Previous Article | Next Article 
Applied and Environmental Microbiology, January 2004, p. 581-587, Vol. 70, No. 1
0099-2240/04/$08.00+0 DOI: 10.1128/AEM.70.1.581-587.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Development of Genetic Techniques for the Psychrotrophic Fish Pathogen Flavobacterium psychrophilum
B. Alvarez,1 P. Secades,1 M. J. McBride,2 and J. A. Guijarro1*
Área de Microbiologia, Departamento de Biología Funcional, IUBA, Universidad de Oviedo, 33006 Oviedo, Asturias, Spain,1
Department of Biological Sciences, University of Wisconsin, Milwaukee, Wisconsin 532012
Received 11 July 2003/
Accepted 2 October 2003

ABSTRACT
Flavobacterium psychrophilum, a member of the
Cytophaga-Flavobacterium-Bacteroides group, is an important pathogen of salmonid fish. Previous attempts
to develop genetic techniques for this fastidious, psychrotrophic
bacterium have met with failure. Here we describe the development
of techniques for the genetic manipulation of
F. psychrophilum and the identification of plasmids, selectable markers, a reporter
system, and a transposon that function in several isolates of
this fish pathogen. The antibiotic resistance genes
ermF,
cfxA,
and
tetQ function in
F. psychrophilum. Cloning vectors based
on the
F. psychrophilum cryptic plasmid pCP1 which carried these
selectable markers were introduced by conjugation from
E. coli,
resulting in antibiotic-resistant colonies of
F. psychrophilum.
Conjugative transfer of DNA into
F. psychrophilum was strain
dependent. Efficient transfer was observed for two of the seven
strains tested (THC02-90 and THC04-90).
E. coli lacZY functioned
in
F. psychrophilum when expressed from a pCP1 promoter, allowing
its development as a reporter for studies of gene expression.
Plasmids isolated from
F. psychrophilum were efficiently introduced
into
F. psychrophilum by electroporation, but plasmids isolated
from
E. coli were not suitable for transfer by this route, suggesting
the presence of a restriction barrier. DNA isolated from
F. psychrophilum was resistant to digestion by
Sau3AI and
BamHI,
indicating that a
Sau3AI-like restriction modification system
may constitute part of this barrier. Tn
4351 was introduced into
F. psychrophilum from
E. coli and transposed with apparent randomness,
resulting in erythromycin-resistant colonies. The techniques
developed in this study allow for genetic manipulation and analysis
of this important fish pathogen.

INTRODUCTION
The gliding bacterium
Flavobacterium psychrophilum is the causative
agent of cold water disease (CWD) in salmonids. Outbreaks of
this disease, which may result in up to 50% mortality, are most
common in fingerlings and typically occur at water temperatures
between 12 and 14°C. CWD has important economic consequences
because of the large and growing salmonid aquaculture industry
(for a review, see references
7 and
10). No vaccine to prevent
CWD is available, and control of the outbreaks currently involves
antimicrobial drug administration.
F. psychrophilum is somewhat fastidious, requiring additions such as serum for optimal growth and for efficient colony formation from single cells plated on solid media. The optimum temperature for growth is approximately 18°C, and most strains fail to grow above 20°C. Under optimal conditions, the population doubles in approximately 3 h. These growth properties have hampered studies of F. psychrophilum and the development of genetic techniques. Recent advances have been made in methods for cultivation (18) and detection (8, 29, 30, 31) of F. psychrophilum, and procedures allowing standardization of experimental infection have been developed (9).
The mechanisms of F. psychrophilum pathogenicity are poorly understood. Cells of F. psychrophilum produce a number of proteases that may play a role in the disease process (3). A correlation has been established between the presence of specific proteases and virulence (13, 20). The metalloprotease Fpp1, which may be involved in pathogenicity, has recently been purified and characterized (23). Lipopolysaccharide may also be associated with virulence and has been the subject of several recent studies (6, 12). The lack of genetic techniques for F. psychrophilum has hampered further progress toward defining the mechanisms of pathogenesis. The development of methods for genetic manipulation would allow for identification of virulence genes and would facilitate the rational design of vaccine strains.
