT 1.6-kb amplicon when using primers MleS-1 and MleS-2. The tetM intron was scored by the lack of the WT 2.9-kb tetM amplicon with primers TetM-F and TetM-R (Fig. 1). dIBS and tIBS sequences refer to IBS sequences in the donor plasmid and DNA target site, respectively. Base pairing of the intron RNA to the donor IBS sequences is required for efficient splicing. NA, not applicable.

Because intron specificity is determined largely by base pairing, the intron's EBS and {delta} determinants can be rescripted to permit intron homing into novel DNA sites. Previous work has shown that the lactococcal Ll.ltrB intron can be retargeted to insert efficiently into plasmid and chromosomal targets within Escherichia coli and other enteric bacteria (9, 11). In addition, biochemical and genetic data have elucidated the target site recognition rules, thereby enabling rational design of introns targeted to any gene (9, 11, 22). Notably, retargeted Ll.ltrB variants in which the IEP has been deleted (Ll.ltrB{Delta}IEP) could home efficiently when the IEP (termed LtrA) was expressed in cis downstream of the intron (9, 11). Since Ll.ltrB{Delta}IEP introns are nonsplicing in the absence of the IEP (16), integration within a novel target site disrupts target gene function.

Given that Ll.ltrB is originally from L. lactis, a bacterium employed in dairy fermentations, we examined Ll.ltrB as a potential food-grade means for targeted insertion and regulation of lactococcal genes. In this work, we demonstrate that Ll.ltrB can be readily targeted to invade the L. lactis mleS gene, which encodes malate decarboxylase, an enzyme that catalyzes a conversion resulting in deacidification in fruit and vegetable fermentations (14). In addition, we delivered a tetM gene within this intron and subsequently invaded tetM with a second retargeted intron. Finally, we were able to confer a phage resistance phenotype to L. lactis by delivering an intron containing an abortive infection gene, abiD (17). Homing is extremely efficient, obviating the need for genetic selection using antibiotic resistance markers. Moreover, integration is highly specific and the integrants are genetically stable. Finally, invasion of a Ll.ltrB{Delta}IEP variant results in a conditional mutant whereby target gene function is partially restored by expression of the IEP in trans.


arrow
MATERIALS AND METHODS
 
Bacterial strains, plasmids, transformation, and growth media.
E. coli DH5{alpha} (Gibco BRL, Rockville, Md.) and MC1016 (New England Biolabs, Beverly, Mass.) were used for plasmid construction and were grown as described previously (2). Lactococcal strains were maintained in GM17 (30) with chloramphenicol and erythromycin added at 5 µg/ml and tetracycline at 10 µg/ml. Nisin induction was as described elsewhere (4). In order to determine stability of the chromosomally integrated introns, cells were cured of plasmid DNA by using ascorbic acid (25) (the percentage of cured cells was 55%) to ensure no additional homing occurred during the stability assessment. Intron stability was determined by serially passaging integrant cultures for 80 generations in GM17 supplemented with 0.8% malate, followed by plating on GM17-malate and PCR of 100 colonies using primers that flank the mleS or tetM intron-exon junction (described below). E. coli and L. lactis were transformed as described previously (2, 20).

Bacteriophage C2 resistance of an M1083s-opt::abiD integrant was determined by an efficiency of plating (EOP) assay on cells grown in GM17 supplemented with 0.8% malate to induce expression of abiD (located within the mleS gene). EOP was calculated by dividing the C2 phage PFU per milliliter obtained from the M1083s-opt::abiD integrant by the PFU per milliliter generated from the parental IL-1403 host strain. Preparation of C2 phage stock lysates and EOP determinations were carried out as described previously (17).

Nucleic acid manipulations, cloning, and hybridization.
Plasmid and chromosomal DNAs were isolated from L. lactis and E. coli as described elsewhere (2, 24, 32). RNA was isolated using the Fast Blue RNA kit (Bio-Rad Laboratories, Hercules, Calif.). DNA sequencing was performed by Davis Sequencing (Davis, Calif.). The selection system used to generate retargeted introns is based on a two-plasmid genetic assay developed previously (9, 11). E. coli intron donor chloramphenicol-resistant (Camr) plasmid pACD2 (previously denoted pACD-{Delta}ORF+ORF) (9, 11) expresses a library of Ll.ltrB{Delta}IEP introns with randomized IBS and EBS sequences from a T7lac promoter. These randomized introns also have a phage T7 promoter cloned near their 3' end. A second, ampicillin-resistant (Ampr) recipient plasmid contains the target gene of interest cloned upstream of a promoterless tetracycline resistance gene (tetR). Both plasmids are cotransformed into E. coli strain HMS174(DE3) with an isopropyl-ß-D-thiogalactopyranoside-inducible T7 RNA polymerase (9). The introns that are able to home into the target site of interest on the recipient plasmid activate expression of the downstream tetR gene. Thus, colonies containing functional retargeted introns are selected by growing on Amp-and Tet-supplemented media. Introns were optimized by modifying EBS2, EBS1, and {delta} sequences to base pair with mleS target site positions -12 to -8, -6 to -1, and +1 to +3, respectively, using previously described procedures (9, 11). The IBS sequences in the 5' exon were altered to base pair with the modified intron EBS sequences to ensure efficient forward splicing of the intron in L. lactis (9). The modifications were introduced via PCR. The first PCR used EBS1 and EBS2 primers (listed below), appropriate for each target site, to generate a 106-bp product that was gel purified and used as primer for the next round of PCR with the IBS primer. The second PCR produced a 350-bp product that was gel purified, digested with BsrGI and HindIII, and cloned into pACD2. The retargeted introns were recloned into the E. coli-L. lactis shuttle vector pMSP3535 (4) by digesting pACD2 (9, 11) with BsiEI and cloning the resulting 3-kb fragment, containing the 1-kb retargeted Ll.ltrB{Delta}IEP with ltrA relocated downstream of the 3' splice site, into SmaI-digested pMSP3535. The LtrA expression plasmid was constructed by digesting the M1083s-opt intron donor plasmid with PstI and cloning the 2-kb fragment, containing the LtrA open reading frame, into PstI-cut pMSP3535. The tetM and abiD genes were cloned into the M1083s-opt intron by PCR amplifying tetM and abiD (primers listed below) and cloning into the MluI site within the M1083s-opt donor plasmid.

