![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Applied and Environmental Microbiology, October 2004, p. 5973-5979, Vol. 70, No. 10
0099-2240/04/$08.00+0 DOI: 10.1128/AEM.70.10.5973-5979.2004
Elizabeth Fischer,2 Jonathan G. Krum,1 and Patricia A. Rosa1
Laboratory of Human Bacterial Pathogenesis,1 Laboratory of Intracellular Parasites, Rocky Mountain Laboratories, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Hamilton, Montana2
Received 19 March 2004/ Accepted 10 June 2004
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionAddendum in proofReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionAddendum in proofReferences |
|---|
An efficient and random mutagenesis system would facilitate functional identification of the large number of unknown ORFs identified in the genome sequence of B. burgdorferi (8, 12). Some transposon systems are capable of achieving saturation mutagenesis and are nearly random in their insertion sites, and the mutated locus is marked by the transposon insertion and therefore easily identified. Specifically, transposons of the mariner family have been used successfully for mutagenesis of a diverse range of organisms, including eukaryotes, archaea, and both gram-positive and gram-negative bacteria (1, 14, 16, 21, 29). The mariner elements do not require host cofactors for transposition, likely contributing to their wide host range (15). Further, mariner transposition is virtually random, requiring only a TA dinucleotide for target specificity. In addition, Lampe and colleagues derived hyperactive transposase mutants of Himar1 (a member of the mariner family), increasing the efficiency of transposition in heterologous hosts (16).
The advantages of the Himar1 element led us to adapt it for transposon mutagenesis in B. burgdorferi. Using this transposon mutagenesis system, we screened for factors affecting the growth rate of B. burgdorferi, as many aspects of spirochete physiology and morphology remain unknown. Analysis of mutants indicated that transposition was random and could achieve saturating levels from a single transformation. The high levels of transposon mutagenesis in B. burgdorferi, combined with a screen for mutants with slower growth rates, readily identified mutations in genes putatively involved in cell division and chemotaxis and a hypothetical ORF affecting outer membrane integrity. These results identify previously uncharacterized B. burgdorferi ORFs involved in spirochete morphology and physiology and establish the foundations for developing transposon mutagenesis in infectious strains of the Spirochaetes.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionAddendum in proofReferences |
|---|
Construction of pMarGent.
David Lampe, Duquesne University, generously provided two hyperactive alleles of the Himar1 transposase, designated C9 and A7 (16). The genes encoding the transposase were fused to the B. burgdorferi flgB promoter by using PCR to incorporate unique restriction sites, as previously described by Bono et al. (6).
Vector pMarGent (Fig. 1) was constructed for delivery of the transposon on a suicide vector in B. burgdorferi. The inverted terminal repeats (binding sites for the transposase, shown in bold below) were incorporated into primers ITR.Flg(5'-GCGGCCGCTAACAGGTTGGCTGATAAGTCCCCGGTCTGCCCTAGGTAATACCCGAGC) and ITR.ColE1.RC (5'-GCGGCCGCTAACAGGTTGGCTGATAAGTCCCCGGTCTCCTAAGGATGAACTTGCCG), which were used for amplifying the ColE1 origin of replication together with the gentamicin-resistance cassette from pBSV2G (10). Primers ITR.Flg and ITR.ColE1.RC also included NotI restriction enzyme sites (underlined) used to produce compatible ends and circularize the PCR fragment. Finally, the C9 or A7 alleles encoding the hyperactive Himar1 transposase, fused to the borrelial flgB promoter, were cloned into the NotI restriction site, producing pMarGent (Fig. 1). The transposon portion of pMarGent (Fig. 1) confers the ability to replicate in E. coli only, but the gentamicin-selectable marker confers resistance in both E. coli and B. burgdorferi.
|
Electroporation of B. burgdorferi and DNA isolation from transformants.
B. burgdorferi strains were transformed by electroporation with 20 µg of pMarGent (23, 24). Transformants were plated in the presence of 40 µg of gentamicin/ml. B. burgdorferi colonies grown on selective media were screened for the gentamicin resistance cassette by PCR, as previously described (24). Colonies positive by PCR analysis were aspirated from the agarose plate with sterile Pasteur pipettes, transferred to liquid BSK, and incubated at 35°C until the culture density reached >108 cells/ml.
Total genomic DNA was isolated from 5- to 10-ml cultures by using the Wizard genomic DNA purification kit (Promega, Madison, Wisc.) or by repeated phenol-chloroform extractions followed by ethanol precipitation. Genomic DNA was separated on a 0.3% 1x Tris-acetate-EDTA agarose gel to resolve intact DNA replicons (restriction-digested DNA was separated on a 0.7% 0.5x Tris-borate-EDTA agarose gel) and visualized by ethidium bromide staining. Gel electrophoresis and Southern hybridization analysis were carried out as previously described (22, 24). The plasmid contents of transposon mutants were determined by PCR (11).