F. psychrophilum is a member of the Cytophaga-Flavobacterium-Bacteroides (CFB) group and is very distantly related to organisms with well-developed genetic systems, such as members of the proteobacteria. In general, plasmids, selectable markers, and transposons that function in proteobacteria fail to function in members of the CFB group (16, 21). Methods for genetic manipulation of Bacteroides species (21) and of some Flavobacterium species (15, 16, 27) have been developed. In spite of the fact that the plasmid used to develop Flavobacterium cloning vectors was isolated from F. psychrophilum D12, repeated attempts by ourselves and others to demonstrate transfer of these plasmids or other genetic elements into F. psychrophilum have been unsuccessful (J. A. Guijarro, unpublished data; M. J. McBride, unpublished data; D. W. Hunnicutt, unpublished data).
In this study, we describe the development of methods for the introduction of DNA into F. psychrophilum by conjugation and electroporation. Selectable markers, plasmid cloning vectors, a lacZY reporter construct, and a transposon which functions in F. psychrophilum are also described, and evidence for a Sau3AI-like restriction modification system in F. psychrophilum THC02-90 is presented. The availability of these genetic techniques should allow analysis of the underlying mechanisms of F. psychrophilum virulence and facilitate the development of vaccine strains.

MATERIALS AND METHODS
Bacterial strains, plasmids, and growth conditions.
The bacterial strains and plasmids used in this study are listed
in Table
1. EAO medium (
18) was used, consisting of 5 g of tryptone,
0.5 g of yeast extract, 0.2 g of beef extract, and 0.2 g of
sodium acetate per liter, with the pH adjusted to 7.2 to 7.4.
EAOS medium was the same as EAO medium except that it was supplemented
with 5% horse serum, 10 µM
L-phenylalanine, 10 µM
L-tyrosine, 10 µM
L-tryptophan, 10 µM
p-aminobenzoic
acid, 10 µM 4-hydroxybenzoic acid, and 10 µM 2,3-dihydroxybenzoic
acid. For growth on solid medium, 15 g of agar was added per
liter of EAOS medium, and cultures were incubated at 20°C.
Nutrient broth (NB; Promega) was used for growth of
F. psychrophilum in liquid, and cultures were incubated at 18°C with shaking
at 250 rpm.
Escherichia coli strains were grown at 37°C
in 2
x TY medium (15 g of tryptone, 10 g of yeast extract, and
5 g of NaCl per liter), with 20 g of agar per liter added for
solid medium. For selection of
F. psychrophilum transconjugants
or transformants, erythromycin, cefoxitin, or tetracycline was
used at 10 µg/ml. For selective growth of
E. coli strains,
antibiotics were used when needed at the following concentrations:
ampicillin, 100 µg/ml; chloramphenicol, 30 µg/ml;
streptomycin, 50 µg/ml; and tetracycline, 15 µg/ml.
Manipulation of DNA and nucleic acid sequencing.
Standard procedures were used to isolate plasmid and genomic
DNA and to clone and analyze DNA fragments (
22). Nucleic acid
sequencing was performed by the dideoxy nucleotide procedure,
using an automated (Applied Biosystems) sequencing system. Sequences
were analyzed with MacVector and AssemblyLign software (Accelrys,
San Diego, Calif.), and comparisons to database sequences were
made by use of the BLAST algorithm (
2).
Conjugal transfer of DNA from E. coli to F. psychrophilum.
E. coli S17-1
pir was used for conjugative transfer of pCP29, pCP23, and pCP23-ß into F. psychrophilum, and E. coli BW19851 was used to transfer pEP4351. Donor E. coli strains were grown to mid-log phase in 2x TY medium, and recipient F. psychrophilum strains were grown to mid-log phase in NB. F. psychrophilum cells (10 ml) were harvested by centrifugation, washed twice with TM buffer, consisting of 20 mM Tris-HCl and 20 mM MgSO4 with the pH adjusted to 7.2, and suspended in 50 µl of TM buffer. E. coli cells (10 ml) were harvested by centrifugation, washed twice with EAO medium, and suspended in 50 µl of EAO medium. Cells of F. psychrophilum and E. coli were mixed together (approximately 108 cells of each strain), spotted onto EAOS agar, and incubated at 20°C for 48 h to allow conjugative transfer of DNA. After conjugation, cells were scraped off the plates, diluted in 1 ml of EAO medium, and plated on EAOS agar containing the appropriate antibiotic (cefoxitin, erythromycin, or tetracycline) to select for plasmid or transposon transfer and to eliminate E. coli donor cells. Plates were incubated at 20°C for 4 to 7 days. A separate counterselection to eliminate E. coli was not needed, since cfxA, ermF, and tetQ are not expressed in E. coli. To calculate the frequencies of conjugative transfer per recipient, cells were plated on EAOS agar without antibiotics to determine the number of surviving F. psychrophilum cells.
Electroporation.
