This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Choi, J. H.
Right arrow Articles by Lee, S. Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Choi, J. H.
Right arrow Articles by Lee, S. Y.
Agricola
Right arrow Articles by Choi, J. H.
Right arrow Articles by Lee, S. Y.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, August 2003, p. 4737-4742, Vol. 69, No. 8
0099-2240/03/$08.00+0     DOI: 10.1128/AEM.69.8.4737-4742.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Enhanced Production of Insulin-Like Growth Factor I Fusion Protein in Escherichia coli by Coexpression of the Down-Regulated Genes Identified by Transcriptome Profiling

Jong Hyun Choi,1 Sang Jun Lee,1,2 Seok Jae Lee,1 and Sang Yup Lee1,2,3*

Metabolic and Biomolecular Engineering National Research Laboratory, Department of Chemical and Biomolecular Engineering and BioProcess Engineering Research Center,1 Department of BioSystems and Bioinformatics Research Center,3 Center for Ultramicrochemical Process Systems, Korea Advanced Institute of Science and Technology, Yuseong-gu, Daejeon 305-701, Korea2

Received 10 March 2003/ Accepted 10 June 2003


arrow
ABSTRACT
 
The transcriptome profiles of recombinant Escherichia coli producing human insulin-like growth factor I fusion protein (IGF-If) during the high-cell-density fed-batch culture were analyzed using DNA microarrays. The expression levels of 529 genes were significantly altered after induction. About 200 genes were significantly down-regulated during the production of IGF-If after induction. Among these down-regulated genes, we rationally selected and coexpressed in E. coli producing IGF-If the prsA gene (encoding a phosphoribosyl pyrophosphate synthetase) and the glpF gene (encoding a glycerol transporter), which are involved in an early key step in the biosynthetic pathway of nucleotides and amino acids (Trp and His) and the first step in glycerol utilization, respectively. As a result, the production of IGF-If could be increased from 1.8 ± 0.13 (± standard deviation) to 4.3 ± 0.24 g/liter. The volumetric productivity was also increased from 0.36 ± 0.027 to 0.82 ± 0.048 g/liter/h. These results demonstrate that transcriptome profiling can provide invaluable information in designing engineered strains showing enhanced performance.


arrow
INTRODUCTION
 
Escherichia coli has been the workhorse for the production of recombinant proteins (7, 20). Various strategies have been employed for the development of E. coli strains which are able to efficiently produce recombinant proteins (14). Once a recombinant host strain is developed, a high level of production of recombinant proteins is generally achieved by high-cell-density fed-batch cultivation (13).

It has been well known that the overproduction of recombinant proteins acts as a stress on the cells, resulting in induction of stress-responsive genes such as dnaK, groEL, ibpA, ibpB, and ompT (10, 17). Furthermore, the yield and specific productivity of recombinant proteins obtained by high-cell-density culture are generally lower than those obtained by flask cultures (9, 21). Since these problems are caused by unknown complex metabolic events, systematic understanding of the physiology and metabolism altered during the fed-batch culture of recombinant E. coli, especially those altered before and after induction, is essential to develop strategies for solving these problems. Transcriptome analysis employing high-density DNA microarrays is well suited for the elucidation of global physiological and metabolic changes. However, most microarray-based studies of transcriptome profiling in E. coli have been carried out in flask cultures (18, 19). In flask cultures, cells grow to a relatively low density, and the growth environment is continuously changing. Therefore, the results of transcriptome profiling obtained in flask cultures cannot be extended to high-cell-density fed-batch cultures, which are industrially relevant processes.

Recently, combined transcriptome and proteome analysis of E. coli during high-cell-density culture was reported (21). The expression of many genes including those of tricarboxylic acid cycle enzymes, NADH dehydrogenase, and ATPase was up-regulated during the exponential fed-batch period and was down-regulated afterwards. Interestingly, the expression of most amino acid biosynthesis genes was down-regulated as the cell density increased (21).

