Previous Article | Next Article 
Applied and Environmental Microbiology, September 2003, p. 5716-5721, Vol. 69, No. 9
0099-2240/03/$08.00+0 DOI: 10.1128/AEM.69.9.5716-5721.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Dispersal and Phylogenetic Diversity of Nonmarine Picocyanobacteria, Inferred from 16S rRNA Gene and cpcBA-Intergenic Spacer Sequence Analyses
Nicholas D. Crosbie,* Matthias Pöckl, and Thomas Weisse
Institute for Limnology, Austrian Academy of Sciences, A-5310 Mondsee, Austria
Received 9 April 2003/
Accepted 27 June 2003

ABSTRACT
More than 20
Synechococcus and
Cyanobium isolates were obtained
from central European subalpine lakes and sequenced for their
16S rRNA gene and part of the phycocyanin operon (
cpc), specifically
the intergenic spacer (IGS) between
cpcB and
cpcA, and corresponding
flanking regions (
cpcBA-IGS). Maximum-likelihood analyses revealed
the existence of at least six to seven clusters of nonmarine
picocyanobacteria within the picophytoplankton clade and support
the conjecture of global dispersal for some closely related
picocyanobacterial genotypes.

INTRODUCTION
Due to their significance for global biogeochemical cycling,
recent research has focused on deciphering the genotypic and
phenotypic diversity of marine picocyanobacteria (
17,
30,
38).
Comparatively sparse information is available on the dispersal
and diversity of freshwater picocyanobacteria, although their
genotypic differences and ecological significance have been
studied in great detail for some lakes (
4,
35). Recently, Ernst
et al. (
10) suggested that strain clusters belonging to the
nonmarine branch of the picophytoplankton clade sensu Urbach
et al. (
38) have undergone ecosystem-dependent adaptive radiations
within several brackish, freshwater and saline (Antarctic) lake
environments. This conclusion is an apparent contradiction of
the common conjecture that many free-living microbial species
have a global distribution because their small size and great
abundance result in dispersal which is rarely (if ever) restricted
by geographical boundaries (
13,
14). This argument has been
known for a long time and is commonly referred to as the "everything
is everywhere" hypothesis (
2).
It is at present difficult to test this hypothesis for picocyanobacteria, because the genetics and ecophysiology of most picocyanobacteria remain poorly understood, and, furthermore, there is often no simple correlation between genotypic and phenotypic diversity (10). The phylogenetic analysis of Ernst and colleagues (10) and their inferences on dispersal and evolution of freshwater picocyanobacteria were derived from a limited number of strains.
Based upon a refined analysis originating from a larger database (with >20 new rRNA gene sequences), we show that some closely related forms are widely dispersed and that taxon undersampling may have resulted in premature phylogenetic inferences in the analysis of Ernst et al. (10). The implications of our findings are discussed in relation to the description of (microbial) ecotypes adapted to environments where the potential for widespread dispersal is high.

Source, isolation, and maintenance of cultures.
To avoid culture bias resulting from the use of standard plating
techniquesthese may favor the isolation of, e.g., phycocyanin-rich
strains (
9), which comprise a small fraction of picocyanobacteria
inhabiting subalpine lakes (
42)we used single-cell sorting
(MW isolates [
7]) and the dilution culture technique (MH isolates)
to obtain isolates from the surface 20-m water column of the
oligo-mesotrophic lakes Mondsee and Hallstättersee, both
deep subalpine lakes located in Upper Austria. The nonaxenic
isolates were maintained in BG11 (
34) at 15°C and under
low light (white light, 10 µmol quanta m
-2 s
-1, continuously
supplied by Osram "cool-white" fluorescent tubes) (henceforth
referred to as standard culture conditions).

Assignment to pigment groups.
A Zeiss Axioplan microscope was used to differentiate phycoerythrin
(PE)- and phycocyanin (PC)-rich isolates based upon their epifluorescent
characteristics under blue (Zeiss filter set 05) and green excitation
(Zeiss filter set 14) (
21,
43) in comparison to the reference
strains BO 8801, BO 8807, and BO 8809 (
11), grown under standard
culture conditions. PE-rich isolates were characterized by their
orange-red fluorescence under green excitation and their yellow-orange
fluorescence under blue excitation. PC-rich isolates appeared
purple-red or red at both green and blue excitation.