F. psychrophilum cells were harvested during exponential growth, washed three times with ice-cold double-distilled water, and resuspended to a density of approximately 1011 cells/ml in double-distilled water. Approximately 200 ng of pCP29 was added to 40 µl of cells. For the optimized procedure, each mixture was placed in a Bio-Rad 0.2-cm pulser cuvette and pulsed with a Bio-Rad gene pulser, with a field strength of 10 kV/cm, resistance of 400
, and capacitance of 25 µF. DNA isolated from F. psychrophilum and E. coli strain S17-1
pir was used to electroporate F. psychrophilum cells. After electroporation, the cells were transferred to NB and incubated at 18°C, with shaking at 250 rpm, for 3 h to allow expression of antibiotic resistance. Afterwards, cells were diluted in NB and plated on EAOS agar with the appropriate antibiotic. Colonies were counted after 4 to 5 days of incubation at 20°C.
Southern blot analysis of Tn4351 insertions.
Tn4351 was introduced into F. psychrophilum THC02-90 by conjugation, as described above. Genomic DNA from erythromycin-resistant transconjugants was isolated, digested with XbaI, separated by gel electrophoresis, and transferred to nylon membranes essentially as described previously (22). The DIG DNA labeling and detection kit (Roche) was used to prepare probes and to perform hybridization. Two probes were used, a 6.2-kb SalI fragment from pEP4351 containing the transposon Tn4351 and the chloramphenicol acetyltransferase gene (cat), which is also present on pEP4351. The cat gene was amplified as a 633-bp PCR product from pIVET8 by use of the primers CAT-1 (CACTGGATATACCACCG) and CAT-2 (TGCCACTCATCGCAGTA).
In vitro ß-galactosidase determination.
The SphI fragment of pIVET8 (14) containing the lacZY genes was inserted into the SphI site of pCP23 downstream of the ORF1 promoter to generate pCP23-ß. pCP23-ß was introduced by conjugation into F. psychrophilum THC02-90, and tetracycline-resistant transconjugants (THC02-90-ß) were obtained. As a control, the THC02-90 strain containing the pCP23 plasmid (THC02-90-p) was used. For detection of ß-galactosidase activity on the plates, 5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside (X-Gal) was added at 50 µg/ml. NB was used to detect the production of ß-galactosidase. Cells from 1 ml of a culture which had been incubated for 48 h were collected by centrifugation at 12,000 x g for 5 min, suspended in buffer Z (19), and disrupted by sonication. ß-Galactosidase activity was measured as previously described (19).
Nucleotide sequence accession number.
The sequence of pCP1 which is reported in this paper has been deposited in the GenBank database under accession number AY277637.

RESULTS
Conjugative transfer of plasmids into F. psychrophilum.
pCP29 was selected as a test plasmid to determine the optimal
conditions for conjugative transfer of DNA into
F. psychrophilum.
Despite the fact that previous attempts to transfer pCP29 and
other plasmids into this bacterium had all failed, we predicted
that
F. psychrophilum would support replication of pCP29 once
barriers to transfer were overcome because this plasmid is derived
from the cryptic
F. psychrophilum D12 plasmid pCP1 (
11,
15).
pCP29 carries two antibiotic resistance genes (
cfxA and
ermF)