In this study, we extended our previous work and applied transcriptome profiling to understand physiological changes of recombinant E. coli producing human insulin-like growth factor I fusion protein (IGF-If) during the high-cell-density fed-batch culture. We were able to rationally select two down-regulated genes after induction and subsequently used them to develop engineered strains that were capable of enhanced production of IGF-If.


arrow
MATERIALS AND METHODS
 
Bacterial strains and plasmids.
The bacterial strains and plasmids used in this study are listed in Table 1. E. coli XL1-Blue was used as a host strain for general cloning works. Recombinant E. coli W3110 harboring pYKM-I1 was used for the production of IGF-If, which is human insulin-like growth factor I fused to the truncated ß-galactosidase (11).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Bacterial strains and plasmids used in this study

DNA manipulation.
PCR was performed with a PCR Thermal Cycler MP TP3000 (Takara Shuzo, Kyoto, Japan) with High Fidelity PCR Master mix (Roche, Indianapolis, Ind.). All DNA manipulations were carried out as described in the work of Sambrook et al. (16). To construct an expression vector containing the lac promoter, PCR was performed using pUC19 as a template and oligonucleotide primers 5'-GGAATTCCATATGTGTTTCCTGTGTGAAATTGTT and 5'-TGCTCACATGTTCTTTCCTG, which contain NdeI and AflIII sites (underlined), respectively. The NdeI- and AflIII-digested PCR product was cloned into the NdeI-AflIII-digested pET3a to make pJHlac. The E. coli prsA gene, which encodes phosphoribosyl pyrophosphate synthetase (315 amino acids), was amplified using the chromosomal DNA of E. coli W3110 as a template. The primers used were 5'-GATAGATATCCTGCAGGTCGACCCAAGCGGACATCACCATCATCACCAT and 5'-CCAAGGATCCGATATCCTCGAGACCAGAATGGTGATGATGGTGATG, which contain NdeI and BamHI restriction sites (underlined), respectively. The NdeI- and BamHI-digested PCR product was cloned into the NdeI-BamHI-digested pJHlac. The resulting plasmid pJHlac-prsA was used as a template for the amplification of lac promoter plus the prsA gene with oligonucleotide primers 5'-GATAGTCTAGAATATCCTGCAGGTCGACCCAAGCGGACATCACCATCATCACCAT and 5'-CCGGATCCAACTGCAGGATATCCTCGAGACCAGAATGGTGATGATGGTGATG, which contain XbaI and BamHI restriction sites (underlined), respectively. The XbaI- and BamHI-digested PCR product was cloned into the XbaI-BamHI-digested pACYC184 to make pJHlacL-prsA (Fig. 1A), which is compatible with the IGF-If expression plasmid pYKM-I1. In order to construct a plasmid carrying both the prsA and glpF genes, the glpF gene, which encodes glycerol transporter (291 amino acids), was amplified using the chromosomal DNA of E. coli W3110 as a template. The oligonucleotide primers used were 5'-CGGGATCCAGAAGGAGATATACATATGAGTCAAACATCAACCTTG and 5'-CTG CAGAACGGCCGTTACAGCGAAGCTTTTTGTTC, which contain BamHI and EagI sites (underlined), respectively. The BamHI- and EagI-digested PCR product was cloned into the BamHI-EagI-digested pJHlacL-prsA to make pJHlacL-prsAglpF (Fig. 1B).



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 1. Schematic drawing of plasmids pJHlacL-prsA (A) and pJHlacL-prsAglpF (B). The plasmids are compatible with IGF-If expression plasmid pYKM-I1. Both the glpF and prsA genes are under the control of the lac promoter, which can be induced by IPTG.

