AEM
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huergo, L. F.
Right arrow Articles by Pedrosa, F. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huergo, L. F.
Right arrow Articles by Pedrosa, F. O.
Agricola
Right arrow Articles by Huergo, L. F.
Right arrow Articles by Pedrosa, F. O.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, October 2004, p. 6320-6323, Vol. 70, No. 10
0099-2240/04/$08.00+0     DOI: 10.1128/AEM.70.10.6320-6323.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

SHORT REPORT

Repressor Mutant Forms of the Azospirillum brasilense NtrC Protein

Luciano F. Huergo, Marcelo C. Assumpção, Emanuel M. Souza, M. Berenice R. Steffens, M. Geoffrey Yates, Leda S. Chubatsu, and Fábio O. Pedrosa*

Department of Biochemistry and Molecular Biology, Universidade Federal do Paraná, Curitiba, Paraná, Brazil

Received 19 February 2004/ Accepted 10 June 2004

ABSTRACT

The Azospirillum brasilense mutant strains FP8 and FP9, after treatment with nitrosoguanidine, showed a null Nif phenotype and were unable to use nitrate as their sole nitrogen source. Sequencing of the ntrC genes revealed single nucleotide mutations in the NtrC nucleotide-binding site. The phenotypes of these strains are discussed in relation to their genotypes.

Nitrogen fixation is an energy-intensive process involving the hydrolysis of at least 16 Mg2+-ATP ions per N2 molecule reduced (13). Moreover, nitrogenase is a very slow enzyme, necessitating synthesis of high concentrations of the individual proteins in the cel1 (18). Both activity and synthesis are tightly regulated by O2 and NH4+. A cascade of interacting proteins, named the ntr system, coordinates nitrogen metabolism in bacteria (10). The ntr system has been extensively studied in enteric bacteria such as Escherichia coli and Klebsiella pneumoniae, and a similar cascade seems to operate in the nitrogen-fixing bacterium Azospirillum brasilense, which associates with and enhances the growth of important graminae (17). The NtrB protein is a sensor kinase or phosphatase that controls the activity of the response regulator protein NtrC. Under limiting ammonium levels, phosphorylated NtrC forms oligomers that bind to the enhancer sequence of the target genes, contacts the {sigma}N-RNA polymerase holoenzyme, and catalyzes the ATP-dependent isomerization of closed complexes to transcriptionally productive open complexes (14). The study of the regulation of nitrogen fixation in A. brasilense began with the isolation of mutants defective in nitrogen fixation (nif mutants). Pedrosa and Yates (12) isolated A. brasilense mutant strains after treatment with nitrosoguanidine. The strains FP8 and FP9 showed a Nif phenotype and were also unable to grow on nitrate as the sole nitrogen source. These mutants were suggested to be ntrC mutants, since they were complemented with the ntrC gene from K. pneumoniae (12). Some years later, Liang and coworkers (8) and Machado and coworkers (9) showed that ntrC insertion mutants did not grow in medium containing nitrate but were able to fix nitrogen, showing nitrogenase levels equivalent to 60% of the level in the wild-type strain, results contrasting with the Nif-negative phenotypes of FP8 and FP9. Subsequent observations (2, 5) have shown that NtrC activates GlnB and GlnZ expression in A. brasilense; the GlnB protein is required for NifA activity (1, 4), and NifA activates all nif genes. GlnB is also involved in the ammonium-induced switching off of nitrogenase activity in A. brasilense (G. Klassen et al., unpublished results), and GlnZ is involved in the switching on after ammonium is depleted (6). Thus, NtrC has a key role in the control of both the synthesis and the activity of nitrogenase. In an attempt to understand the above-mentioned contrasting observations on the role of NtrC in A. brasilense, we have isolated and sequenced the ntrC genes of strains FP8 and FP9 and identified two unique mutations, which produced repressor NtrC mutant proteins. Our results indicate two residues in the Walker A motif essential for ATP binding and hydrolysis and for transcriptional activation of the A. brasilense NtrC protein. These repressor genes may inhibit nitrogen fixation by binding to the promoter region, blocking the {sigma}70 promoter of the glnB gene, and failing to activate the {sigma}N promoter.

Expression of the glnB gene in strain FP9.