that function in
Flavobacterium johnsoniae,
Bacteroides thetaiotaomicron,
and many other members of the CFB group, so it seemed likely
that pCP29 would confer erythromycin and cefoxitin resistance
to
F. psychrophilum. F. psychrophilum THC02-90, which does not
carry pCP1, was chosen as the recipient strain to avoid problems
of plasmid incompatibility. pCP29 was transferred by conjugation
from
E. coli to
F. psychrophilum THC02-90, and cefoxitin- and
erythromycin-resistant colonies arose after 4 to 5 days of incubation
at 20°C. pCP29 plasmid DNA was isolated from the transconjugants,
and phenotypic analysis and PCR analysis using specific
F. psychrophilum primers (
8) confirmed that the transconjugants were
F. psychrophilum.
A number of variables were tested to determine the optimal conditions
for conjugative transfer. Recipient cells harvested during the
early exponential phase of growth (optical density at 525 nm,
0.3 to 0.5) resulted in the highest frequencies of conjugation
(1.3
x 10
-5 to 1.7
x 10
-5 antibiotic-resistant colonies per
recipient cell). Cells harvested during stationary phase exhibited
much lower rates of conjugative transfer (5.9
x 10
-7 to 8.3
x 10
-7 antibiotic-resistant colonies per recipient cell). The
length of mating time (24, 48, or 72 h) was tested, and the
maximum number of transconjugants per recipient cell was obtained
with 48 h of incubation. We expected that conjugative transfer
from
E. coli would not be efficient at the low temperatures
required for cultivation of
F. psychrophilum and therefore used
the highest temperature that
F. psychrophilum would easily tolerate
(20°C). Reduction of the temperature of incubation during
mating to 18 and 15°C resulted in a reduction of 10- and
100-fold, respectively, in the number of antibiotic-resistant
transconjugants. With control experiments, we found that conjugation
of pCP29 from
E. coli into
F. johnsoniae, whose optimum growth
temperature is 30°C, was also reduced 10-fold when conjugation
was performed at 20°C instead of 30°C.
cfxA and
ermF functioned equally well as selectable markers in
F. psychrophilum,
since similar numbers of transconjugants were obtained with
either cefoxitin or erythromycin as the selective agent.
tetQ conferred tetracycline resistance on
F. psychrophilum, but colonies
did not appear until after 5 to 7 days of incubation when the
tetQ-containing plasmid, pCP23, was transferred, and conjugative
transfer frequencies were low (2.44
x 10
-8 to 3.33
x 10
-8 antibiotic-resistant
colonies per recipient cell). Plasmids were also transferred
by conjugation into several other strains of
F. psychrophilum.
pCP29 was transferred by conjugation into
F. psychrophilum THC04-90
(6
x 10
-6 colonies per recipient cell) and, less efficiently,
into
F. psychrophilum SH3-81. Despite repeated attempts, no
transconjugants were obtained with
F. psychrophilum strains
ATCC 49418, ATCC 49510, ATCC 49511, Ch8-80, D12, and FPC 830.
Electroporation of F. psychrophilum.
A procedure was developed to allow for the direct introduction of DNA into F. psychrophilum cells by electroporation. pCP29 isolated from F. psychrophilum THC02-90 was used to optimize this procedure. Electrocompetent cells of F. psychrophilum were prepared by washing with either 10% glycerol or distilled water. Cells produced by either procedure were equally competent. The voltage (2.5 to 12.5 kV/cm) and resistance (200 to 1,000
) were varied to optimize transfer. The optimal conditions for transfer were 7.5 to 12.5 kV/cm and 200 to 600
. The highest number of transformants (2 x 106 to 2.6 x 106 transformants/µg of DNA) was obtained when the electrical parameters were 400
, 10 kV/cm, and 25 µF and cefoxitin was used as the selective agent. The antibiotic used for selection had a marked effect on the efficiency of electrotransformation. When erythromycin was used instead of cefoxitin, only 4 x 104 to 5.3 x 104 colonies/µg of DNA were obtained.
Sequence analysis of pCP1.
The 3,407-bp nucleotide sequence of pCP1 was determined in order to enhance the usefulness of cloning vectors such as pCP29 and pCP23, which were derived from this plasmid. pCP1 contains four open reading frames: repA, ORF1, ORF2, and ORF3 (Fig. 1). RepA is similar to the Reimerella antatipestifer plasmid replication protein 1 from pCFC1 (49% identity over 317 amino acids; GenBank accession number AAC27555) and is probably involved in plasmid replication. The functions of the other open reading frames are not known. ORF1 and ORF2 are apparently not needed for replication in F. psychrophilum or F. johnsoniae, since ORF1 was disrupted during construction of pCP11 (15) and pCP29 (11) (Fig. 1) and ORF1 and ORF2 were disrupted during construction of pCP23 (1) (Fig. 1). Upstream of repA is a 21-bp sequence, AAACTTTCTTTTCGCTTATAA, that is tandemly repeated 4.7 times and may be involved in plasmid replication.
Development of lacZY as a transcriptional reporter for F. psychrophilum.
The ORF1 promoter reads toward the multiple cloning site of
pCP23 (Fig.
1). Promoterless
lacZY was cloned into the multiple
cloning site to test this promoter and to determine whether
lacZ could be used as a reporter of gene expression for
F. psychrophilum.
Green tetracycline-resistant transconjugants appeared after
7 days of incubation (Fig.
2). Expression of
lacZ from this
promoter was measured under various conditions as a first test
of its usefulness as a reporter of
F. psychrophilum gene expression.
The expression level was similar for cultures grown at 12 and
18°C and for cultures grown at pHs 6, 6.5, 7, and 7.5. In
contrast, the addition of 1 to 5 mM CaCl
2 resulted in decreased
expression.