Fed-batch cultures.
Fed-batch cultures were carried out at 37°C in a 6.6-liter-jar fermentor (Bioflo 3000; New Brunswick Scientific Co., Edison, N.J.) containing 2 liters of R/2 medium (9) supplemented with 20 g of glycerol/liter and 2 g of yeast extract/liter. The seed culture of E. coli W3110 harboring pYKM-I1 was prepared in a 1-liter flask containing the same medium (0.2 liters) at 37°C and 200 rpm in a shaking incubator and transferred into the fermentor. Culture pH was controlled at 6.8, except for the periods of nutrient feeding (see below), by the addition of 28% (vol/vol) ammonia solution. The dissolved oxygen concentration was controlled at 40% of air saturation by automatically increasing the agitation speed up to 1,000 rpm and by changing the pure oxygen percentage. Nutrient feeding solution containing 500 g of glycerol/liter, 50 g of yeast extract/liter, and 15 g of MgSO4 · 7H2O/liter was added by the pH-stat feeding strategy (2). When the pH rose to a value greater by 0.05 than that of its set point (6.8) due to the depletion of glycerol, an appropriate volume of feeding solution was automatically added to increase the glycerol concentration in the culture broth to 0.5 g/liter. Expression of the IGF-If gene was induced when the cell concentration reached 14 g (dry cell weight [DCW]) per liter by the addition of isopropyl-ß-D-thiogalactopyranoside (IPTG; Sigma Chemical Co., St. Louis, Mo.) to give the final 1 mM concentration. Ampicillin and chloramphenicol were added in the initial medium to concentrations of 15 and 50 mg/liter, respectively, depending on the plasmids employed (Table 1). Fed-batch cultures were carried out in duplicates.

Analytical methods.
During the fed-batch cultivation, cell growth was monitored by measuring the absorbance at 600 nm (optical density at 600 nm; DU Series 600 spectrophotometer; Beckman, Fullerton, Calif.). DCW (grams per liter) was determined as described previously (1). Protein samples were analyzed by electrophoresis on a sodium dodecyl sulfate-12% (wt/vol) polyacrylamide gel (12). The protein bands were visualized with Coomassie brilliant blue R-250 stain (Bio-Rad Laboratories, Hercules, Calif.). The contents of IGF-If in total protein were quantified with a GS710 calibrated imaging densitometer (Bio-Rad). The total protein concentration was determined with a protein assay kit (Bio-Rad) with bovine serum albumin as a standard.

Microarray experiments.
We used the Panorama E. coli gene array (Sigma-Genosys, Inc., Woodlands, Tex.), which contains all the open reading frames in the E. coli chromosome. To make hybridization probes for the E. coli DNA microarray, total RNA was isolated from the culture by using the Qiagen RNeasy columns (Valencia, Calif.). The purified RNA (1 µg) was mixed with random hexamer primers for cDNA labeling reaction, which was performed using 50 U of avian myeloblastosis virus reverse transcriptase (Roche, Basel, Switzerland) and 20 µCi of [{alpha}-33P]dCTP (2,000 to 3,000 Ci/mmol; New England Nuclear, Boston, Mass.) as recommended by Sigma-Genosys, Inc. The cDNA labeling reaction mixture (30 µl) containing 0.5 mM (each) dATP, dGTP, and dTTP and 10 mM dithiothreitol was incubated for 3 h at 42°C. Unincorporated nucleotides were removed by gel filtration through a G-25 Sephadex column (Amersham Biosciences, Piscataway, N.J.).

The Panorama E. coli gene array (Sigma-Genosys) was hybridized with labeled cDNA concentrates plus 0.8 mg of salmon sperm DNA per ml (Amersham Biosciences). Prior to hybridization, the solution was boiled for 10 min and then cooled to room temperature. After hybridization for 18 h at 65°C, the Panorama membrane was washed with 0.5x SSPE solution (0.09 M NaCl, 5 mM NaH2PO4, and 0.5 mM EDTA [pH 7.7]) and subsequently rinsed with 0.5x SSPE at 65°C for 20 min. The Panorama membrane was scanned with a BAS 1500 (Fuji, Tokyo, Japan) instrument with a pixel size of 100 µm. The signal intensities and local background were determined by Array Vision (Imaging Research Inc., St. Catharines, Ontario, Canada). DNA microarray experiments were carried out in duplicate. Also, the Panorama E. coli gene array contains duplicate spots for each gene. Therefore, a total of four measurements were made for each gene. Raw array data from each experimental replicate were exported from Array Vision into MS Excel for further analysis. The raw data values were normalized and selected as described previously (4). We could select 529 genes that were significantly up- or down-regulated by a value greater than 3 standard deviations of the mean of the log ratios for all genes (99.9% confidence) and those that had a P value greater than 0.05% (95% probability that the ratio is significant).