Southern hybridizations were carried out on nylon membranes (Zeta-probe; Bio-Rad) as described previously (2) and probed with a digoxigenin-labeled probe specific to sequences within intron domain IV (9). Probe signal was detected using a DIG luminescence detection kit (Boehringer Roche, Indianapolis, Ind.).

Primers, probes, and PCR methods.
PCRs were done using a PTC-200 thermal cycler (MJ Research, San Francisco, Calif.) under the following reaction conditions: 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 0.2 mM deoxynucleoside triphosphates, 6 mM MgCl2, a 0.25 µM concentration of each primer, 2.5 U of Taq DNA polymerase, and 100 ng of DNA. Colony PCR was done by toothpicking a single colony into 2 µl of water in a PCR tube, adding 13 µl of GeneReleaser (Bioventures Incorporated, Murfreesboro, Tenn.), and microwaving for 5 min. Reverse transcription-PCR (RT-PCR) was performed with the Access RT-PCR system (Promega, Madison, Wis.). All primers were obtained from Operon Technologies (Alameda, Calif.). Primers MleS-1 (5'-TTGTACGATGCGTGCACATG) and MleS-2 (5'-GATATTCCCCTTACTACTCT) were used to amplify the complete mleS gene; BsrGI (5'-GGGGTGTACAAATGTGGTGA) was used with MleS-1 to amplify mleS-intron 5' junctions; RT-F (5'-GGTTTACTTTTTGATGATATG) and RT-R (5'-GAAGATTACTGGGCGTTCTG) were used to assay M1083s-opt intron splicing from within the mleS gene; BsrGI and MleS-2 were used for sequencing of 5' and 3' mleS-intron junctions, respectively, from the amplicon produced with primers MleS-1 and MleS-2; Intron-1 (5'-GACGCGTTGGGAAATGGC) and Intron-2 (5'-TCACTGTCGACCCTATAGTGAGTCGTATTA) were used to create a digoxigenin-labeled probe specific to intron domain IV; and Tetjctn-F (5'-TTGTTTCGCTATCATTGCCATTTCC) and Tetjctn-R (5'-TCGTTTCCCTCTATTACCGTATCCC) were used to amplify the tetM-intron junctions. tetM was amplified with TetMF (5'-GGGGACGGCTGAGGAAAATC) and TetMR (5'-GGGGACGGCTCAACATAAAATAC). Amplification of abiD was performed with primers abiD-F (5'-GGGGACGCGTGTATATAAGGTCTAAAAT) and abiD-R (5'-GGGGACGCGTCTTATATTCTAATCATTT). Primers used for intron optimization were as follows: M1083sE1 (5'-GATTGTACAAATGTGGTGATAACAGATAAGTCTTAACGTTGACTTACCTTTC); M1083sE2 (5'-CTAATTTCGGTTAGGTCTCGATAGAGGAAAG); M1083sIBS (5'-AAAAAGCTTCGTCGATCGTGAAGACCTTCTTAACGTGCGCCCAG); M1107sE1 (5'-GATTGTACAAATGTGGTGATAACAGATAAGTCCCAACTATTTACTTACCTTTC); M1107sE2 (5'-CTAATTTCGGTTTTTACTCGATAGAGGAAAG); and M1107sIBS (5'-AAAAAGCTTCGTCGATCGTGAAGTAAAACCAACTGTGCGCCCAG). Underlined nucleotides represent modified positions.

Homing assays.
An L. lactis culture containing an intron donor plasmid was induced overnight with nisin, then plated at different dilutions onto GM17-Erm plates containing 25 ng of nisin/ml, and incubated at 30°C for 1 to 2 days. While continued expression of the intron from the nisin promoter was not detrimental to homing or to cell growth, homing frequencies were determined after an initial induction of expression in order to more closely gauge the insertion frequencies resulting from a defined window of induction. Chromosomal DNA isolated from the induced culture, as well as from 50 to 100 colonies from GM17-Erm-nisin plates, was tested for intron integration via PCR. To determine the percentage of mleS and tetM disruptants, select colonies that exhibited mleS-intron or tetM-intron junctions were toothpicked into 100 µl of phosphate-buffered saline, vortexed, diluted, and plated onto GM17-Erm medium without nisin. A total of 50 to 100 colonies from the second plating were tested for intron integration via colony PCR with primers flanking the mleS gene and primers to the mleS-intron junction. tetM-intron segregants were verified by colony PCR with primers flanking the tetM gene and primers to the tetM-intron junction.