DNA isolation, PCR amplification, and sequencing.
Near-full-length 16S rRNA gene sequences were determined for
21
Synechococcus and
Cyanobium isolates sensu Castenholtz (
5).
The less conserved intergenic spacer (IGS) between
cpcB and
cpcA, and corresponding flanking regions (henceforth referred
to as
cpcBA-IGS)
, were sequenced for 25
Synechococcus and
Cyanobium isolates. These gene sequences have been targeted in previous
phylogenetic studies of picocyanobacteria (
29).
DNA was extracted from 10 ml of culture material using the FastDNA kit and FastPrep instrument (Bio 101). 16S rRNA gene and cpcBA-IGS sequences were amplified using cyanobacterium-specific primer pairs, 16S5'F (AGAGTTTGATCCTGGCTCAG) and B23S5'R (CTTCGCCTCTGTGTGCCTAGGT) (19, 32) and cpcBF(UFP) (TAGTGTAAAACGACGGCCAGTTGYYTKCGCGACATGGA) and cpcAR(URP) (TAGCAGGAAACAGCTATGACGTGGTGTARGGGAAYTT) (29), respectively. PCRs were done in 25-µl volumes, with final concentrations of reactants as follows: for the 16S rRNA gene PCR, 0.2 mM (each) deoxynucleoside triphosphate, 0.4 µM (each) primer, ca. 100 ng of template DNA, 1 mg of bovine serum albumin ml-1, 1.5 mM MgSO4, and 0.4 to 0.8 U of high-fidelity SuperTaq (Ambion) polymerase; for the cpcBA-IGS PCR, 0.3 mM (each) deoxynucleoside triphosphate, 0.5 µM (each) primer, 10 to 100 ng of template DNA, 2.5 mM MgCl2, and 0.5 U of Taq (Qiagen) polymerase. Cycling parameters are given in the work of Scheldeman et al. (32) (for 16S rRNA gene PCR) and Robertson et al. (29) (for cpcBA-IGS PCR). PCRs were performed in multiples, and products were pooled, purified using the QIAquick PCR purificaton kit (Qiagen), and then sequenced (VBC Genomics) bidirectionally.

Sequence alignment and phylogenetic analyses.
CLUSTALX (
37) and the ARB (
http://www.arb-home.de) automatic
alignment tool (Fast Aligner, version 1.03) were used to produce
working alignments of the
cpcBA-IGS and 16S rRNA gene sequences,
respectively. The final alignments were obtained by manual refinement,
taking into account structural constraints (16S rRNA gene sequences:
secondary structure models available from the Comparative RNA
Web Site (
http://www.rna.icmb.utexas.edu);
cpcBA-IGS sequences:
amino acid alignment given as Table 23 in the supplement to
Bickel et al. (
3). After the removal of hypervariable (50% conservation
filter implemented in ARB using the filter by base frequency
function; see Ludwig and Klenk [
20] for a discussion on the
use of filters in phylogenetic analysis) and other potentially
misleading sites, the alignments used in phylogenetic analyses
consisted of 1,383 (16S rRNA gene sequences) and 362 (
cpcBA-IGS
sequences) nucleotide positions. Pairwise nucleotide sequence
identities were calculated from the full-length alignments using
uncorrected distances and excluding sequences from putative
coisolates (i.e., isolates originating from the same water sample
and identical in both 16S rRNA gene and
cpcBA-IGS sequence sets),
poorly aligned columns (i.e., most of the IGS between
cpcB and
cpcA), and sites with ambiguous (i.e., codes M, R, W, Y, etc.)
bases. Maximum-likelihood (
12) trees were inferred with TREEFINDER
(
http://www.treefinder.de), assuming the GTR +

model of nucleotide
substitution. For both the 16S rRNA gene and cpcBA-IGS data
sets, GTR +

was the best-fit model of nucleotide substitution
according to analyses performed with ModelTest (
27).