arrow
RESULTS AND DISCUSSION
 
Transcriptome analysis of recombinant E. coli producing IGF-If fusion proteins.
Fed-batch culture of recombinant E. coli W3110 (pYKM-I1) was carried out using glycerol as a carbon source, because it resulted in better production of IGF-If than did glucose (3). The time profiles of cell concentration, IGF-If concentration, and IGF-If content are shown in Fig. 2A. The specific growth rate during the exponential growth was 0.23 h-1. The maximum cell concentration of 48.9 ± 2.93 (± standard deviation) g (DCW)/liter was obtained in 18 h. The concentration of IGF-If steadily increased to reach 1.8 ± 0.13 g/liter at 5 h after induction and then slightly decreased towards the end of cultivation. The IGF-If content reached the maximum value of 9.5% of total proteins at 2 h after induction. The volumetric productivity of IGF-If was 0.36 ± 0.027 g/liter/h. These values are rather low for the recombinant proteins produced by fed-batch culture of E. coli (13). Therefore, we decided to identify limiting metabolic enzymes during the IGF-If production by transcriptome profiling. For the analysis and comparison of transcriptomes, fermentation samples were taken before IPTG induction and at 6 h after induction and were analyzed by hybridizing the prepared cDNA of these samples to the Panorama E. coli gene array containing 4,290 open reading frames of E. coli. The calculation of log expression ratios allowed pairwise comparison of relative transcript levels of all genes. Out of 4,290 open reading frames, 529 genes showing significant variations in the gene expression level were identified. Among them, we selected 50 genes that are well characterized and associated with metabolic pathways of interest (Tables 2 and 3).



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 2. Time profiles of cell density (optical density at 600 nm [•]), DCW (grams per liter [{blacksquare}]), IGF-If concentration (grams per liter [{circ}]), and IGF-If content (percentage of total proteins [{square}]) during the fed-batch cultures of E. coli W3110 harboring pYKM-I1 (A), E. coli W3110 harboring pYKM-I1 and pJHlacL-prsA (B), and E. coli W3110 harboring pYKM-I1 and pJHlacL-prsAglpF (C). Vertical dashed lines indicate the time point of induction with 1 mM IPTG. The arrows in panel A are the sampling points for transcriptome analyses.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Selected genes that are up-regulated after IPTG induction


View this table:
[in this window]
[in a new window]
 
TABLE 3. Selected genes that are down-regulated after IPTG induction

First, it was notable that the genes associated with protein biosynthetic apparatus, rplQT, rpmB, and rpsS (encoding ribosomal proteins), were considerably down-regulated after IPTG induction. However, the expression of the rrn operons encoding rRNAs was not changed. The expression of the rrnD genes (yhdZ and yhdW) encoding another 5S rRNA was highly up-regulated. These results suggested that protein synthesis could be negatively affected by the ribosome dysfunction which is caused by the lack of ribosomal proteins, rather than rRNAs.

Second, the expression of the genes associated with the biosynthesis of nucleotides and amino acids was down-regulated. For example, the expression of the metL gene was most significantly down-regulated after induction (Table 3). It is interesting that the expression of the metB gene, which forms an operon with the metL gene, was also significantly down-regulated after induction. This suggests the existence of good correlation between the metBL operon structure and the transcript levels of the metB and metL genes. In addition, the expression of the genes in the biosynthetic pathways of serine, cysteine, glutamate, glutamine, arginine, aspartate, threonine, isoleucine, valine, and histidine was slightly down-regulated. It was notable that the expression of the prsA gene was severely down-regulated (>2.7-fold). Ribose-phosphate pyrophosphokinase encoded by the prsA gene is involved in the first step for the biosynthesis of purine, pyrimidine, and nicotinamide nucleotides and for the biosynthesis of histidine and tryptophan. Therefore, it was reasoned that nucleic and amino acid depletion may become a bottleneck in protein production during the high-cell-density fed-batch culture of recombinant E. coli.