Malate decarboxylase assay.
To prepare extracts, an overnight culture was diluted 1/100 in 100 ml of GM17-Erm with or without nisin and grown until A600 = 0.6 to 0.8. Cells were pelleted and incubated with 500 µl of 1-mg/ml lysozyme for 30 min at 37°C and then washed by centrifugation in 10 ml of 0.1 M potassium phosphate buffer (pH 6.0). The pelleted cells were resuspended in 2 ml of potassium phosphate buffer and disrupted in a Fast Prep (Bio 101, La Jolla, Calif.) instrument at a setting of 6 for 40 s. Cell debris was pelleted for 20 min at 4°C and the supernatant was removed for assay. Protein concentrations were determined using the Bio-Rad protein assay kit (Bio-Rad Laboratories). The decarboxylase assay was performed as previously described (21), except that the reaction mixture consisted of 0.1 M potassium phosphate buffer (pH 6.0), 50 µM NAD, 87 µM MnSO4, 1.5 mM malate, 10 nCi of L-1,4(2,3)-[14C]malic acid (55 mCi/mmol; Amersham Pharmacia, Piscataway, N.J.).


arrow
RESULTS
 
Retargeted introns can home efficiently and specifically in lactococci.
We used an E. coli-based selection system with a combinatorial library of Ll.ltrB intron donor plasmids having randomized IBS, EBS, and {delta} sequences (9, 11) to obtain two Ll.ltrB introns targeted to the mleS gene of L. lactis IL-1403 (1) and a third intron targeted to a tetM antibiotic resistance marker. These intron variants are denoted M1107s, M1083s, and T942a, indicating that they insert in the sense (s) or antisense (a) DNA strand at positions +1107, +1083, or +942 from their respective initiation codons. E. coli intron donor plasmids contain Ll.ltrB {Delta}IEP variants with the IEP (LtrA) expressed in cis from a position downstream of the 3' exon (Fig. 1). In E. coli, the M1107s and M1083s introns, without alterations to optimize base pairing, invaded a plasmid-borne mleS gene at frequencies of 17 and 47%, respectively.

The M1107s and M1083s introns, containing ltrA relocated downstream of the intron's 3' splice site, were recloned under the control of a nisin-inducible promoter in the E. coli-L. lactis shuttle vector pMSP3535 (4) and transformed into L. lactis IL1403. Two versions of the introns were tested: the original introns isolated from the combinatorial library in E. coli, and optimized versions in which mismatches were corrected between the intron's EBS sequences and IBS sequences in the DNA target site (tIBS) as well as IBS sequences in the donor plasmid (dIBS) for efficient RNA splicing (Fig. 2). Since previous analysis indicated that positions -7 and -13 are not recognized by base pairing, these positions were left unchanged (9) (Fig. 2). After induction with nisin, intron invasion was scored by PCR amplification across the 5' mleS-intron junction within the chromosomal mleS gene (primers MleS-1 and BsrGI [Fig. 1]). Nisin-induced expression of the optimized introns in broth culture gave mleS-intron junctions indicative of a homing event (data not shown), whereas the unoptimized introns gave no detectable mleS-intron junctions, even though these introns homed efficiently in the plasmid assay in E. coli.

To score invasion frequency, the induced cultures were plated onto GM17 medium in the presence of nisin and the resulting colonies were analyzed directly by PCR. One hundred percent of colonies derived from M1083s-opt- and M1107s-opt-induced cultures possessed the mleS-intron junction (Fig. 2 and 3). A similar plating analysis of unoptimized M1083s and M1107s variants did not reveal any mleS-intron junctions (<1% invasion). The necessity of using optimized introns could reflect that base pairing requirements are more stringent in L. lactis than in E. coli (see Discussion).



View larger version (34K):
[in this window]
[in a new window]
  		FIG. 3. (A) Agarose gel showing PCR products from homing assays and clonal segregants containing the inserted intron. J indicates PCR with primers that detect the 5' intron-exon junction (MleS-1 and BsrGI), and F indicates PCR with primers flanking the mleS gene (MleS-1 and MleS-2) (Fig. 1). Lanes: 1, a nonclonal mleS::M1083s-opt colony; 2, a nonclonal mleS::M1107s-opt colony; 3, a nonclonal mleS::M1083s-opt::tetM colony; 4, a clonal mleS::M1083s-opt segregant; 5, a clonal mleS::M1107s-opt segregant; 6, a clonal mleS::M1083s-opt::tetM segregant. (B) Agarose gel of the PCR product from homing assays in which the T942a-tetM junction was amplified with primers TetMjctn-F and TetMjctn-R (Fig. 1). Lane 1, molecular mass ladder; 2, 0.8-kb T942a-tetM junction PCR product.

Since the mleS integration was achieved without selection, it was essential to determine if the colonies that possessed mleS-intron junctions were clonal. Therefore, an additional PCR was performed using primers that flank the intron invasion site in the mleS gene (primers MleS-1 and MleS-2 [Fig. 1]). If intron invasion occurs, the mleS amplicon should be 0.9 kb larger than that derived from a wild type (WT) gene (Fig. 1). However, PCRs performed on DNA from induced broth cultures containing the retargeted introns, as well as selected colonies identified as possessing mleS-intron junctions, exhibited only the 1.6-kb amplicon indicative of the WT mleS gene (Fig. 3A). This suggested that lactococcal colonies identified as positive for mleS-intron junctions contained a mixture of WT and disrupted mleS genes, with the smaller product predominating during PCR.

To determine the fraction of cells possessing WT or intron-invaded mleS genes, selected colonies were washed with phosphate-buffered saline and replated on GM17 medium without nisin to eliminate further intron expression. The resulting colonies were then directly assayed by PCR using the same primers flanking the intron target site within the mleS gene. Analysis of five individual colonies that contained M1083s-opt integrants indicated the fractions of cells possessing an intron-invaded mleS gene were 4 to 92% (Fig. 2). M1107s-opt integrants had lower percentages, 1 to 4% (Fig. 2), consistent with the relative insertion frequencies of these introns (1 and 5% for M1107s-opt and M1083s-opt, respectively) in E. coli.