Transposition of Tn4351 in F. psychrophilum.
Tn
4351 was introduced into
F. psychrophilum THC02-90 on pEP4351
by conjugation, and erythromycin-resistant transconjugants were
obtained at a frequency of 0.8
x 10
-8 to 1.8
x 10
-8 per recipient
cell. PCR and Southern blot analysis of transconjugants verified
that Tn
4351 had been transferred (Fig.
3). When analyzed by
miniprep, none of the transconjugants carried pEP4351 as a free
plasmid, indicating that as expected, pEP4351 did not replicate
in
F. psychrophilum. Some transconjugants carried only Tn
4351 (Fig.
3B and C, lanes 3 to 6, 11, and 13), whereas others had
the delivery vector integrated into the chromosome with Tn
4351 (Fig.
3B and C, lanes 7 to 10 and 12). Insertions of plasmid
DNA into the chromosome, which may be the result of homologous
recombination after transposition of Tn
4351, have been described
previously for
B. thetaiotaomicron,
F. johnsoniae, and related
bacteria (
15,
24). The frequencies of such insertions are strain
dependent. Most of the mutants that did not carry vector DNA
had single insertions of Tn
4351, but the presence of three bands
in lane 6 of Fig.
3B suggests that multiple insertions may also
occur. Tn
4351 inserted at different locations in the chromosome
(Fig.
3) and will probably be useful for mutagenesis of
F. psychrophilum.
Evidence for a Sau3AI-like restriction modification system in F. psychrophilum.
Electroporation of pCP29 extracted from
E. coli into
F. psychrophilum resulted in no antibiotic-resistant transformants. We suspected
that a restriction barrier was responsible for the lack of transformants.
One indication of the presence of a restriction modification
system is modification of DNA such that it resists digestion
by the restriction enzyme produced by that strain. DNA propagated
in
F. psychrophilum was resistant to digestion by
Sau3AI (Fig.
4, lanes 5 and 9) and
BamHI (Fig.
4, lanes 3 and 7). Both enzymes
cleave DNA that contains the core sequence GATC and are inhibited
by methylation of cytosine in this sequence.
MboI, which recognizes
the same sequence as
Sau3AI but is not inhibited by cytosine
methylation, digested
F. psychrophilum chromosomal DNA (Fig.
4, lane 4) and pCP29 DNA isolated from
F. psychrophilum (Fig.
4, lane 8). In contrast, when pCP29 was extracted from
E. coli S17-1
pir, it was susceptible to digestion by
BamHI (Fig.
4,
lane 11) and
Sau3AI (Fig.
4, lane 13) but was resistant to
MboI
(Fig.
4, lane 12), an enzyme that fails to digest DNA that has
been methylated on adenine residues by the
dam system.
F. psychrophilum DNA appears to be modified, and it is likely that this modification
is part of a restriction modification system. This may account
for some of the difficulties encountered when introducing DNA
into
F. psychrophilum by electroporation. Others have observed
that conjugative transfer is generally less sensitive to the
presence of restriction systems in the recipient strain (
21),
which may account for the success of conjugative transfer of
DNA into
F. psychrophilum.

DISCUSSION
F. psychrophilum,
Flavobacterium columnare, and
Flavobacterium branchiophilum are important fish pathogens. Techniques to genetically
manipulate some members of the genus
Flavobacterium have been
developed (
15,
16,
27), but despite the efforts of several laboratories,
the fish pathogenic flavobacteria have resisted attempts of
gene transfer. In this study, techniques that allow for the
genetic manipulation of several strains of
F. psychrophilum were developed, opening up the possibility of genetic analysis
of pathogenesis by members of this genus.
DNA was introduced into F. psychrophilum by conjugation. Plasmids based on pCP1 replicated in F. psychrophilum, and the antibiotic resistance genes cfxA, ermF, and tetQ conferred cefoxitin resistance, erythromycin resistance, and tetracycline resistance, respectively. Conjugal transfer was strain dependent and was observed for three of the seven strains tested. F. psychrophilum THC02-90 and THC04-90, which were the best recipients for conjugative transfer, do not harbor any of the cryptic plasmids that are present in many strains (4). Since pCP1 was isolated from F. psychrophilum D12, it is possible that plasmid incompatibility accounts for some of the difficulties encountered when transferring pCP29 into some strains of F. psychrophilum. Another reason that F. psychrophilum may have resisted attempts of gene transfer until now is its inability to tolerate temperatures above 20°C. E. coli cells incubated at low temperatures exhibit decreased levels of conjugation (26). Low temperatures could alter the expression of genes involved in conjugation or the lipid composition of cell membranes (for a review, see reference 28), resulting in a decreased efficiency of conjugative transfer.