Screen for growth rate phenotypes.
B. burgdorferi transformants were visually scored for altered colony morphology (i.e., compact versus diffuse colony shape) or delayed colony formation (i.e., transformants that arose at least 4 days after other colonies became visible). Selected transformants were aspirated with sterile Pasteur pipettes and transferred to liquid BSK medium containing 40 µg of gentamicin/ml. Those transformants that grew slower in liquid than the wild type were selected for further characterization (see below).
Microscopic characterization of transformants.
Mutants were visually examined by dark-field and scanning electron microscopy. Cells for scanning electron microscopy studies were allowed to settle on poly-L-lysine-coated Thermanox coverslips (Nunc, Naperville, Ill.) for 30 min and then fixed with 2.5% glutaraldehyde-4% paraformaldehyde in 0.1 M sodium cacodylate-0.1 M sucrose buffer for 2 h. Samples were postfixed for 1 h with 1% osmium tetroxide and dehydrated in a graded ethanol series. The samples were critical point dried under CO2 in a Bal-Tec (Balzers, Liechtenstein) model CPD 030 dryer, mounted on aluminum studs, and sputter coated with 100 Å of iridium in a model IBS/TM200S ion beam sputterer (South Bay Technologies, San Clemente, Calif.). Samples were viewed at 5 kV in an S-4500 field emission scanning electron microscope (Hitachi, Tokyo, Japan). The images were captured with Orion version 6.01 software (Focused Resolutions, Inc., Methuen, Mass.) and processed using Photoshop version 7 (Adobe Systems, Mountain View, Calif.).
Transposon recovery in E. coli.
Vector pMarGent was constructed such that the transposon and B. burgdorferi DNA flanking the insertion site could be rescued easily in E. coli (Fig. 1 and 2). The recovery strategy entailed digestion of total genomic DNA with HindIII, a restriction enzyme with cleavage sites that were frequent throughout B. burgdorferi genomic DNA but absent from the transposon. Digested DNA was self ligated, transformed into E. coli, and plated in the presence of 5 µg of gentamicin/ml. Only circularized DNA containing the ColE1 origin of replication and the gentamicin resistance marker (carried on the transposon) would successfully transform E. coli. Specifically, 500 ng of total genomic DNA from B. burgdorferi transformants was digested with HindIII and ligated in a 10- to 15-µl volume at room temperature for >4 h (Fig. 2). Transposon insertions along with B. burgdorferi flanking DNA were recovered by transforming 5 µl of the ligation reaction mixture into chemically competent E. coli TOP10 cells (Invitrogen). Individual E. coli transformants were inoculated into 5-ml cultures, and plasmid DNA was isolated using the Qiaprep Spin Miniprep kit (QIAGEN, Valencia, Calif.). Primers Col (5'-CAGCAACGCGGCCTTTTTACG) and Flg (5'-TTTTTTGTTTGTTTTAAAAT) were used to sequence out from the transposon into the flanking B. burgdorferi DNA (Fig. 1). Sequences were identified using the BLAST nucleotide algorithm from the National Center for Biotechnology Information (27).
|
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionAddendum in proofReferences |
|---|
Initial attempts to constitutively express the Himar1 transposase by introduction on shuttle vector pBSV2 failed (24; data not shown), possibly because overexpression of the transposase was lethal to B. burgdorferi. Therefore, we constructed a suicide vector in which the transposase would be transiently expressed from a strong borrelial promoter (flgBp). Use of this vector should allow sufficient expression of the transposase for transposition to occur but presumably avoid problems related to constitutive expression. For this purpose, vector pMarGent (Fig. 1) was constructed for transient expression of the transposase. The transposon (mobile element) portion of pMarGent is shown in Fig. 2 and consists of the inverted terminal repeats flanking a gentamicin-selectable marker and a ColE1 origin of replication. Once transposition had occurred, the transposase gene would be left on a fragment of foreign DNA and presumably degraded by cellular nucleases, enhancing the likelihood of a single transposition event per cell. Placement of ColE1 between the inverted repeats (i.e., within the transposon) allowed facile rescue in E. coli for subsequent characterization of the insertion site (Fig. 2; see Materials and Methods).
Transposition frequencies in B. burgdorferi strains.