Intron-mediated delivery and inactivation of tetM.
To determine the impact of heterologous DNA carriage on targeted invasion of mleS, the 2-kb tetM gene was cloned into domain IV within M1083s-opt. The resultant M1083s-opt::tetM intron gave a somewhat lower range of homing frequencies, comparing five of these colonies (5 to 56% [Fig. 2]) to five colonies with M1083s-opt (4 to 92%). A second intron, T942a, was then targeted to the antisense strand of tetM. T942a expressed in an M1083s-opt::tetM integrant homed at frequencies of 21 to 46% (Fig. 2), as judged by PCR across the tetM-intron junction (Fig. 3B) and an inability to amplify the 2.0-kb WT tetM with primers TetMF and TetMR (Fig. 1). This demonstrates that group II introns can be used to deliver, and subsequently disrupt, selectable markers used for the manipulation of lactococcal strains.

Food-grade delivery of abiD into the lactococcal chromosome.
The ability of Ll.ltrB to deliver genetic information into the lactococcal chromosome without selection suggests that introns could be used to stabilize industrially significant traits within lactococcal starter cultures. To demonstrate this, we cloned the 1.4-kb abiD gene, which encodes resistance to common lactococcal bacteriophages (17), into domain IV of the M1083s-opt intron. The resultant M1083s-opt::abiD intron homed into mleS at frequencies between <0.5 and 2%, slightly lower that that observed for the M1083s-opt::tetM intron. EOP assays on the M1083s-opt::abiD integrants demonstrated resistance to bacteriophage C2 at levels similar to those previously shown for abiD (EOP = 0.09) (17).

Specificity of intron insertion.
Invasion of mleS by M1083s-opt and T947a is highly specific. Southern blot analysis of BsaJI- or HindIII-digested DNA from clonal M1083s-opt, M1083s-opt::tetM, and T942a integrants confirmed that M1083s-opt and T942a invasion occurred only in single sites within L. lactis IL1403 (Fig. 4). As an additional check for specificity, the M1083s-opt donor plasmid was transformed into L. lactis LM0230, a host that harbors an mleS gene with sequence differences from the mleS gene in IL1403. These differences result in a tIBS mismatch with the M1083s-opt intron EBS at position +1 and wobble base pairs at positions -1 and -10 (Fig. 2). No other sequence polymorphisms exist between the LM0230 and IL1403 mleS alleles within the intron target site region. PCR analysis of DNA purified from LM0230 cultures expressing M1083s-opt did not reveal mleS-intron junctions, suggesting that intron homing occurred at a low frequency if at all. PCR analysis of colonies isolated from this culture also failed to identify mleS-intron junctions (Fig. 2).



View larger version (61K):
[in this window]
[in a new window]
  		FIG. 4. Southern hybridization analysis. BsaJI- or HindIII-cut DNAs from intron-containing L. lactis IL-1403 integrants were hybridized to a sequence in intron domain IV (see Materials and Methods). A single, randomly chosen integrant was examined for each intron delivered. (A) M1083s-opt integrant cured of donor plasmid. Lane 1, {lambda}-HindIII molecular mass markers; 2, HindIII-cut IL-1403 DNA; 3, BsaJI-cut IL-1403 DNA; 4, HindIII-cut IL-1403 M1083s-opt integrant DNA; 5, BsaJI-cut IL-1403 M1083s-opt integrant DNA. The probe detects a single band of the expected sizes (1.8 and 1.2 kb, respectively, for BsaJI and HindIII cleavage) for the M1083s-opt or M1107s-opt intron-invaded mleS genes and no band for the control WT IL-1403 DNA. (B) M1083s-opt::tetM and T942a integrants. Lane 1, {lambda}-HindIII molecular mass markers; 2, HindIII-cut T942a integrant DNA; 3, BsaJI-cut T942a integrant DNA; 4, HindIII-cut M1083s-opt::tetM integrant DNA; 5, BsaJI-cut M1083s-opt::tetM integrant DNA; 6, HindIII-cut L. lactis IL-1403 WT DNA; 7, BsaJI-cut L. lactis IL-1403 WT DNA. The probe detects bands of the expected sizes for the M1083s-opt::tetM intron in mleS (3.7 and 2.3 kb, respectively, for BsaJI and HindIII cleavage) and the T942a intron in tetM (4.6 and 3.2 kb, respectively, for BsaJI and HindIII cleavage) and no band for the control L. lactis IL-1403 WT DNA. Bands noted as donor plasmid result from the probe hybridizing to intron DNA present on donor plasmid within uncured T942a integrants.

{Delta}IEP-intron gene inactivation.
All of the introns used in this study do not possess the IEP LtrA. Previous analysis of {Delta}IEP variants of Ll.ltrB suggested a severe reduction in splicing activity (16, 35). Invasion by M1083s-opt or M1107s-opt effectively disrupted malate decarboxylase activity by insertion of a 0.9-kb nonsplicing intron into mleS (Table 1). To determine if {Delta}IEP introns could splice after integration into mleS, an M1083s-opt integrant was assayed for intron splicing by RT-PCR (Fig. 5, lane 1). No spliced product could be detected, suggesting that the M1083s-opt intron integrated into the sense strand was nonfunctional.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Malate decarboxylase activity



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 5. Conditional splicing of the integrated M1083s-opt intron from the chromosomal mleS gene. Splicing was assayed by RT-PCR using RT-F and RT-R primers (Fig. 1) on strains with and without LtrA expressed in trans. The primers yield a 0.2-kb PCR product corresponding to ligated exons or a 1.1-kb PCR product corresponding to unspliced precursor RNA containing the inserted intron. Lanes: 1, mleS::M1083s-opt integrant without LtrA expression plasmid; 2, mleS::M1083s-opt integrant, LtrA induced; 3, mleS::M1083s-opt integrant, LtrA present but not induced.