The expression of the A. brasilense glnB gene, which codes for the GlnB protein, was assayed in both the wild-type strain FP2 and the mutant strain FP9 by using a plasmid-borne glnB::lacZ transcriptional fusion, pLHWglnB (5) (Table 1). Expression of the glnB promoter gene in the wild-type strain FP2 was induced under nitrogen-limiting conditions, but no induction was observed under this condition in strain FP9, confirming the results of previous studies (4, 5). Expression of the glnB gene in A. brasilense occurs through two distinct promoters, glnBp1-{sigma}70 and glnBp2-{sigma}N (3). At high fixed nitrogen levels, glnB is transcribed from glnBp1-{sigma}70; however, a much more effective transcription occurs from glnBp2-{sigma}N under nitrogen limitation (3). Our previous report (5) showed that the expression of glnB in an ntrC mutant background occurred at high levels and was not controlled by the nitrogen levels, giving rise to the suggestion that glnBp1-{sigma}70 is down-regulated by the NtrC protein (two putative NtrC binding sequences overlap this promoter) and that glnBp2-{sigma}N is activated by the phosphorylated form of NtrC (5). Since the phenotype of strain FP9 was complemented by the ntrC gene (9, 12), we suspected that this strain produced a mutant form of the NtrC protein that repressed the glnBp1-{sigma}70 promoter and failed to activate the glnBp2-{sigma}N promoter. A class of NtrC mutant proteins, known as NtrC repressor or NtrC(rep) proteins, were previously characterized for Salmonella enterica serovar Typhimurium as proteins that repress glnA transcription (7, 11, 15, 19, 20). As GlnB is required in A. brasilense for the activation of the NifA protein, the low level of GlnB expression is probably responsible for the Nif phenotype in FP9 (4). In contrast, in the insertional mutant, the lack of NtrC relieves transcription from the glnBp1-{sigma}70 promoter, leading to NifA activation and nitrogenase expression.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Expression of plasmid-borne glnB-lacZ fusions in A. brasilense under different physiological conditionsa

 
Effect of FP9 ntrC expression on nitrate growth and nitrogenase activity.

To determine if the FP9 phenotype was caused by a mutation in the ntrC gene, this gene was cloned and expressed in the wild-type and ntrC mutant A. brasilense strains. ThentrC gene from the FP9 strain was amplified with FP9 genomic DNA as the template and two specific primers: NtrC1 (5' CTACGCAAGTAATGCTGC 3') and NtrC4 (5' CGAGGAATCCCTGACAC 3'). The amplified DNA was treated with T4 DNA polymerase and then was cloned into the pCR4 vector (Blunt TOPO; Invitrogen), producing the plasmid pMA-tc9.1. The EcoRI fragment from the pMA-tc9.1 plasmid was then subcloned into the EcoRI site of the vector pLAFR3.18, and a plasmid that contained the FP9 ntrC gene under the control of the plac promoter was selected and named pLHFP9NTRC. This plasmid was transferred to the wild-type strain FP2 and to the ntrC insertional mutant strain LHNTRC5 (5). The transconjugants were tested for growth in a medium containing nitrate as the sole nitrogen source. The wild-type A. brasilense FP2 strain expressing the ntrC gene from the FP9 strain was unable to grow using nitrate as its nitrogen source (not shown), a characteristic phenotype of all A. brasilense ntrC mutants (8, 9, 12). The nitrogenase activity of transconjugant A. brasilense strains harboring the pLHFP9NTRC plasmid was also determined (Fig. 1). The results show that the expression of the ntrC gene from the FP9 strain caused a dramatic effect (sixfold reduction) of the nitrogenase activity of the wild-type strain FP2. In the ntrC insertional mutant LHNTRC5, the nitrogenase activity was half of that observed in the wild-type strain, confirming the results of previous studies (8, 9). However, the introduction of the pLHFP9NTRC plasmid into the LHNTRC5 strain leads to a Nif phenotype similar to that observed in the FP9 strain, almost zero nitrogenase activity (12). These results suggest that the product of the ntrC gene of FP9 is the cause of the Nif null phenotype. They also indicate that the NtrC protein from FP9 has a negative dominant effect over wild-type NtrC when it is expressed from the plac promoter in a low-copy-number plasmid (pLAFR3.18), possibly because FP9 NtrC outcompetes native NtrC due to gene dosage. The opposite effect was achieved by K. pneumoniae NtrC when strains FP8 an FP9 were complemented for nitrogenase activity (12). As observed by others (8, 9), ntrC is not required for nitrogen fixation in A. brasilense (Fig. 1), so the reduction in nitrogenase activity observed in the LHNTRC5 ntrC insertional mutant was probably due to a lower level of glnB gene expression (5). The null Nif activity in this transformed strain was due to a lack of native NtrC to compete against FP9 NtrC.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 1. Effect of the expression of the FP9 ntrC gene on the nitrogenase activity of strains FP2 (wild type) and LHNTRC5 (ntrC). Transconjugant cells were grown in NFbHP semisolid medium (12) for 24 to 30 h and then assayed for ethylene reduction as described previously (9). Average values ± standard deviations were calculated for three different transconjugant colonies assayed in duplicate in three independent experiments.