The conditions for the introduction of DNA into F. psychrophilum cells by electroporation were also determined. Antibiotic-resistant colonies arose when plasmid DNA isolated from F. psychrophilum was introduced into cells of F. psychrophilum, but DNA isolated from E. coli was not suitable for transfer by electroporation. A restriction barrier is likely to be responsible for our inability to introduce DNA isolated from E. coli into F. psychrophilum by electroporation. The resistance of F. psychrophilum DNA to digestion by Sau3AI and BamHI suggests that a Sau3AI-like restriction modification system may constitute at least part of the restriction barrier. The generation of a strain of F. psychrophilum with a restriction enzyme deficiency or the use of an E. coli strain containing the modification enzyme may remove the barrier to transfer of DNA by electroporation. Until then, conjugation will likely be a more reliable technique for the transfer of DNA from E. coli into F. psychrophilum.
Tn4351 was demonstrated to function in F. psychrophilum, inserting into the chromosome and conferring resistance to erythromycin. Tn4351 has been used for mutagenesis of a number of other members of the CFB group (15, 16, 21, 24) and is likely to be a useful genetic tool for mutagenesis and analysis of F. psychrophilum genes.
With the tools described above, a foreign gene (E. coli lacZ) was introduced into F. psychrophilum and expressed, apparently from the ORF1 promoter of pCP23. The results indicate that lacZ may be used in F. psychrophilum as a reporter of gene expression. They also suggest that the ORF1 promoter may be used to express genes for complementation analyses of F. psychrophilum mutants. The presence of calcium in the culture medium resulted in decreased levels of ß-galactosidase activity from this construct. Calcium has previously been implicated in the control of expression of Fpp1 protease, a putative virulence factor of F. psychrophilum (23). Growth of F. psychrophilum is also sensitive to the level of calcium in the medium (P. Secades and J. A. Guijarro, unpublished data).
F. psychrophilum and the related bacteria F. columnare and F. branchiophilum are important pathogens of fish. The development of methods to genetically manipulate F. psychrophilum should allow for new approaches for the identification of virulence factors and determination of the mechanisms of pathogenesis and could result in the development of vaccine strains to prevent CWD. The results of this study may also aid the development of similar genetic systems for the other flavobacterial fish pathogens.

ACKNOWLEDGMENTS
This work was supported by a grant (AGL2000-0869) from the Ministerio
de Ciencia y Técnologia of Spain. B. Alvarez was the
recipient of a grant from the FICYT. M. McBride was supported
by grants from the National Science Foundation (MCB-0130967)
and the Milwaukee Foundation.
We thank C. Rodicio for useful comments and assistance in the restriction modification experiments, J.-F. Bernardet for providing strains, and D. Saffarini and the members of the Saffarini and McBride laboratories for helpful suggestions.

FOOTNOTES
* Corresponding author. Mailing address: Área de Microbiologia, Facultad de Medicina, Universidad de Oviedo, 33006 Oviedo, Asturias, Spain. Phone: 34985104218. Fax: 34985103148. E-mail:
jaga{at}sauron.quimica.uniovi.es.


REFERENCES
1 - Agarwal, S., D. W. Hunnicutt, and M. J. McBride. 1997. Cloning and characterization of the Flavobacterium johnsoniae (Cytophaga johnsonae) gliding motility gene, gldA. Proc. Natl. Acad. Sci. USA 94:12139-12144.[Abstract/Free Full Text]
2 - Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410.[CrossRef][Medline]
3 - Bertolini, J. M., H. Wakabayashi, V. G. Watral, M. J. Whipple, and J. S. Rohovec. 1994. Electrophoretic detection of proteases from selected strains of Flexibacter psychrophilus and assessment of their variability. J. Aquat. Anim. Health 6:224-233.[CrossRef]
4 - Chakroun, C., F. Grimont, M. C. Urdaci, and J.-F. Bernardet. 1998. Fingerprinting of Flavobacterium psychrophilum isolates by ribotyping and plasmid profiling. Dis. Aquat. Org. 33:167-177.[Medline]
5 - Cooper, A. J., A. P. Kalinowski, N. B. Shoemaker, and A. A. Salyers. 1997. Construction and characterization of a Bacteroides thetaiotaomicron recA mutant: transfer of Bacteroides integrated conjugative elements is recA independent. J. Bacteriol. 179:6221-6227.[Abstract/Free Full Text]
6 - Crump, E. M., M. B. Perry, S. C. Clouthier, and W. W. Kay. 2001. Antigenic characterization of the fish pathogen Flavobacterium psychrophilum. Appl. Environ. Microbiol. 67:750-759.[Abstract/Free Full Text]
7 - Dalsgaard, I. 1993. Virulence mechanisms in Cytophaga psychrophila and other Cytophaga-like bacteria pathogenic for fish. Annu. Rev. Fish Dis. 3:127-144.