The T942a intron invaded the antisense strand of tetM. Therefore, no intron splicing is possible from that target and, as expected, all M1083s-opt::tetM integrants (n = 34) were tetracycline sensitive.

Integrated intron stability.
Most methods for insertional mutagenesis require selection to drive integration into the chromosome and to maintain the mutation. Since intron-based insertion did not require selection to identify integrants, it was essential to determine if the integrated introns were genetically stable within expressed genes. To this end, clonal M1083s-opt, M1083s-opt::tetM, M1083s-opt::abiD, and T942a integrants, cured of donor intron plasmids, were serially transferred for 80 generations in GM17 broth containing malate prior to plating. Malate induces expression of mleS in IL1403 (26). Colony PCR demonstrated that 100% of M1083s-opt, M1083s-opt::tetM, and M1083s-opt::abiD integrants were stable after 80 generations. Moreover, 100% of M1083s-opt::tetM integrants continued to be resistant to tetracycline and 100% of T942a integrants (within the tetM gene) were sensitive to tetracycline. Similarly, resistance to bacteriophage C2 in the M1083s-opt::abiD integrants remained stable for 80 generations, with no change in strain EOP before and after passage (EOP = 0.09). Thus, within lactococci, mutants obtained by group II intron invasion appear to be very stable, even when residing within expressed genes.

Complementation of intron splicing partially restores mleS activity.
Since invasion into the sense strand of mleS by M1083s-opt abolished gene function, restoration of intron splicing should result in restoration of mleS function. To examine this, the gene encoding LtrA was cloned into the nisin-inducible expression vector pMSP3535 and transformed into the M1083s-opt mutant strain, which had been cured of the original intron donor plasmid. RT-PCR on RNA purified from nisin-induced broth cultures of this transformant clearly demonstrated splicing of the M1083s-opt intron within mleS (Fig. 5, lane 2). Sequence analysis of the resultant RT-PCR product verified the correct ligation of mleS exons. Uninduced cultures also exhibited some spliced mleS mRNA product, indicating low-level expression of LtrA from the pMSP3535 vector in the absence of nisin (Fig. 5, lane 3). Expression of LtrA within the M1083s-opt mutant partially restored cellular malate decarboxylase levels in the induced culture to ~21% that of WT (Table 1).


arrow
DISCUSSION
 
This work demonstrates that retargeted group II introns can be used to generate chromosomal insertions within lactococci, bacteria employed in the production of numerous fermented dairy products (31). Three different retargeted introns were shown to efficiently invade chromosomal genes in L. lactis IL1403. Homing frequencies were extremely high, and integrants were readily identified by simple PCR screening, thereby eliminating the need for antibiotic marker selection to enrich for integrants. Given that no selection was employed to identify colonies with an integrated intron, the resultant colonies were nonclonal and subsequent segregation of clonal populations was necessary. The percentage of cells containing the intron varied within colonies, suggesting that the timing of the homing event during the growth of the colony influences the percentage of the population invaded. M1107s-opt appeared to have a lower homing efficiency compared to M1083s-opt and T942a, likely reflecting specific features of the target site or differences in optimal matches to the target sequence.

Cousineau et al. (5) previously demonstrated the Ll.ltrB intron can home with a 0.8-kb kanamycin resistance gene cloned into intron domain IV. In this work, tetM and abiD were separately delivered within the M1083s-opt intron. Invasion frequencies for both M1083s-opt::tetM and M1083s-opt::abiD introns were lower than that observed for the M1083s-opt intron, suggesting that heterologous DNA carriage within domain IV lowers homing frequencies. Surprisingly, different homing efficiencies were observed for M1083s-opt introns containing internal tetM (2-kb) or abiD (1.4-kb) genes, with the M1083opt::tetM intron integrating at a higher frequency. This suggests that the size and content of heterologous DNA delivered within domain IV of the intron can impact targeted homing efficiencies.

Directed intron homing in Lactococcus appears to be quite specific. M1083s-opt, its tetM derivative, and T942a integrated only into the specific chromosomal sites for which they had been targeted. Additionally, when expressed in L. lactis LM0230, which has a slightly different mleS target site, the M1083s-opt intron showed no detectable homing. The sequence polymorphisms in LM0230 result in intron RNA-DNA target site mismatch at position +1 and wobble base pairs (29) at positions -10 and -1, which have been shown previously to be required for efficient homing (Fig. 2) (10, 22).

We were surprised to find that the unoptimized M1107s and M1083s introns isolated in the E. coli-based selection could home efficiently in E. coli but not in L. lactis. Although these introns have several mismatches between their EBS sequences and IBS sequences in both the donor plasmid and DNA target site, it was observed previously that retargeted introns could function in E. coli and remain highly specific despite a small number of mismatches at some positions (9, 11). It is possible that expression from the T7lac promoter in the E. coli system is significantly higher than the cognate expression from the nisin-inducible promoter in lactococci, so that splicing and homing can occur despite mismatches. Alternatively, conditions in L. lactis may require more stringent base pairing for intron function. The difference does not present a problem for gene targeting, since base pairing is easily optimized for selected introns, and optimal base pairing is incorporated into a newly developed computer program for designing efficient retargeted introns, thereby avoiding the necessity for intron selection within E. coli (J. Perutka and A. M. Lambowitz, unpublished data).