 
Expression of the nifR3 ntrBC operon.

In A. brasilense, the promoter region of the nifR3 ntrBC operon shares structural and sequential similarity with glnBp1, which is a {sigma}70 promoter overlapping the putative NtrC upstream activation sequence. The NtrC protein seems to repress this promoter (9). To determine the effect of FP9 NtrC on the expression of the A. brasilense nifR3 ntrBC operon, the plasmid pLHFP9NTRC was introduced into the A. brasilense strain HDK1 (chromosomal {Delta}nifR3 ntrBC-lacZ fusion [9]) and nifR3 ntrBC promoter activity was determined by assessing ß-galactosidase activity. The presence of the pLHFP9NTRC plasmid caused a significant decrease in nifR3 ntrBC promoter activity. With pLAFR3.18 (the control), A. brasilense HDK1 produced 2,547 ± 196 nmol of o-nitrophenol min–1 mg of protein–1 (average ± standard deviation) in the presence of 0.5 mM glutamate (nitrogen limitation) and 804 ± 37 nmol of o-nitrophenol min–1 mg of protein–1 in the presence of 20 mM ammonium chloride plus 0.5 mM glutamate (nitrogen excess). With pLHFP9NTRC, it produced 994 ±45 and 481 ± 30 nmol of o-nitrophenol min–1 mg of protein–1 in the presence of 0.5 mM glutamate and 20 mM ammonium chloride plus 0.5 mM glutamate, respectively (calculated from three different transconjugant colonies assayed in duplicate in three independent experiments). These results suggest that the ntrC gene from strain FP9 produced an NtrC protein that can bind to the NtrC upstream activation sequence and repress the {sigma}70 promoter of the nifR3 ntrBC operon.

Sequence analysis of the predicted NtrC proteins expressed from strains FP9 and FP8.

In order to determine the sequences of the ntrC genes from strains FP9 and FP8 (phenotypically similar to FP9) (12), the following strategy was used. The ntrC gene from strain FP9 was amplified from the plasmid pLHFP9NTRC with the reverse and universal primers, and the fragment obtained was sequenced directly. Five specific primers, as well as the reverse and universal primers, were used in the sequencing reactions. The primers used were NtrC2 (5' AAGCTGGACTTCCTCGA 3'), NtrC3 (5' GCGCTCCTGGACAAGAT 3'), NtrC6 (5' CGACGTGCTAATGCCGTT 3'), NtrCF (5' TGACCTCTTGCGAATAGAGC 3'), and NtrCR (5' CTTCGTCGCGATCAACATGG 3'). The FP9 mutation identified by sequencing the DNA insert of the pLHFP9NTRC plasmid was also confirmed by sequencing the PCR product obtained with the primers NtrC1 and NtrC4 by using a boiled culture of A. brasilense FP9 as a template. The FP8 ntrC sequence was obtained by directly sequencing a PCR product obtained with the primers NtrC1 and NtrC4 by using a boiled culture of A. brasilense FP8 as a template. Comparison of the FP9 ntrC sequence (GenBank accession no. AY502106) with the wild-type ntrC sequence (GenBank accession no. Z37984) indicated that the FP9 ntrC gene contains a single base change at position 520 of the coding sequence (G->A), producing a change of glycine 240 to aspartate (NtrCG240D). The comparison of the FP8 ntrC sequence (GenBank accession no. AY502105) also showed one base change at position 514 of the coding sequence (G->A), producing a change of glycine 238 to glutamic acid (NtrCG238E). These amino acid substitutions replaced glycine 238 or 240 in the proposed nucleotide-binding site of the NtrC protein, the Walker A motif, G235E236S237G238T239G240K241E242 (16) (Fig. 2). A replacement of the third glycine of the Walker A motif of S. enterica serovar Typhimurium NtrCG173N to asparagine produced a mutant NtrC protein with the repressor characteristic [NtrC(rep)] (20). This mutant protein showed a lower ATPase activity in solution and apparently was not able to bind ATP (20), although its DNA-binding capacity was not altered (11). Phosphorylated NtrC couples the energy of ATP hydrolysis to the unfavorable reaction of open complex formation. The A. brasilense NtrCG240D and NtrCG238E mutant proteins probably cannot efficiently bind or hydrolyze ATP and thus cannot support {sigma}N RNA polymerase holoenzyme open complex formation, since not only the size but also the negative charge of the new residues probably contributes to lowering the affinity of the NtrC Walker A motif for ATP. Our results suggest that the A. brasilense NtrCG240D (FP9) and NtrCG238E (FP8) mutant proteins maintained their DNA-binding capacity but were unable to activate transcription. These characteristics, typical of NtrC(rep) mutants, also explain why strain FP9 expresses low levels of glnB under ammonium-limiting conditions, since NtrCG240D represses expression from the {sigma}70 promoter and is unable to activate expression from the {sigma}N promoter.