Derivatives of pMarGent constructed with either the A7 or C9 hyperactive transposase alleles were used in parallel for all transformations. Transpositions of the A7 and C9 alleles occurred at approximately the same frequency in B. burgdorferi (data not shown). Mutagenesis of strain B31-AchbC72 resulted in a transformation frequency of 
5.5 x 10–5 (Table 1). Between 5,000 and 40,000 independent mutants were obtained per transformation, depending on the number of spirochetes surviving electroporation. Assuming a lower limit of 5,000 mutants per transformation and an approximate B. burgdorferi genome size of 1.52 Mbp (8), transposon insertions would occur, on average, every 300 bp. The ability of pMarGent to attain saturating levels of mutagenesis in B. burgdorferi is further supported by the Southern blot shown in Fig. 3B. Total genomic DNA was isolated from a transformation outgrowth (a mixed population of all mutants), digested with the restriction enzyme SpeI, blotted, and hybridized with the gentamicin resistance gene (aacC1). All visible restriction fragments hybridized with the probe, supporting a random, saturating mutagenesis (Fig. 3B, lane marked T.O.).
|
|
However, it was theoretically possible that additional plasmids, other than lp25 and lp56, impeded efficient transposition in B. burgdorferi. A3-89 cells in which transposition had occurred may have lost additional plasmids, most likely during growth and competence preparation, and these other plasmids may potentially encode barriers to transposition. Therefore, several A3-89 transposition mutants were randomly chosen and analyzed for their plasmid content; all retained the same plasmid composition as the parental A3-89 strain (data not shown). This result further supports the possibility that a barrier to efficient transposition is imposed by the restriction-modification systems encoded on lp25 and lp56 but not by other plasmids.
Characterization of transposon mutants.
Transposon mutants were characterized to determine the target site preferences. Genomic DNA was isolated from 12 randomly chosen transposon mutants. The transposon, along with flanking B. burgdorferi DNA, was recovered from E. coli and sequenced to identify the insertion site (Fig. 2). No additional consensus sequence was observed beyond the canonical TA dinucleotide target site (Table 2 and data not shown), indicating that transposition is random in B. burgdorferi. When the gene conferring gentamicin resistance (aacC1) was used as a probe, it hybridized to all B. burgdorferi DNA replicons isolated from a pMarGent transformation outgrowth (Fig. 3A, lane marked T.O.). Together, the results indicate that Himar1-mediated transposition targets both linear and circular DNA forms without preference (Fig. 3 and Table 2).
|
Genomic DNA from a subset of mutants analyzed by Southern blotting as shown in Fig. 3 was also probed with the labeled transposase gene. The probe hybridized only to the pMarGent vector DNA included as a positive control, indicating that once transposition had occurred, the remaining portion of the vector (including the transposase gene) was lost from the cell, as anticipated (data not shown).
Screen for growth rate mutants.
The utility of the pMarGent transposon system was demonstrated by designing a simple screen to identify mutations affecting growth, since many aspects of spirochete physiology and morphology remain unknown. A3-89 colonies that arose late or had compact colony morphologies (compared to the parental diffuse colony morphology) were selected for further characterization. Although many slow-growing mutants such as E-2 appeared normal, visual examination of mutants E-8 and D-5 by dark-field and electron microscopy revealed significant alterations in spirochete morphology. Rescue of the transposon in E. coli followed by sequencing identified the genetic loci disrupted. Mutant E-2 contained a transposon insertion into BB0414 (cheR-2), which encodes a putative methyltransferase protein. In other organisms, methyltransferases are involved in regulating the chemotactic response (9), but B. burgdorferi homologs have not been characterized. Elongated cells of mutant E-8 resulted from insertion of the transposon into BB0257, a putative cell division ORF (Fig. 4). The protein encoded by BB0257 has not been experimentally characterized, but by sequence similarity it was assigned to the FtsK/SpoIIIE family of proteins (12). Mutations in the FtsK/SpoIIIE family affect cell division and intercellular DNA transfer (5, 28). The third mutant, D-5, was significantly impaired in outer membrane integrity (Fig. 4). The disrupted ORF, BB0323, is designated as a hypothetical open reading frame lacking database homologs but containing a LysM domain at the carboxy terminus. The LysM domain is a peptidoglycan-binding module present in a variety of different bacterial proteins (4). These three mutants, and potentially others identified in this screen, represent new inroads into spirochete physiology and warrant further investigation to complete our understanding of their functions.