All introns used in this study are {Delta}IEP intron variants. Invasion of M1083s-opt and M1107s-opt into the mleS gene effectively eliminated cellular malate decarboxylase activity (1.9% of WT), and T942a invasion into the antisense strand of the tetM gene resulted in sensitivity to tetracycline. RT-PCR analysis of RNA expressed from the mleS::M1083s-opt gene did not reveal any spliced products. M1083s-opt, its tetM and abiD derivatives, and T942a integrants were stable for 80 generations, suggesting that reversion to WT status, if occurring, is infrequent.

Splicing of mleS::M1083s-opt was achieved by providing the IEP (LtrA) in trans. Cellular levels of malate decarboxylase were restored to 21% of WT upon expression of LtrA from a nisin-inducible vector. The reduced level of complementation could be due to several factors. Foremost is that changes in tIBS-intron EBS pairings as well as surrounding mleS exon sequences may reduce the splicing efficiency relative to WT levels. In addition, separation of the IEP from the cognate intron-containing mRNA may impact effective RNP formation and function. Zhou et al. (35) complemented mutant Ll.ltrB variants by expressing LtrA in trans and observed these introns to be functioning at a 20-fold-lower level than that of WT. Our results are consistent with a general reduction in splicing efficiency when the intron IEP is supplied in trans. Lastly, LtrA has been found to down regulate itself by binding to its own ribosome binding site (28). This regulatory mechanism may impede full complementation of intron-integrated mleS.

The LAB have long been employed in the preservation of foodstuffs. In general, genetic improvement of LAB strains by recombinant methods promises to greatly enhance their efficacy in various arenas (23). Methods for performing targeted gene disruptions in the LAB predominately employ temperature-sensitive vectors where homology-driven integration into the chromosome is achieved at the higher, nonpermissive temperature (19). Unlike the intron method described here, these systems require larger stretches of target site homology (>500 bp) in addition to the need for selection to drive the integration event. Such conditionally replicative vector systems are often limited if the host strain does not grow (or grows poorly) at the nonpermissive temperature needed to drive the integration. This is true for many commercial strains of L. lactis subsp. cremoris, which do not grow well at 37°C (15). Thus, targeted invasion with the lactococcal group II intron, Ll.ltrB, provides an attractive alternative for chromosomal manipulation of lactococci, since no selection is needed to drive the integration event and conditionally replicative vectors are not needed. For food-grade delivery of novel traits, or insertional mutagenesis of a target gene, appropriately modified introns simply need to be expressed in a host cell and, upon invasion, the donor plasmid is cured. Rescripting of intron EBS sequences to accommodate donor IBS and target IBS base pairing allows virtually any genomic locus to be targeted. The ability to identify stable insertions in a specific gene without genetic selection eliminates the need for antibiotic markers, or even food-grade markers (6), to stabilize genetic insertions within lactococci. Given that homing of Ll.ltrB occurs efficiently in hosts as diverse as E. coli and L. lactis, it is likely that targeted intron mutagenesis will work in other food-grade LAB as well.


arrow
ACKNOWLEDGMENTS
 
This work was funded in part by the California Dairy Research Foundation (D.A.M.), scholarships from the American Society of Enology and Viticulture and the Wine Spectator (C.L.F.), and NIH grant GM37949 (A.M.L.).

Ralf Zink at Nestlé Inc. is acknowledged for helpful discussions and support.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Viticulture and Enology, University of California at Davis, 1 Shields Ave., Davis, CA 95616-8749. Phone: (530) 754-7821. Fax: (530) 752-0382. E-mail: damills{at}ucdavis.edu. Back