Synechococcus PCC 6301 (formerly Anacystis nidulans) was chosen as the outgroup since it forms, together with PCC 7943 and PCC 7942, a paraphyletic group closely related to but well separated from the picophytoplankton clade sensu Urbach et al. (38) (10; N. D. Crosbie, unpublished analyses).
The cpcBA-IGS sequence set was examined for recombination events using a substitution method sensu Posada (26) as implemented in Geneconv 1.81 (S. A. Sawyer [http://www.math.wustl.edu/
sawyer]). The global permutation P values based on BLAST-like global scores (10,000 replicates) smaller than 0.05 were considered as evidence of recombination. A multiple-comparison correction (Bonferroni) is already built into the P values. The default value of the parameter gscale (gscale = 0) was used.

Results of phylogenetic analyses.
Phylogenetic analyses of the 16S rRNA gene sequences revealed
a high pairwise similarity for all freshwater picocyanobacteria
(Fig.
1). Overall, the near-full-length 16S rRNA gene sequences
obtained from 67 inland water picocyanobacterial isolates differed
by a maximum of 5% in pairwise comparisons (average pairwise
sequence identity, 98%; calculations excluded isolate PS-845
and isolates from Antarctic saline lakes). Our cluster designations
(and their nomenclature) are based on the groups proposed originally
by Robertson et al. (
29), with modifications according to Ernst
et al. (
10).
Many of our new PE-rich isolates from Lakes Mondsee and Hallstättersee
clustered with isolates obtained from other subalpine lakes,
falling into two groups, B (= subalpine cluster I) and H. The
new group, H, consists of seven closely related (average pairwise
sequence similarity for the 16S rRNA gene, 99.9%) isolates from
L. Mondsee and one isolate from Japanese Lake Biwa. Additionally
we propose the new group I, which contains three PC-rich isolates
from L. Mondsee and one PC-rich isolate from an Arctic tundra
pond. Isolates forming group H and those obtained from L. Hallstättersee
exhibited a greater tendency to form cell aggregations under
standard culture conditions. All isolates obtained in this study
were coccoid with the exception of MH 305, MH 307, and MW 76B2,
which formed rods. The latter isolate appears to be identical
to BO 8807, which also exhibits a rod morphology (
10).
A maximum-likelihood tree derived from the cpcBA-IGS gene sequences of 59 isolates, including 25 new Synechococcus and Cyanobium isolates from subalpine lakes, was constructed based upon an unambiguous alignment of 362 nucleotides (nt) (Fig. 2). The overall pattern was consistent with the 16S rRNA gene-based phylogeny (Fig. 1)for example, the new groups H and I were evident in both treesbut demonstrates, however, that subalpine cluster I (10) is not exclusive for subalpine central European lakes (Fig. 2).
Isolates obtained from widely separated locations shared up
to 99.87% identity in 16S rRNA gene sequences (e.g., the PC-rich
isolates P211 and MW 100C3 differed in two nt positions; Fig.
1, bottom) and up to 99.72% in cpcBA-IGS sequences (e.g., the
PE-rich isolates PS-714 and BO 8807 differed in one nucleotide
position; Fig.
2, top).
As originally observed by Robertson et al. (29), the length of the IGS separating cpcB and cpcA exhibited a strong relationship with phylogenetic groups (Fig. 2). Additionally, two isolates (PS-727 and PS-729) having an IGS length inconsistent with their initial (i.e., in the work of Robertson et al. [29]) classification in group B, were clearly separated in our phylogenetic analyses of the larger cpcBA-IGS data set (cf. Robertson et al. [29]).
With respect to terminal branching patterns, the results suggest a high degree of congruence between 16S rRNA gene- and cpcBA-IGS-based phylogenies of the nonmarine members of the picophytoplankton clade, though with less well delineated subgroups in the more conserved 16S rRNA gene phylogeny (29; this study). Contrary to the observations of Ernst et al. (10) and in agreement with Robertson et al. (29), we found a moderate and strong correlation between phylogenetic clusters and pigment group assignment in the 16S rRNA gene- and cpcBA-IGS-based phylogenetic analyses, respectively. We confirm, however, that both pigment types (i.e., PE- or PC-rich) can be found in some closely related isolates (e.g., isolates forming group A).