Third, in the energy and carbon metabolism, the genes in the tricarboxylic acid cycle showed a relatively constant expression level, while the expression of the genes in the glycolytic pathway, such as gapA, eno, and tpiA, was up-regulated. In this work, glycerol was used as a carbon source, because it allowed production of more IGF-If than glucose did in a previous study (3). The growth rate with glycerol is about 74% of that achievable with glucose (8). It was notable that the expression of the glpF gene encoding a glycerol transporter was significantly down-regulated (>2.2-fold) after induction. Therefore, it was thought that the reduced transport of glycerol might have become a limiting factor for the production of IGF-If.

Among the other genes that showed altered expression levels, but less-than-twofold changes, were stress-responsive genes including dnaK, ibpA, and ibpB. They were up-regulated by 1.6-, 1.6-, and 1.8-fold, respectively, which has been a well-known phenomenon during recombinant protein production (5, 6, 10). However, the expression level of the groEL gene was not changed. Moreover, the expression of the ompT gene was significantly down-regulated (Table 3), coinciding with results previously reported (21).

Effect of prsA coexpression on IGF-If production.
Among the down-regulated genes, we selected the prsA gene as the first candidate for amplification, as its product ribose-phosphate pyrophosphokinase is a key enzyme for the biosynthesis of nucleic acids and amino acids. The 5-phosphoribosyl-1-pyrophosphate (PRPP) produced by PrsA is of importance for the biosynthesis of purine, pyrimidine, and nicotinamide nucleotides and of histidine and tryptophan. Since the expression level of the prsA gene was significantly decreased after induction, PRPP might be limiting. Therefore, it was reasoned that increasing the level of PrsA would result in the sufficient supply of PRPP for synthesis of purine, pyrimidine, and amino acids and consequently increase the protein production during high-cell-density culture. The effect of the prsA gene coexpression on IGF-If production was investigated by carrying out the pH-stat fed-batch culture of E. coli W3110 harboring pYKM-I1 and pJHlacL-prsA (Fig. 2B). The specific growth rate during the exponential phase was 0.16 h-1, which is lower than that of W3110 harboring pYKM-I1 only. The maximum cell concentration of 34.2 ± 2.12 (± standard deviation) g (DCW)/liter was obtained in 24 h. The IGF-If content reached 22% of total protein at 5 h after IPTG induction, which is 2.3 times higher than that obtained without the coexpression of the prsA gene, and then was maintained constantly afterwards. The IGF-If concentration reached a maximum value of 3.6 ± 0.19 g/liter at 12 h after induction. The volumetric productivity of IGF-If was 0.64 ± 0.034 g/liter/h, which is 1.8 times higher than that obtained with W3110 harboring pYKM-I1 only. Therefore, the coexpression of the prsA gene resulted in the increase of recombinant protein production, possibly by increasing the metabolic fluxes towards the biosynthesis of nucleic acids and amino acids. However, the growth rate was lower than that of E. coli W3110 harboring pYKM-I1 only.

Enhancement of volumetric productivity of IGF-If by the coexpression of prsA and glpF genes.
To further enhance the volumetric productivity of IGF-If, we decided to develop a strategy for restoring the growth rate of W3110 harboring pYKM-I1 and pJHlacL-prsA to a value close to that of W3110 harboring pYKM-I1 only. In this study, glycerol was used as a carbon source for the production of recombinant IGF-If. Unlike other carbohydrates, glycerol enters the cytoplasm by facilitated diffusion across the cytoplasmic membrane by use of the facilitator protein GlpF. The expression level of the glpF gene was significantly decreased after induction (Table 3). It means that the cell's ability to transport glycerol is significantly decreased after induction. In order to increase glycerol transport, the E. coli glpF gene was coexpressed in E. coli W3110 harboring pYKM-I1. Both the glpF and prsA genes were coexpressed in E. coli W3110 harboring pYKM-I1. The pH-stat fed-batch culture of E. coli W3110 harboring pYKM-I1 and pJHlacL-prsAglpF was then carried out (Fig. 2C). The specific growth rate was 0.22 h-1, which is similar to that of W3110 harboring pYKM-I1 only. The maximum cell concentration of 46.2 ± 2.53 (± standard deviation) g (DCW)/liter was obtained in 20 h. The IGF-If content reached 19.4% of total protein at 5 h after IPTG induction. The IGF-If concentration increased to 4.3 ± 0.24 g/liter at 8 h after induction. The volumetric productivity of IGF-If of 0.82 ± 0.048 g/liter/h was obtained at 6 h after induction, which is 2.3 and 1.3 times higher than those obtained with W3110 harboring pYKM-I1 only and W3110 harboring pYKM-I1 plus pJHlacL-prsA, respectively. The sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis clearly shows the improvement of IGF-If production by the coexpression of the prsA and glpF genes (Fig. 3). To examine the effect of GlpF on the productivity of IGF-If, the glpF gene alone was coexpressed in E, coli W3110 harboring pYKM-I1. In this case, the level of IGF-If was not increased, but the specific growth rate was increased (data not shown). Therefore, the increased level of GlpF is responsible for better growth of recombinant E. coli producing IGF-If.