8 - Del Cerro, A., M. C. Mendoza, and J. A. Guijarro. 2002. Usefulness of a TaqMan-based polymerase chain reaction assay for the detection of the fish pathogen Flavobacterium psychrophilum. J. Appl. Microbiol. 93:149-156.[CrossRef][Medline]
9 - Garcia, C., F. Pozet, and C. Michel. 2000. Standardization of experimental infection with Flavobacterium psychrophilum, the agent of rainbow trout Onchorhynchus mykiss fry syndrome. Dis. Aquat. Org. 42:191-197.[Medline]
10 - Holt, R. A. 1987. Cytophaga psychrophila, the causative agent of bacterial coldwater disease in salmonid fish. Ph.D. thesis. Oregon State University, Corvallis.
11 - Kempf, M. J., and M. J. McBride. 2000. Transposon insertions in the Flavobacterium johnsoniae ftsX gene disrupt gliding motility and cell division. J. Bacteriol. 182:1671-1679.[Abstract/Free Full Text]
12 - MacLean, L. L., E. Vinogradov, E. M. Crump, M. B. Perry, and W. W. Kay. 2001. The structure of the lipopolysaccharide O-antigen produced by Flavobacterium psychrophilum (259-93). Eur. J. Biochem. 268:2710-2716.[Medline]
13 - Madsen, L., and I. Dalsgaard. 1998. Characterization of Flavobacterium psychrophilum; comparison of proteolytic activity and virulence of strains isolated from trout (Oncorhynchus mykiss), p. 45-52. In A. C. Barnes, G. A. Davidson, M. P. Hiney, and D. McIntosh (ed.), Methodology in fish disease research. Fisheries Research Service, Aberdeen, Scotland.
14 - Mahan, M. J., J. W. Tobias, J. M. Slauch, P. C. Hanna, R. J. Collier, and J. J. Mekalanos. 1995. Antibiotic-based selection for bacterial genes that are specifically induced during infection of a host. Proc. Natl. Acad. Sci. USA 92:669-673.[Abstract/Free Full Text]
15 - McBride, M. J., and S. A. Baker. 1996. Development of techniques to genetically manipulate members of the genera Cytophaga, Flavobacterium, Flexibacter, and Sporocytophaga. Appl. Environ. Microbiol. 62:3017-3022.[Abstract]
16 - McBride, M. J., and M. J. Kempf. 1996. Development of techniques for the genetic manipulation of the gliding bacterium Cytophaga johnsonae. J. Bacteriol. 178:583-590.[Abstract/Free Full Text]
17 - Metcalf, W. W., W. Jiang, and B. L. Wanner. 1994. Use of the rep technique for allele replacement to construct new Escherichia coli hosts for maintenance of R6K
origin plasmids at different copy numbers. Gene 138:1-7.[CrossRef][Medline]
18 - Michel, C., D. Antonio, and R. P. Hedrick. 1999. Production of viable cultures of Flavobacterium psychrophilum approach and control. Res. Microbiol. 150:351-358.[Medline]
19 - Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
20 - Ostland, V. E., P. J. Byrne, G. Hoover, and H. W. Ferguson. 2000. Necrotic myositis of rainbow trout, Oncorhynchus mykiss (Walbaum): proteolytic characteristics of a crude extracellular preparation from Flavobacterium psychrophilum. J. Fish Dis. 23:329-336.[CrossRef]
21 - Salyers, A. A., N. Shoemaker, A. Cooper, J. D'Elia, and J. A. Shipman. 1999. Genetic methods for Bacteroides species, p. 229-249. In M. C. M. Smith and R. E. Sockett (ed.), Genetic methods for diverse prokaryotes. Academic Press, London, United Kingdom.