View larger version (93K):
[in this window]
[in a new window]
 
FIG. 2. Alignment of the central domains of eight activators of the {sigma}N holoenzyme: Salmonella serovar Typhimurium NtrC (GenBank accession no. CAA59425; NtrC St), A. brasilense NtrC (GenBank accession no. Z37984) (NtrC Ab), K. pneumoniae NifA (GenBank accession no. P03027) (NifA Kp), Rhizobium leguminosarum DctD (GenBank accession no. P13632) (Dctd Rl), Alcaligenes eutrophus HoxA (GenBank accession no. A38533) (Hoxa Ae), Pseudomonas putida XylR (GenBank accession no. P06519) (Xylr Pp), Caulobacter crescentus FlbD (GenBank accession no. P17899) (Flbd Cc), and E. coli FhlA (GenBank accession no. BAA16379) (Fhla Ec). The alignments were generated by the Clustal W program; residues that are identical in at least six activators are white letters on a black background. The black lines indicate three functional determinants in the sequence: the Walker A and B motifs and the switch I region. Letters above the alignment designate all single amino acid substitutions in NtrC mutant proteins resulting in NtrC(Rep) proteins (original references are given in reference 4); the bold letters indicate the mutations found in this study (G238E in the A. brasilense FP8 NtrC protein and G240D in the A. brasilense FP9 NtrC protein).

 
In conclusion, the results reported here support the view that G240D and G238E mutations in the NtrC protein of A. brasilense strains FP9 and FP8, respectively, produced a strong transcription repressor protein responsible for the null Nif and nitrate growth phenotypes of these strains.

ACKNOWLEDGMENTS

We are grateful to Hidevaldo B. Machado for providing the HDK1 strain. We also thank Valter de Baura, Roseli Prado, and Julieta Pie for technical assistance.

This work was supported by PRONEX/CNPq/MCT, CNPq, CAPES, Fundação Araucária, and Paraná Tecnologia.


    FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biochemistry and Molecular Biology, Universidade Federal do Paraná, CP 19046, 81531-990, Curitiba, Paraná, Brazil. Phone: 55 41 366 4398. Fax: 55 41 266 2042. E-mail: fpedrosa{at}ufpr.br. Back