In the 16S rRNA gene sequence set, a pattern suggesting motif exchange (e.g., compare the helix 49 motif pattern of isolates BO 8807 and MW 76B2 [group B] with the helix 49 motif pattern of group H isolatessee Fig. 1), involving the terminal loop of helix 49 and its closing base pair (reference 10 and results herein), could have resulted from horizontal transfer (the "simplified complexity hypothesis"; see reference 41) and/or from endogenous processes (15). From X-ray structures, helix 49 appears not to be in contact with any other molecules within the ribosome and belongs to the group of rRNA hairpins exhibiting variable length and variable loop sequences (16).
Deep-branching patterns were sensitive to hypervariable sites (i.e., those removed by a 50% conservation filter) and the inclusion or exclusion of the helix 49 tetraloop motif (6 nt positions in the alignment) in the 16S rRNA gene sequence matrix subjected to phylogenetic analyses. Notably, PE-rich Antarctic isolates obtained from marine-derived saline lakes (28) and PS-845 (isolation details suggest a marine origin; M. M. Watanabe, personal communication) clustered with PC-rich freshwater isolates obtained from the Arctic (Bylot Island ponds) and central Europe (Lakes Mondsee and Constance) when the motif was included (results not shown). When excluded (either separately or together with hypervariable sites), the Antarctic isolates clustered together with PS-845 at the base of the picophytoplankton clade (Fig. 1). Although we could find no evidence of recombination in the set of picocyanobacterial cpcBA-IGS sequences (P > 0.05), the potential for spurious phylogenies (18, 22) was minimized by restricting analyses to an alignment made almost entirely from the flanking regions. A similar approach was taken by Robertson et al. (29).

Global dispersal versus ecosystem-dependent radiation.
While certain groups of freshwater picocyanobacteria may have
arisen in a specific ecosystem type (e.g., deep subalpine lakes),
the frequency and widespread nature of microbial dispersal (
13)
would all but ensure that newly adapted strains and their progenitors
are dispersed to widely separated locations. Given conditions
suitable for growth, the population of "old" and "new" arrivals
would increase, but bias originating from selective sampling
of picocyanobacterial strains (for example, by fluorescence
in situ hybridization, quantitative PCR, culture, or clone libraries)
must be taken into account before safe conclusions regarding
the geographical restriction of ecotypes sensu Cohan (
6) can
be made. Although our analyses confirm that most gene clusters
do contain isolates originating with nearby locations (
10),
there is also evidence for widespread dispersal of some closely
related taxa. This is illustrated by cluster B, the so-called
subalpine cluster I (
10), which contains isolates obtained from
Irish Lough Neagh (isolate PS-714) and several Japanese lakes
of very different type from the oligo-mesotrophic, deep subalpine
lakes (e.g., Fig.
2). Lake Kasumigaura (from which PS-725 was
isolated), for instance, is the second-largest hypertrophic
lake in Japan, with a surface area of 220 km
2 and a mean water
depth of 4 m (
36).
Prokaryote speciation is thought to have produced ecotypes recognizable as tightly clustered groups in sequence-based phylogenies (6, 23). Because phylogenetic analyses are sensitive, however, to the character and number of sequences included in the analysis and on the particular algorithm used to perform the clustering (25), robust ecotypes might be defined from a relatively small number of 16S rRNA gene sequences originating from a relatively small number of locations and environments. At the other extreme, the collection of a large number of more variable sequences [e.g., cpcBA-IGS (29; this study) or ITS sequences (10)] from a great many locations and environments will be needed. The present analysis suggests that there are at least seven clusters within the nonmarine picocyanobacteria forming the picophytoplankton clade sensu Urbach et al. (38). Whether these gene clusters should be given species rank remains debatable until more ecophysiological evidence on representative strains has been accumulated.