arrow
REFERENCES
 
    1
  1. Ansanay, V., S. Dequin, B. Blondin, and P. Barre. 1993. Cloning, sequence and expression of the gene encoding the malolactic enzyme from Lactococcus lactis. FEBS Lett. 332:74-80.[CrossRef][Medline]
    2. 2
  2. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1995. Current protocols in molecular biology. Wiley, New York, N.Y.
    3. 3
  3. Belfort, M., V. Derbyshire, M. M. Parker, B. Cousineau, and A. M. Lambowitz. 2002. Mobile introns: pathways and proteins, p. 761-783. In N. L. Craig, R. Craigie, M. Gellert, and A. M. Lambowitz (ed.), Mobile DNA II. ASM Press, Washington, D.C.
    4. 4
  4. Bryan, E. M., T. Bae, M. Kleerebezem, and G. M. Dunny. 2000. Improved vectors for nisin-controlled expression in gram-positive bacteria. Plasmid 44:183-190.[CrossRef][Medline]
    5. 5
  5. Cousineau, B., D. Smith, S. Lawrence-Cavanagh, J. E. Mueller, J. Yang, D. Mills, D. Manias, G. Dunny, A. M. Lambowitz, and M. Belfort. 1998. Retrohoming of a bacterial group II intron: mobility via complete reverse splicing, independent of homologous DNA recombination. Cell 94:451-462.[CrossRef][Medline]
    6. 6
  6. de Vos, W. M. 1999. Gene expression systems for lactic acid bacteria. Curr. Opin. Microbiol. 2:289-295.[CrossRef][Medline]
    7. 7
  7. Eskes, R., L. Liu, H. Ma, M. Y. Chao, L. Dickson, A. M. Lambowitz, and P. S. Perlman. 2000. Multiple homing pathways used by yeast mitochondrial group II introns. Mol. Cell. Biol. 20:8432-8446.[Abstract/Free Full Text]
    8. 8
  8. Eskes, R., J. Yang, A. M. Lambowitz, and P. S. Perlman. 1997. Mobility of yeast mitochondrial group II introns: engineering a new site specificity and retrohoming via full reverse splicing. Cell 88:865-874.[CrossRef][Medline]
    9. 9
  9. Guo, H., M. Karberg, M. Long, J. P. Jones, B. Sullenger, and A. M. Lambowitz. 2000. Group II introns designed to insert into therapeutically relevant DNA target sites in human cells. Science 289:452-457.[Abstract/Free Full Text]
    10. 10
  10. Guo, H., S. Zimmerly, P. S. Perlman, and A. M. Lambowitz. 1997. Group II intron endonucleases use both RNA and protein subunits for recognition of specific sequences in double-stranded DNA. EMBO J. 16:6835-6848.[CrossRef][Medline]
    11. 11
  11. Karberg, M., H. Guo, J. Zhong, R. Coon, J. Perutka, and A. M. Lambowitz. 2001. Group II introns as controllable gene targeting vectors for genetic manipulation of bacteria. Nat. Biotechnol. 19:1162-1167.[CrossRef][Medline]
    12. 12
  12. Konings, W. N., J. Kok, O. P. Kuipers, and B. Poolman. 2000. Lactic acid bacteria: the bugs of the new millennium. Curr. Opin. Microbiol. 3:276-282.[CrossRef][Medline]
    13. 13
  13. Konings, W. N., O. Kuipers, and J. H. J. Huis int Veld. 1999. Lactic acid bacteria: genetics, metabolism, and applications. Proceedings of the Sixth Symposium on Lactic Acid Bacteria: Genetics, Metabolism and Applications, 19 to 23 September 1999, Veldhoven, The Netherlands. Kluwer, Boston, Mass.
    14. 14
  14. Kunkee, R. E. 1991. Some roles of malic acid in the malolactic fermentation in wine making. FEMS Microbiol. Rev. 88:55-72.[CrossRef]
    15. 15
  15. Lowrie, R. J., R. C. Lawrence, L. E. Pearce, and E. L. Richards. 1972. Cheddar cheese flavor. III. The growth of lactic streptococci during cheesemaking and the effect on bitterness development. N. Z. J. Dairy Sci. Technol. 7:44-50.
    16. 16
  16. Matsuura, M., R. Saldanha, H. Ma, H. Wank, J. Yang, G. Mohr, S. Cavanagh, G. Dunny, M. Belfort, and A. Lambowitz. 1997. A bacterial group II intron encoding reverse transcriptase, maturase, and DNA endonuclease activities: insertion of new genetic information at a selected DNA target site. Genes Dev. 11:2910-2924.[Abstract/Free Full Text]
    17. 17
  17. McLandsborough, L. A., K. M. Kolaetis, T. Requena, and L. L. McKay. 1995. Cloning and characterization of the abortive infection genetic determinant abiD isolated from pBF61 of Lactococcus lactis subsp. lactis KR5. Appl. Environ. Microbiol. 61:2023-2026.[Abstract]
    18. 18
  18. Michel, F., and J.-L. Ferat. 1995. Structure and activities of group II introns. Annu. Rev. Biochem. 64:435-461.[CrossRef][Medline]
    19. 19
  19. Mills, D. A. 2001. Mutagenesis in the post genomics era: tools for generating insertional mutations in the lactic acid bacteria. Curr. Opin. Biotechnol. 12:503-509.[CrossRef][Medline]
    20. 20
  20. Mills, D. A., C. K. Choi, G. M. Dunny, and L. L. McKay. 1994. Genetic analysis of regions of the Lactococcus lactis subsp. lactis plasmid pRS01 involved in conjugative transfer. Appl. Environ. Microbiol. 60:4413-4420.[Abstract/Free Full Text]
    21. 21
  21. Mills, D. A., and M. C. Flickinger. 1993. Cloning and sequence analysis of the meso-diaminopimelate decarboxylase gene from Bacillus methanolicus MGA3 and comparison to other decarboxylase genes. Appl. Environ. Microbiol. 59:2927-2937.[Abstract/Free Full Text]
    22. 22
  22. Mohr, G., D. Smith, M. Belfort, and A. M. Lambowitz. 2000. Rules for DNA target-site recognition by a lactococcal group II intron enable retargeting of the intron to specific DNA sequences. Genes Dev. 14:559-573.[Abstract/Free Full Text]
    23. 23
  23. Mollet, B. 1999. Genetically improved starter strains: opportunities for the dairy industry. Int. Dairy J. 9:11-15.
    24. 24
  24. O'Sullivan, D. J., and T. R. Klaenhammer. 1993. Rapid mini-prep isolation of high-quality plasmid DNA from Lactococcus and Lactobacillus spp. Appl. Environ. Microbiol. 59:2730-2733.[Abstract/Free Full Text]
    25. 25
  25. Ramesh, A., P. M. Halami, and A. Chandrashekar. 2000. Ascorbic acid-induced loss of a pediocin-encoding plasmid in Pediococcus acidilactici CFR K7. World J. Microbiol. Biotechnol. 16:695-697.[CrossRef]
    26. 26
  26. Renault, P., C. Gaillardin, and H. Heslot. 1989. Product of the Lactococcus lactis gene required for malolactic fermentation is homologous to a family of positive regulators. J. Bacteriol. 171:3108-3114.[Abstract/Free Full Text]
    27. 27
  27. Singh, N. N., and A. M. Lambowitz. 2001. Interaction of a group II intron ribonucleoprotein endonuclease with its DNA target site investigated by DNA footprinting and modification interference. J. Mol. Biol. 309:361-386.[CrossRef][Medline]
    28. 28
  28. Singh, R. N., R. J. Saldanha, L. M. D'Souza, and A. M. Lambowitz. 2002. Binding of a group II intron-encoded reverse transcriptase/maturase to its high affinity intron RNA binding site involves sequence-specific recognition and autoregulates translation. J. Mol. Biol. 318:287-303.[CrossRef][Medline]
    29. 29
  29. Sugimoto, N., M. Nakano, and S.-I. Nakano. 2000. Thermodynamics-structure relationship of single mismatches in RNA/DNA duplexes. Biochemistry 39:11270-11281.[CrossRef][Medline]
    30. 30
  30. Terzaghi, B. E., and W. E. Sandine. 1975. Improved medium for lactic streptococci and their bacteriophages. Appl. Microbiol. 29:807-813.
    31. 31
  31. Teuber, M. 1995. The genus Lactococcus, p. 173-234. In B. J. B. Wood and W. H. Holzapfel (ed.), The genera of lactic acid bacteria. Blackie Academic & Professional, London, England.
    32. 32
  32. Wang, J., N. B. Shoemaker, G.-R. Wang, and A. A. Salyers. 2000. Characterization of a Bacteroides mobilizable transposon, NBU2, which carries a functional lincomycin resistance gene. J. Bacteriol. 182:3559-3571.[Abstract/Free Full Text]
    33. 33
  33. Wood, B. J. B., and W. H. Holzapfel. 1995. The genera of lactic acid bacteria. Blackie Academic & Professional, London, England.
    34. 34
  34. Yang, J., S. Zimmerly, P. S. Perlman, and A. M. Lambowitz. 1996. Efficient integration of an intron RNA into double-stranded DNA by reverse splicing. Nature 381:332-335.[CrossRef][Medline]
    35. 35
  35. Zhou, L., D. A. Manias, and G. M. Dunny. 2000. Regulation of intron function: efficient splicing in vivo of a bacterial group II intron requires a functional promoter within the intron. Mol. Microbiol. 37:639-651.[CrossRef][Medline]
    36. 36
  36. Zimmerly, S., H. Guo, R. Eskes, J. Yang, P. S. Perlman, and A. M. Lambowitz. 1995. A group II intron RNA is a catalytic component of a DNA endonuclease involved in intron mobility. Cell 83:529-538.[CrossRef][Medline]
    37. 37
  37. Zimmerly, S., H. Guo, P. S. Perlman, and A. M. Lambowitz. 1995. Group II intron mobility occurs by target DNA-primed reverse transcription. Cell 82:545-554.[CrossRef][Medline]