REFERENCES

  1. Araujo, L. M., R. A. Monteiro, E. M. Souza, M. B. R. Steffens, L. U. Rigo, F. O. Pedrosa, and L. S. Chubatsu. 2004. GlnB is specifically required for Azospirillum brasilense NifA activity in Escherichia coli. Res. Microbiol. 155:491-495.[Medline]
  2. de Zamaroczy, M. 1998. Structural homologues P(II) and P(Z) of Azospirillum brasilense provide intracellular signalling for selective regulation of various nitrogen-dependent functions. Mol. Microbiol. 29:449-463.[CrossRef][Medline]
  3. de Zamaroczy, M., F. Delorme, and C. Elmerich. 1990. Characterization of three different nitrogen-regulated promoter regions for the expression of glnB and glnA in Azospirillum brasilense. Mol. Gen. Genet. 224:421-430.[Medline]
  4. de Zamaroczy, M., A. Paquelin, and C. Elmerich. 1993. Functional organization of the glnB-glnA cluster of Azospirillum brasilense. J. Bacteriol. 175:2507-2515.[Abstract/Free Full Text]
  5. Huergo, L. F., E. M. Souza, M. B. Steffens, M. G. Yates, F. O. Pedrosa, and L. S. Chubatsu. 2003. Regulation of glnB gene promoter expression in Azospirillum brasilense by the NtrC protein. FEMS Microbiol. Lett. 223:33-40.[CrossRef][Medline]
  6. Klassen, G., E. M. Souza, M. G. Yates, L. U. Rigo, J. Inaba, and F. O. Pedrosa. 2001. Control of nitrogenase reactivation by the GlnZ protein in Azospirillum brasilense. J. Bacteriol. 183:6710-6713.[Abstract/Free Full Text]
  7. Li, J., L. Passaglia, I. Rombel, D. Yan, and S. Kustu. 1999. Mutations affecting motifs of unknown function in the central domain of the nitrogen regulatory protein C. J. Bacteriol. 181:5443-5454.[Abstract/Free Full Text]
  8. Liang, Y. Y., F. Arsene, and C. Elmerich. 1993. Characterization of the ntrBC genes of Azospirillum brasilense Sp7: their involvement in the regulation of nitrogenase synthesis and activity. Mol. Gen. Genet. 240:188-196.[CrossRef][Medline]
  9. Machado, H. B., M. G. Yates, S. Funayama, L. U. Rigo, M. B. R. Steffens, E. M. Souza, and F. O. Pedrosa. 1995. The ntrBC genes of Azospirillum brasilense are part of a nifR3-like-ntrB-ntrC operon and are negatively regulated. Can. J. Microbiol. 41:674-684.[Medline]
  10. Merrick, M. J., and R. A. Edwards. 1995. Nitrogen control in bacteria. Microbiol. Rev. 59:604-622.[Abstract/Free Full Text]
  11. North, A. K., D. S. Weiss, H. Suzuki, Y. Flashner, and S. Kustu. 1996. Repressor forms of the enhancer-binding protein NtrC: some fail in coupling ATP hydrolysis to open complex formation by {sigma}54-holoenzyme. J. Mol. Biol. 260:317-331.[CrossRef][Medline]
  12. Pedrosa, F. O., and M. G. Yates. 1984. Regulation of nitrogen fixation (nif) genes of Azospirillum brasilense by nifA and ntrC (glnG) type genes. FEMS Microbiol. Lett. 55:95-101.[CrossRef]
  13. Peters, J. W., K. Fisher, and D. R. Dean. 1995. Nitrogenase structure and function: a biochemical-genetic perspective. Annu. Rev. Microbiol. 49:335-366.[CrossRef][Medline]
  14. Porter, S. C., A. K. North, and S. Kustu. 1995. Mechanism of the transcription activation by NtrC. In J. A. Hoch and T. J. Silvahy (ed.), Two-component signal transduction. ASM Press, Washington, D.C.
  15. Rombel, I., P. Peters-Wendisch, A. Mesecar, T. Thorgeirsson, Y. Shin, and S. Kustu. 1999. MgATP binding and hydrolysis determinants of NtrC, a bacterial enhancer-binding protein. J. Bacteriol. 181:4628-4638.[Abstract/Free Full Text]
  16. Saraste, M., P. R. Sibbald, and A. Wittinghofer. 1990. The P-loop—a common motif in ATP- and GTP-binding proteins. Trends Biochem. Sci. 15:430-434.[CrossRef][Medline]
  17. Steenhoudt, O., and J. Vanderleyden. 2000. Azospirillum, a free-living nitrogen-fixing bacterium closely associated with grasses: genetic, biochemical and ecological aspects. FEMS Microbiol. Rev. 24:487-506.[CrossRef][Medline]
  18. Thorneley, R. N. F., and D. J. Lowe. 1985. Kinetics and mechanism of the nitrogenase enzyme system. In T. G. Spiro (ed.), Molybdenum enzymes. John Wiley and Sons, New York, N.Y.
  19. Wei, G. R., and S. Kustu. 1981. Glutamine auxotrophs with mutations in a nitrogen regulatory gene, ntrC, that is near glnA. Mol. Gen. Genet. 183:393-399.
  20. Weiss, D. S., J. Batut, K. E. Klose, J. Keener, and S. Kustu. 1991. The phosphorylated form of the enhancer-binding protein NtrC has an ATPase activity that is essential for activation of transcription. Cell 67:155-167.[CrossRef][Medline]


Applied and Environmental Microbiology, October 2004, p. 6320-6323, Vol. 70, No. 10
0099-2240/04/$08.00+0     DOI: 10.1128/AEM.70.10.6320-6323.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huergo, L. F.
Right arrow Articles by Pedrosa, F. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huergo, L. F.
Right arrow Articles by Pedrosa, F. O.
Agricola
Right arrow Articles by Huergo, L. F.
Right arrow Articles by Pedrosa, F. O.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. Microbiol. Mol. Biol. Rev. Eukaryot. Cell All ASM Journals