Although sequence-based clustering methods guide the formulation of testable hypotheses, the practical challenge for microbial ecologists will be to define ecotypes using methods which accurately predict ecological equivalence, which in turn requires careful consideration of the number and nature (genotypic and phenotypic) of arbiters (e.g., growth rate, grazing susceptibility, subtractive hybridization [1, 33], or gene expression) chosen to test ecotype boundariesi.e., which strains should be included or excluded. This is especially important given that apparently minor differences in picocyanobacterial genotypes can obscure ecologically significant differences (8, 10). A quantitative appraisal of the "everything (microbial) is everywhere" hypothesis will require that putative ecotypes are empirically defined. Limited phylogenetic information in the 16S rRNA gene (24), taxon undersampling, and the potential "erosion" of phylogenies due to horizontal transfer of genetic information mean that a mature understanding of picocyanobacterial ecotypes, their effective and potential biogeography (or lack thereof), will require that more importance is given to quantifying the limitations of (i) sequence acquisition, depending on the extent and nature of sampling, (ii) the number and choice of gene or gene-fragment(s), and (iii) methods of phylogenetic analysis.

Nucleotide sequence accession numbers.
GenBank accession codes for sequences determined in this study
are
AY151211 to
AY151251 and
AY224198 to
AY224207.

ACKNOWLEDGMENTS
We thank P. Stadler for technical assistance; M. W. Hahn for
providing isolates MH 301, MH 305, and MH 307; A. Wilmotte and
B. R. Robertson for providing details of unpublished primers;
and W. F. Vincent and M. M. Watanabe for information on several
isolates included in the phylogenetic analyses. Comments from
M. W. Hahn and R. Kurmayer helped to improve an earlier draft
of the manuscript.
This work was supported by the Austrian Science Fund (FWF P14238-Bio).

FOOTNOTES
* Corresponding author. Present address: Ocean Genome Legacy, 32 Tozer Rd., Beverly, MA 01915. Phone: 43 6232 3125 45. Fax: 43 6232 3578. E-mail:
crosbie{at}neb.com.


REFERENCES
1 - Agron, P. G., M. Macht, L. Radnedge, E. W. Skowronski, W. Miller, and G. L. Andersen. 2002. Use of subtractive hybridization for comprehensive surveys of prokaryotic genome differences. FEMS Microbiol. Lett. 211:175-182.[CrossRef][Medline]
2 - Amann, R., and R. Roselló-Mora. 2001. Mikrobiologische Aspekte der Biodiversität, p. 161-180. In P. Janich, M. Gutmann, and K Prieß (ed.), Biodiversität. Springer, Berlin, Germany.
3 - Bickel, P. J., K. J. Kechris, P. C. Spector, G. J. Wedemayer, and A. N. Glazer. 2002. Finding important sites in protein sequences. Proc. Natl. Acad. Sci. USA 99:14764-14771.[Abstract/Free Full Text]
4 - Callieri, C., and J. G. Stockner. 2002. Freshwater autotrophic picoplankton: a review. J. Limnol. 61:1-14.
5 - Castenholz, R. W. 2001. Phylum BX. Cyanobacteria, oxygenic photosynthetic bacteria, p. 473-599. In D. R. Boone and R. W. Castenholz (ed.), Bergey's manual of systematic bacteriology, vol. 1. Springer, New York, N.Y.
6 - Cohan, F. M. 2001. Bacterial species and speciation. Syst. Biol. 50:513-524.[Abstract/Free Full Text]
7 - Crosbie, N. D., M. Pöckl, and T. Weisse. Rapid establishment of clonal isolates of freshwater autotrophic picoplankton by single-cell and single-colony sorting. J. Microbiol. Methods, in press.
8 - Crosbie, N. D., K. Teubner, and T. Weisse. Flow-cytometric mapping provides novel insights into the seasonal and vertical distributions of freshwater autotrophic picoplankton. Aquat. Microb. Ecol., in press.