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionAddendum in proofReferences |
|---|
The pMarGent system allows for random-tagged, saturating mutagenesis in B. burgdorferi. Transposition in high- and low-passage-number strains occurs at near saturating levels, with an insertion occurring, on average, every 300 bp. Construction of pMarGent was designed for easy recovery of the transposon and flanking Borrelia DNA sequences in E. coli, allowing rapid identification of the insertion site. Characterization of mutants, by Southern blot analysis and sequencing of recovered transposons, supports a single transposition event per cell (Fig. 3, Table 2, and data not shown). The utility of this mutagenesis system was demonstrated by applying a straightforward screen for mutants with altered growth rates. The mutants isolated by using this screen included those impaired in cell division, chemotaxis, and morphology.
The morphology and mechanism(s) of motility of spirochetes are unusual. Comparison of the three sequenced spirochete genomes (those of B. burgdorferi, T. pallidum, and L. interrogans) reveals that chemotaxis and motility genes represent a significant portion of the total genome of these organisms (over 5% for B. burgdorferi and T. pallidum) (8, 12, 13, 19). One reason for this substantial dedication of genetic and cellular machinery to directed motion might relate to survival and growth within the organisms' eukaryotic hosts. B. burgdorferi, however, must survive in both the mammalian host and the tick vector. The presence, then, of an additional chemotaxis operon in B. burgdorferi, not found in either of the other two spirochetes, may relate to motility in two very different eukaryotic environments (9). Likewise, a duplicated set of sensory transducing homologs in B. burgdorferi, including a cheR-2 homolog, may also pertain to nutrient acquisition in different hosts (9). The transposon mutagenesis system presented here, combined with a screen for slower growth rates, identified an insertion in cheR-2 (BB0414), which encodes a methyltransferase involved in regulating the chemotactic response. The cheR-2 mutant should be useful for studying the function of this additional copy of the methyltransferase, as T. pallidum, L. interrogans, and most other bacteria contain only a single copy.
This screen also identified a slow-growing mutant with a transposon insertion in a putative cell division ORF (BB0257). As shown in Fig. 4, the BB0257 mutant forms long chains of incompletely separated spirochetes, suggesting a defect in cell division. This result represents the first experimental support for the role of BB0257 in cell division. BB0257 has similarity to cell division genes in other organisms, including the E. coli ftsK gene. A mutation in ftsK blocks cell division but allows DNA replication (5). If the BB0257 mutant has a similar phenotype, then it will be a useful strain for studying DNA location and segregation in B. burgdorferi, an issue that remains largely unaddressed.
An insertion into the hypothetical ORF BB0323 resulted in a dramatic defect in outer membrane integrity. Electron micrographs of BB0323 mutant cells reveal spirochetes with ruptured outer membranes that often form enormous blebs (Fig. 4). Few individual spirochetes were observed, suggesting that there may be an aborted fission phenotype associated with this mutation. The Institute for Genomic Research annotation of this gene (http://www.tigr.org/tigr-scripts/CMR2/GenomePage3.spl?database=gbb) recognizes a conserved lysin motif, designated LysM and present in a number of eukaryotic and prokaryotic proteins. This widespread motif apparently corresponds to a domain with general peptidoglycan-binding functions and includes proteins involved in cell wall degradation, binding and anchoring IgG to avoid the host immune system, and attachment to host cells (4). The function of the BB0323 ORF remains unknown, but the transposon insertion has a significant impact on the ability of B. burgdorferi cells to grow as individual spirochetes and form an intact outer membrane. Investigation into the function of the BB0323 product may elucidate a new protein function, perhaps necessary for critical outer membrane interactions with mammalian and tick hosts.
Although these transposon mutants were generated in A3-89, a noninfectious strain lacking lp25, infectivity can be assessed in this genetic background. As demonstrated by Purser and colleagues, reintroduction of the BBE22 product is sufficient to restore murine infectivity in lp25– strains (18). Therefore, the effect on infectivity of a specific transposon mutation can be tested by reintroduction of BBE22 and complementation with a wild-type copy of the mutated ORF. Complementation would ensure that the observed phenotypes of these mutants are directly linked to the disrupted locus, as transposon insertions may have polar effects on flanking genes.
Use of the pMarGent transposon system, in conjunction with a screen for slower growth rates, identified several previously uncharacterized genes that warrant further investigation and may enhance our understanding of spirochete cell division, chemotaxis, and spirochete membrane structure. This transposon system indicates the utility of the Himar1 element for mutagenesis in other spirochetes and provides the foundation for identifying B. burgdorferi loci relevant to pathogenesis, infectivity, and transmission in the tick vector and the mammalian host.
|
ADDENDUM IN PROOF |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionAddendum in proofReferences |
|---|
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Present address: Department of Microbiology, University of Washington, Seattle, WA 98195.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionAddendum in proofReferences |
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | Microbiol. Mol. Biol. Rev. | Eukaryot. Cell | All ASM Journals |
|---|