Applied and Environmental Microbiology, February 2003, p. 1121-1128, Vol. 69, No. 2
0099-2240/03/$08.00+0     DOI: 10.1128/AEM.69.2.1121-1128.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Zhuang, F., Karberg, M., Perutka, J., Lambowitz, A. M. (2009). EcI5, a group IIB intron with high retrohoming frequency: DNA target site recognition and use in gene targeting. RNA 15: 432-449 [Abstract] [Full Text]  
  • Zalewska-Piatek, B., Bury, K., Piatek, R., Bruzdziak, P., Kur, J. (2008). Type II Secretory Pathway for Surface Secretion of DraD Invasin from the Uropathogenic Escherichia coli Dr+ Strain. J. Bacteriol. 190: 5044-5056 [Abstract] [Full Text]  
  • Rodriguez, S. A., Yu, J.-J., Davis, G., Arulanandam, B. P., Klose, K. E. (2008). Targeted Inactivation of Francisella tularensis Genes by Group II Introns. Appl. Environ. Microbiol. 74: 2619-2626 [Abstract] [Full Text]  
  • Yao, J., Lambowitz, A. M. (2007). Gene Targeting in Gram-Negative Bacteria by Use of a Mobile Group II Intron ("Targetron") Expressed from a Broad-Host-Range Vector. Appl. Environ. Microbiol. 73: 2735-2743 [Abstract] [Full Text]  
  • Plante, I., Cousineau, B. (2006). Restriction for gene insertion within the Lactococcus lactis Ll.LtrB group II intron. RNA 12: 1980-1992 [Abstract] [Full Text]  
  • Rawsthorne, H., Turner, K. N., Mills, D. A. (2006). Multicopy Integration of Heterologous Genes, Using the Lactococcal Group II Intron Targeted to Bacterial Insertion Sequences. Appl. Environ. Microbiol. 72: 6088-6093 [Abstract] [Full Text]  
  • Yao, J., Zhong, J., Fang, Y., Geisinger, E., Novick, R. P., Lambowitz, A. M. (2006). Use of targetrons to disrupt essential and nonessential genes in Staphylococcus aureus reveals temperature sensitivity of Ll.LtrB group II intron splicing. RNA 12: 1271-1281 [Abstract] [Full Text]  
  • Chen, Y., McClane, B. A., Fisher, D. J., Rood, J. I., Gupta, P. (2005). Construction of an Alpha Toxin Gene Knockout Mutant of Clostridium perfringens Type A by Use of a Mobile Group II Intron. Appl. Environ. Microbiol. 71: 7542-7547 [Abstract] [Full Text]  
  • Yao, J., Zhong, J., Lambowitz, A. M. (2005). Gene targeting using randomly inserted group II introns (targetrons) recovered from an Escherichia coli gene disruption library. Nucleic Acids Res 33: 3351-3362 [Abstract] [Full Text]  
  • Zhong, J., Karberg, M., Lambowitz, A. M. (2003). Targeted and random bacterial gene disruption using a group II intron (targetron) vector containing a retrotransposition-activated selectable marker. Nucleic Acids Res 31: 1656-1664 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Frazier, C. L.
Right arrow Articles by Mills, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Frazier, C. L.
Right arrow Articles by Mills, D. A.
Agricola
Right arrow Articles by Frazier, C. L.
Right arrow Articles by Mills, D. A.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»