9 - Ernst, A. 1991. Cyanobacterial picoplankton from Lake Constance. I. Isolation by fluorescence characteristics. J. Plankton Res. 13:1307-1312.[Abstract/Free Full Text]
10 - Ernst, A., S. Becker, U. I. A. Wollenzien, and C. Postius. 2003. Ecosystem-dependent adaptive radiations of picocyanobacteria inferred from 16S rRNA and ITS-1 sequence analysis. Microbiology 149:217-228.[Abstract/Free Full Text]
11 - Ernst, A., G. Sandmann, C. Postius, S. Brass, U. Kenter, and P. Böger. 1992. Cyanobacterial picoplankton from Lake Constance. 2. Classification of isolates by morphology and pigment composition. Bot. Acta 105:161-167.
12 - Felsenstein, J. 1981. Evolutionary trees from DNA sequences: a maximum likelihood approach. J. Mol. Evol. 17:368-376.[CrossRef][Medline]
13 - Finlay, B. J. 2002. Global dispersal of free-living microbial eukaryote species. Science 296:1061-1063.[Abstract/Free Full Text]
14 - Finlay, B. J., S. C. Maberly, and J. I. Cooper. 1997. Microbial diversity and ecosystem function. Oikos 80:209-213.[CrossRef]
15 - Gutell, R. R., N. Larsen, and C. R. Woese. 1994. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective. Microbiol. Rev. 58:10-26.[Abstract/Free Full Text]
16 - Hedenstierna, K. O. F., J. L. Siefer, G. E. Fox, and E. J. Murgola. 2000. Co-conservation of rRNA tetraloop sequences and helix length suggests involvement of the tetraloops in higher-order interactions. Biochimie 82:221-227.[Medline]
17 - Honda, D., A. Yokota, and J. Sugiyama. 1999. Detection of seven major evolutionary lineages in cyanobacteria based on 16S rRNA gene sequence analysis with new sequences of five marine Synechococcus strains. J. Mol. Evol. 48:723-739.[CrossRef][Medline]
18 - Janson, S., and E. Granéli. 2002. Phylogenetic analyses of nitrogen-fixing cyanobacteria from the Baltic Sea reveal sequence anomalies in the phycocyanin operon. Int. J. Syst. Evol. Microbiol. 52:1397-1404.[Abstract]
19 - Lepere, C., A. Wilmotte, and B. Meyer. 2000. Molecular diversity of Microcystis strains (Cyanophyceae, Chroococcales) based on 16S rDNA sequences. Syst. Geogr. Plants 70:275-283.[CrossRef]
20 - Ludwig, W., and H. Klenk. 2001. Overview: a phylogenetic backbone and taxonomic framework for procaryotic systematics, p. 49-65. In D. R. Boone and R. W. Castenholz (ed.), Bergey's manual of systematic bacteriology, vol. 1. Springer, New York, N.Y.
21 - MacIsaac, E. A., and J. G. Stockner. 1993. Enumeration of phototrophic picoplankton by autofluorescence microscopy, p. 187-197. In P. F. Kemp, B. F. Sherr, E. B. Sherr, and J. J. Cole (ed.), Handbook of methods in aquatic microbial ecology. Lewis Publishers, Boca Raton, Fla.
22 - Manen, J., and J. Falquet. 2002. The cpcB-cpcA locus as a tool for the genetic characterization of the genus Arthrospira (Cyanobacteria): evidence for horizontal transfer. Int. J. Syst. Evol. Microbiol. 52:861-867.[Abstract]
23 - Palys, T., F. M. Cohan, and L. K. Nakamura. 1997. Discovery and classification of ecological diversity in the bacterial world: the role of DNA sequence data. Int. J. Syst. Bacteriol. 47:1145-1156.[Abstract/Free Full Text]
24 - Palys, T., E. Berger, I. Mitrica, L. K. Nakamura, and F. M. Cohan. 2000. Protein-coding genes as molecular markers for ecologically distinct populations: the case of two Bacillus species. Int. J. Syst. Evol. Microbiol. 50:1021-1028.[Abstract]
25 - Pollock, D. D., D. J. Zwickl, J. A. McGuire, and D. M. Hillis. 2002. Increased taxon sampling is advantageous for phylogenetic inference. Syst. Biol. 51:664-671.[CrossRef][Medline]
26 - Posada, D. 2002. Evaluation of methods for detecting recombination from DNA sequences: empirical data. Mol. Biol. Evol. 19:708-717.[Abstract/Free Full Text]
27 - Posada, D., and K. A. Crandall. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14:817-818.[Abstract/Free Full Text]
28 - Rankin, L. M., P. D. Franzmann, T. A. McMeekin, and H. R. Burton. 1997. Seasonal distribution of picocyanobacteria in Ace Lake, a marine-derived Antarctic lake, p. 178-184. In B. Battaglia, J. Valencia, and D. W. H. Walton (ed.), Antarctic communities. Species, structure and survival. Cambridge University Press, Cambridge, United Kingdom.