View larger version (66K):
[in this window]
[in a new window]
 
FIG. 3. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of total proteins of recombinant E. coli W3110 harboring pYKM-I1 (A) and W3110 harboring pYKM-I1 and pJHlacL-prsAglpF (B). Lanes: M, molecular mass markers; 1, proteins prepared before induction; 2 to 7, 1 to 6 h after IPTG induction, respectively. The arrowsindicate recombinant IGF-If.

Transcriptome profiling has recently been widely applied to understand the global physiological changes caused by environmental and/or genetic changes (15, 19). The target genes to be overexpressed or possibly deleted for the achievement of a desired goal can be rationally selected based on the transcriptome profiling results. This approach, as successfully demonstrated in this study, should prove invaluable in designing engineered microorganisms capable of better performance.


arrow
ACKNOWLEDGMENTS
 
This work was supported by the Basic Industrial Research Project of the Korean Ministry of Commerce, Industry and Energy (MOCIE) and by the Center for Ultramicrochemical Process Systems. Further support from LG Life Sciences Ltd., Samchully Pharmaceutical Co. Ltd., and BioLeaders Co. is also appreciated. Hardware for computational analysis was supported by the IBM Shared University Research Program.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Chemical and Biomolecular Engineering, Korea Advanced Institute of Science and Technology, 373-1 Guseong-dong, Yuseong-gu, Daejeon 305-701, Korea. Phone: 82-42-869-3930. Fax: 82-42-869-8800. E-mail: leesy{at}kaist.ac.kr. Back