22 - Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
23 - Secades, P., B. Alvarez, and J. A. Guijarro. 2001. Purification and characterization of a psychrophilic calcium induced, growth-phase-dependent metalloprotease from the fish pathogen Flavobacterium psychrophilum. Appl. Environ. Microbiol. 67:2436-2444.[Abstract/Free Full Text]
24 - Shoemaker, N. B., C. Getty, J. F. Gardner, and A. A. Salyers. 1986. Tn4351 transposes in Bacteroides spp. and mediates the integration of plasmid R751 into the Bacteroides chromosome. J. Bacteriol. 165:929-936.[Abstract/Free Full Text]
25 - Simon, R., U. Priefer, and A. Puhler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram-negative bacteria. Bio/Technology 1:784-791.[CrossRef]
26 - Singleton, P., and A. E. Anson. 1983. Effect of pH on conjugal transfer at low temperatures. Appl. Environ. Microbiol. 46:291-292.[Abstract/Free Full Text]
27 - Su, H., Z. Shao, L. Tkalec, F. Blain, and J. Zimmermann. 2001. Development of a genetic system for the transfer of DNA into Flavobacterium heparinum. Microbiology 147:581-589.[Abstract/Free Full Text]
28 - Thieringer, H. A., P. G. Jones, and M. Inouye. 1998. Cold shock and adaptation. Bioessays 20:49-57.[CrossRef][Medline]
29 - Toyama, T., K. Kita-Tsukamoto, and H. Wakabayashi. 1994. Identification of Cytophaga psychrophila by PCR targeted 16S ribosomal RNA. Fish Pathol. 29:271-275.
30 - Urdaci, M. C., C. Chakroun, D. Faure, and J.-F. Bernardet. 1998. Development of a polymerase chain reaction assay for identification and detection of the fish pathogen Flavobacterium psychrophilum. Res. Microbiol. 149:519-530.[Medline]
31 - Wiklund, T., L. Madsen, M. S. Bruun, and I. Dalsgaard. 2000. Detection of Flavobacterium psychrophilum from fish tissue and water samples by PCR amplification. J. Appl. Microbiol. 88:299-307.[CrossRef][Medline]
Applied and Environmental Microbiology, January 2004, p. 581-587, Vol. 70, No. 1
0099-2240/04/$08.00+0 DOI: 10.1128/AEM.70.1.581-587.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Groot, M. N., Nieboer, F., Abee, T.
(2008). Enhanced Transformation Efficiency of Recalcitrant Bacillus cereus and Bacillus weihenstephanensis Isolates upon In Vitro Methylation of Plasmid DNA. Appl. Environ. Microbiol.
74: 7817-7820
[Abstract]
[Full Text]
-
Mally, M., Cornelis, G. R.
(2008). Genetic Tools for Studying Capnocytophaga canimorsus. Appl. Environ. Microbiol.
74: 6369-6377
[Abstract]
[Full Text]
-
Nicolas, P., Mondot, S., Achaz, G., Bouchenot, C., Bernardet, J.-F., Duchaud, E.
(2008). Population Structure of the Fish-Pathogenic Bacterium Flavobacterium psychrophilum. Appl. Environ. Microbiol.
74: 3702-3709
[Abstract]
[Full Text]
-
Alvarez, B., Alvarez, J., Menendez, A., Guijarro, J. A.
(2008). A mutant in one of two exbD loci of a TonB system in Flavobacterium psychrophilum shows attenuated virulence and confers protection against cold water disease. Microbiology
154: 1144-1151
[Abstract]
[Full Text]
-
Chen, S., Bagdasarian, M., Kaufman, M. G., Bates, A. K., Walker, E. D.
(2007). Mutational Analysis of the ompA Promoter from Flavobacterium johnsoniae. J. Bacteriol.
189: 5108-5118
[Abstract]
[Full Text]
-
Chen, S., Bagdasarian, M., Kaufman, M. G., Walker, E. D.
(2007). Characterization of Strong Promoters from an Environmental Flavobacterium hibernum Strain by Using a Green Fluorescent Protein-Based Reporter System. Appl. Environ. Microbiol.
73: 1089-1100
[Abstract]
[Full Text]
-
Alvarez, B., Secades, P., Prieto, M., McBride, M. J., Guijarro, J. A.
(2006). A Mutation in Flavobacterium psychrophilum tlpB Inhibits Gliding Motility and Induces Biofilm Formation.. Appl. Environ. Microbiol.
72: 4044-4053
[Abstract]
[Full Text]
-
Soule, M., Cain, K., LaFrentz, S., Call, D. R.
(2005). Combining Suppression Subtractive Hybridization and Microarrays To Map the Intraspecies Phylogeny of Flavobacterium psychrophilum. Infect. Immun.
73: 3799-3802
[Abstract]
[Full Text]