29 - Robertson, B. R., N. Tezuka, and M. M. Watanabe. 2001. Phylogenetic analyses of Synechococcus strains (cyanobacteria) using sequences of the 16S rDNA and part of the phycocyanin operon reveal multiple evolutionary lines and reflect phycobilin content. Int. J. Syst. Evol. Microbiol. 51:861-871.[Abstract]
30 - Rocap, G., L. Distel, J. B. Waterbury, and S. W. Chisholm. 2002. Resolution of Prochlorococcus and Synechococcus ecotypes by using 16S-23S ribosomal DNA internal transcribed spacer sequences. Appl. Environ. Microbiol. 68:1180-1191.[Abstract/Free Full Text]
31 - Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406-425.[Abstract]
32 - Scheldman, P., D. Baurain, R. Bouhy, M. Scott, M. Mühling, B. A. Whitton, A. Belay, and A. Wilmotte. 1999. Arthrospira (Spirulina) strains from four continents are resolved into only two clusters, based on amplified ribosomal DNA restriction analysis of the internally transcribed spacer. FEMS Microbiol. Lett. 172:213-222.[CrossRef][Medline]
33 - Schmidt, K. D., T. Schmidtrose, U. Romling, and B. Tummler. 1998. Differential genome analysis of bacteria by genomic subtractive hybridization and pulsed-field gel electrophoresis. Electrophoresis 19:509-514.[CrossRef][Medline]
34 - Stanier, R. Y., R. Kunisawa, M. Mandel, and G. Cohen-Bazier. 1971. Purification and properties of unicellular blue-green algae (order Chroococcales). Bacteriol. Rev. 35:171-205.[Free Full Text]
35 - Stockner, J., C. Callieri, and G. Cronberg. 2000. Picoplankton and other non-bloom forming cyanobacteria in lakes, p. 195-231. In B. A. Whitton and M. Potts (ed.), The ecology of cyanobacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands.
36 - Sugiara, N., B. Wei, and T. Maekawa. 2002. The discrimination of the response pattern of inter-phylum phytoplankton diversity to long-term eutrophication trends in lake Kasumigaura, Japan. Aquat. Ecosyst. Health Manag. 5:403-410.[CrossRef]
37 - Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24:4876-4882.
38 - Urbach, E., D. J. Scanlan, D. L. Distel, J. B. Waterbury, and S. W. Chisholm. 1998. Rapid diversification of marine picophytoplankton with dissimilar light-harvesting structures inferred from sequences of Prochlorococcus and Synechococcus (Cyanobacteria). J. Mol. Evol. 46:188-201.[CrossRef][Medline]
39 - Van de Peer, Y., and R. De Watcher. 1994. TREECON: a software package for the construction and drawing of evolutionary trees. Comput. Appl. Biosci. 9:177-182.[CrossRef]
40 - Vincent, W. F., J. P. Bowman, L. M. Rankin, and T. A. McMeekin. 2000. Phylogenetic diversity of picocyanobacteria in Arctic and Antarctic ecosystems, p. 317-322. In C. R. Bell, M. Brylinsky, and P. Johnson-Green (ed.), Microbial biosystems: new frontiers. Proceedings of the 8th International Symposium on Microbial Ecology. Atlantic Canada Society for Microbial Ecology, Halifax, Canada.