arrow
REFERENCES
 
    1
  1. Choi, J., S. Y. Lee, K. Shin, W. G. Lee, S. J. Park, H. N. Chang, and Y. K. Chang. 2002. Pilot scale production of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) by fed-batch culture of recombinant Escherichia coli. Biotechnol. Bioprocess Eng. 7:1-4.
  2. 2
  3. Choi, J. H., K. J. Jeong, S. C. Kim, and S. Y. Lee. 2000. Efficient secretory production of alkaline phosphatase by high cell density culture of recombinant Escherichia coli using the Bacillus sp. endoxylanase signal sequence. Appl. Microbiol. Biotechnol. 53:640-645.[Medline]
  4. 3
  5. Chung, B. H., Y. J. Choi, S. H. Yoon, S. Y. Lee, and Y. I. Lee. 2000. Process development for production of recombinant human insulin-like growth factor-I in Escherichia coli. J. Ind. Microbiol. Biotechnol. 24:94-99.[CrossRef]
  6. 4
  7. Conway, T., B. Kraus, D. L. Tucker, D. J. Smalley, A. F. Dorman, and L. McKibben. 2001. DNA array analysis in a Windows-PC environment. BioTechniques 32:110-119.
  8. 5
  9. Gill, R. T., M. P. DeLisa, J. J. Valdes, and W. E. Bentley. 2001. Genomic analysis of high-cell-density recombinant Escherichia coli fermentation and cell conditioning for improved recombinant protein yield. Biotechnol. Bioeng. 72:85-95.[Medline]
  10. 6
  11. Gill, R. T., J. J. Valdes, and W. E. Bentley. 2000. A comparative study of global stress gene regulation in response to overexpression of recombinant proteins in Escherichia coli. Metab. Eng. 2:178-189.[CrossRef][Medline]
  12. 7
  13. Hockney, R. C. 1994. Recent developments in heterologous protein production in Escherichia coli. Trends Biotechnol. 12:456-463.[CrossRef][Medline]
  14. 8
  15. Holms, H. 1996. Flux analysis and control of the central metabolic pathways in Escherichia coli. FEMS Microbiol. Rev. 19:85-116.[CrossRef][Medline]
  16. 9
  17. Jeong, K. J., and S. Y. Lee. 1999. High-level production of human leptin by fed-batch cultivation of recombinant Escherichia coli and its purification. Appl. Environ. Microbiol. 65:3027-3032.[Abstract/Free Full Text]
  18. 10
  19. Jurgen, B., H. Y. Lin, S. Riemschneider, C. Scharf, P. Neubauer, R. Schmid, M. Hecker, and T. Schweder. 2000. Monitoring of genes that respond to overproduction of an insoluble recombinant protein in Escherichia coli glucose-limited fed-batch fermentations. Biotechnol. Bioeng. 70:217-224.[CrossRef][Medline]
  20. 11
  21. Kim, S. O., and Y. I. Lee. 1996. High-level expression and simple purification of recombinant human insulin-like growth factor I. J. Biotechnol. 48:97-105.
  22. 12
  23. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.[CrossRef][Medline]
  24. 13
  25. Lee, S. Y. 1996. High cell-density culture of Escherichia coli. Trends Biotechnol. 14:98-105.[CrossRef][Medline]
  26. 14
  27. Makrides, S. C. 1996. Strategies for achieving high-level expression of genes in Escherichia coli. Microbiol. Rev. 60:512-538.[Abstract/Free Full Text]
  28. 15
  29. Richmond, C. S., J. D. Glasner, R. Mau, H. Jin, and F. R. Blattner. 1999. Genome-wide expression profiling in Escherichia coli K-12. Nucleic Acids Res. 27:3821-3835.[Abstract/Free Full Text]
  30. 16
  31. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
  32. 17
  33. Schweder, T., H. Y. Lin, B. Jurgen, A. Breitenstein, S. Riemschneider, V. Khalameyzer, A. Gupta, K. Buttner, and P. Neubauer. 2002. Role of the general stress response during strong overexpression of a heterologous gene in Escherichia coli. Appl. Microbiol. Biotechnol. 58:330-337.[CrossRef][Medline]
  34. 18
  35. Tao, H., C. Bausch, C. Richmond, F. R. Blattner, and T. Conway. 1999. Functional genomics: expression analysis of Escherichia coli growing on minimal and rich media. J. Bacteriol. 181:6425-6440.[Abstract/Free Full Text]
  36. 19
  37. Wei, Y., J. M. Lee, C. Richmond, F. R. Blattner, J. A. Rafalski, and R. A. LaRossa. 2001. High-density microarray-mediated gene expression profiling of Escherichia coli. J. Bacteriol. 183:545-556.[Abstract/Free Full Text]
  38. 20
  39. Weickert, M. J., D. H. Doherty, E. A. Best, and P. O. Olins. 1996. Optimization of heterologous protein production in Escherichia coli. Curr. Opin. Biotechnol. 7:494-499.[CrossRef][Medline]
  40. 21
  41. Yoon, S. H., M. J. Han, S. Y. Lee, K. J. Jeong, and J. S. Yoo. 2003. Combined transcriptome and proteome analysis of Escherichia coli during high cell density culture. Biotechnol. Bioeng. 81:753-767.[CrossRef][Medline]


Applied and Environmental Microbiology, August 2003, p. 4737-4742, Vol. 69, No. 8
0099-2240/03/$08.00+0     DOI: 10.1128/AEM.69.8.4737-4742.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Wierckx, N. J. P., Ballerstedt, H., de Bont, J. A. M., de Winde, J. H., Ruijssenaars, H. J., Wery, J. (2008). Transcriptome Analysis of a Phenol-Producing Pseudomonas putida S12 Construct: Genetic and Physiological Basis for Improved Production. J. Bacteriol. 190: 2822-2830 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Choi, J. H.
Right arrow Articles by Lee, S. Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Choi, J. H.
Right arrow Articles by Lee, S. Y.
Agricola
Right arrow Articles by Choi, J. H.
Right arrow Articles by Lee, S. Y.