41 - Wang, Y., and Z. Zhang. 2000. Comparative sequence analyses reveal frequent occurrence of short segments containing an abnormally high number of non-random base variations in bacterial rRNA genes. Microbiology 146:2845-2854.[Abstract/Free Full Text]
42 - Weisse, T. 1988. Dynamics of autotrophic picoplankton in Lake Constance. J. Plankton Res. 10:1179-1188.[Abstract/Free Full Text]
43 - Weisse, T., and U. Kenter. 1991. Ecological characteristics of autotrophic picoplankton in a prealpine lake. Int. Rev. Hydrobiol. 76:493-504.[CrossRef]
Applied and Environmental Microbiology, September 2003, p. 5716-5721, Vol. 69, No. 9
0099-2240/03/$08.00+0 DOI: 10.1128/AEM.69.9.5716-5721.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Stuken, A., Campbell, R. J., Quesada, A., Sukenik, A., Dadheech, P. K., Wiedner, C.
(2009). Genetic and morphologic characterization of four putative cylindrospermopsin producing species of the cyanobacterial genera Anabaena and Aphanizomenon. J PLANKTON RES
31: 465-480
[Abstract]
[Full Text]
-
Moser, M., Callieri, C., Weisse, T.
(2009). Photosynthetic and growth response of freshwater picocyanobacteria are strain-specific and sensitive to photoacclimation. J PLANKTON RES
31: 349-357
[Abstract]
[Full Text]
-
Sanchez-Baracaldo, P., Handley, B. A., Hayes, P. K.
(2008). Picocyanobacterial community structure of freshwater lakes and the Baltic Sea revealed by phylogenetic analyses and clade-specific quantitative PCR. Microbiology
154: 3347-3357
[Abstract]
[Full Text]
-
Ivanikova, N. V., Popels, L. C., McKay, R. M. L., Bullerjahn, G. S.
(2007). Lake Superior Supports Novel Clusters of Cyanobacterial Picoplankton. Appl. Environ. Microbiol.
73: 4055-4065
[Abstract]
[Full Text]
-
Wu, Q. L., Zwart, G., Schauer, M., Kamst-van Agterveld, M. P., Hahn, M. W.
(2006). Bacterioplankton Community Composition along a Salinity Gradient of Sixteen High-Mountain Lakes Located on the Tibetan Plateau, China. Appl. Environ. Microbiol.
72: 5478-5485
[Abstract]
[Full Text]
-
Kim, S.-G., Rhee, S.-K., Ahn, C.-Y., Ko, S.-R., Choi, G.-G., Bae, J.-W., Park, Y.-H., Oh, H.-M.
(2006). Determination of Cyanobacterial Diversity during Algal Blooms in Daechung Reservoir, Korea, on the Basis of cpcBA Intergenic Spacer Region Analysis.. Appl. Environ. Microbiol.
72: 3252-3258
[Abstract]
[Full Text]
-
Chen, F., Wang, K., Kan, J., Suzuki, M. T., Wommack, K. E.
(2006). Diverse and Unique Picocyanobacteria in Chesapeake Bay, Revealed by 16S-23S rRNA Internal Transcribed Spacer Sequences.. Appl. Environ. Microbiol.
72: 2239-2243
[Abstract]
[Full Text]
-
Hahn, M. W., Pockl, M., Wu, Q. L.
(2005). Low Intraspecific Diversity in a Polynucleobacter Subcluster Population Numerically Dominating Bacterioplankton of a Freshwater Pond. Appl. Environ. Microbiol.
71: 4539-4547
[Abstract]
[Full Text]
-
Ernst, A., Deicher, M., Herman, P. M. J., Wollenzien, U. I. A.
(2005). Nitrate and Phosphate Affect Cultivability of Cyanobacteria from Environments with Low Nutrient Levels. Appl. Environ. Microbiol.
71: 3379-3383
[Abstract]
[Full Text]
-
Dorigo, U., Jacquet, S., Humbert, J.-F.
(2004). Cyanophage Diversity, Inferred from g20 Gene Analyses, in the Largest Natural Lake in France, Lake Bourget. Appl. Environ. Microbiol.
70: 1017-1022
[Abstract]
[Full Text]