This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lara, M.
Right arrow Articles by Espitia, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lara, M.
Right arrow Articles by Espitia, C.
Agricola
Right arrow Articles by Lara, M.
Right arrow Articles by Espitia, C.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, February 2004, p. 679-685, Vol. 70, No. 2
0099-2240/04/$08.00+0     DOI: 10.1128/AEM.70.2.679-685.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Expression, Secretion, and Glycosylation of the 45- and 47-kDa Glycoprotein of Mycobacterium tuberculosis in Streptomyces lividans

Martha Lara,1 Luis Servín-González,2 Mahavir Singh,3 Carlos Moreno,4 Ingrid Cohen,1 Manfred Nimtz,3 and Clara Espitia1*

Departamento de Inmunología,1 Departamento de Biología Molecular, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, México D.F., México,2 GBF, German National Research Center for Biotechnology, Braunschweig, 38124 Braunschweig, Germany,3 Department of Bacteriology, Royal Free and University College Medical School, Windeyer Institute, London W1P 6DB, United Kingdom4

Received 22 May 2003/ Accepted 30 October 2003


arrow
ABSTRACT
 
The gene encoding the 45/47 kDa glycoprotein (Rv1860) of Mycobacterium tuberculosis was expressed in Streptomyces lividans under its own promoter and under the thiostrepton-inducible Streptomyces promoter PtipA. The recombinant protein was released into the culture medium and, like the native protein, migrated as a double band at 45 and 47 kDa in sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) gels. However, in contrast to the native protein, only the 47-kDa recombinant protein could be labeled with concanavalin A (ConA). Carbohydrate digestion with jack bean {alpha}-D-mannosidase resulted in a reduction in the molecular mass of the recombinant protein upper band and completely eliminated ConA binding. Two-dimensional gel electrophoresis revealed only one isoelectric point for the recombinant protein. Comparative fingerprinting analysis of the individually purified upper and lower recombinant protein bands, treated under the same conditions with specific proteases, resulted in similar peptide patterns, and the peptides had the same N-terminal sequence, suggesting that migration of the recombinant protein as two bands in SDS-PAGE gels could be due to differences in glycosylation. Mass spectrometry analysis of the recombinant protein indicated that as in native protein, both the N-terminal and C-terminal domains of the recombinant protein are glycosylated. Furthermore, it was determined that antibodies of human tuberculosis patients reacted mainly against the carbohydrate residues of the glycoprotein. Altogether, these observations show that expression of genes for mycobacterial antigens in S. lividans is very useful for elucidation of the functional role and molecular mechanisms of glycosylation in bacteria.


arrow
INTRODUCTION
 
Glycosylation is an important covalent modification of proteins. While eukaryotic glycoproteins have been characterized in detail, information about the structure, function, and biosynthetic pathways of prokaryotic glycoproteins is scarce. The list of known bacterial glycoproteins is growing, and the variety of components and structures observed indicates the importance of glycosylation in cell processes, as well as the potential role of glycosylation in pathogenesis (2, 23, 25).

Carbohydrates have been reported to be associated with antigenic proteins of pathogenic mycobacteria (7, 10, 11). The importance of carbohydrates attached to proteins in immune recognition has been demonstrated by the decreased capacity of the Mycobacterium tuberculosis 45/47 kDa recombinant protein (r45/47 kDa) to stimulate T-cell lymphocyte responses when its mannosylation pattern is changed (12, 32).

Until now, glycosylation of M. tuberculosis proteins has been confirmed only for the 45/47 kDa protein and for the Mycobacterium bovis MPB83 protein (Rv2873), in which chemical linkage between carbohydrate and protein was demonstrated (5, 24). The function of glycosylation of mycobacterial glycoproteins remains unknown. The 45/47 kDa protein corresponds to the Rv1860 sequence, which is encoded by a gene which has been annotated as modD in the M. tuberculosis genome sequence (GenBank accession no. X99258). This suggests that the 45/47 kDa protein could be part of a putative molybdenum transport system.

Proteins homologous to the 45/47 kDa protein have been found in M. bovis, Mycobacterium avium, Mycobacterium leprae, and Mycobacterium vaccae. All of these proteins have the ability to bind to fibronectin (31, 33, 34, 40).

The 45/47 kDa proteins from M. tuberculosis and M. bovis are immunodominant antigens which are secreted into the culture medium and migrate as glycosylated double bands in sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) gels (8). In the present study, the M. tuberculosis gene encoding the 45/47 kDa protein was expressed in Streptomyces lividans, a gram-positive, sporulating, mycelial bacterium which is not pathogenic. Streptomyces strains are a well-known source of antibiotics and are characterized by their capacity to produce secreted proteins (26, 30). In addition, like many other eubacteria, S. lividans has the ability to glycosylate its own proteins, as well as heterologous proteins (18, 21, 28). The ability to glycosylate cloned gene products enhances the usefulness of Streptomyces as a host for the production of heterologous polypeptides, and this system is a potent tool for studying glycosylation processes in bacteria. The existence of vectors for inducible protein expression in S. lividans allows production of large amounts of proteins suitable for immunological and biochemical characterization of glycoproteins. In this study we expressed the M. tuberculosis 45/47 kDa protein in S. lividans in order to assess the potential of the expression system for obtaining M. tuberculosis glycoproteins with vaccine and/or diagnostic potential.


arrow
MATERIALS AND METHODS
 
Bacterial strains and plasmids.
Escherichia coli XL1-Blue was used as a host for recombinant plasmids. The laboratory strain M. tuberculosis H37Rv was obtained from the American Type Culture Collection (Rockville, Md.). Wild-type S. lividans 1326 and the plasmid vectors pIJ486 and pIJ6021 (4) were obtained from D. A. Hopwood, John Innes Centre, Norwich, United Kingdom.

Isolation and cloning of the DNA region carrying the 45/47 kDa protein gene.
A cosmid clone carrying the M. tuberculosis gene for the 45/47 kDa protein was isolated by screening the Tropist3 DNA cosmid library of M. tuberculosis H37Rv (17); a PCR product corresponding to the amplified gene was used as the probe. DNA from the positive cosmid colony was enzyme restricted. Fragments were separated on 8% agarose gels and transferred by blotting onto nylon filters (Amersham). The filters were then prehybridized and probed at 42°C in 6x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate, pH 7.0) containing 1 mM sodium phosphate, 1 mM EDTA, 0.05% skim milk, and 0.5% SDS for 2 and 4 h, respectively. After this, the filters were washed twice in 2x SSC for 15 min each time and once in 2x SSC-0.3% SDS for 15 min and autoradiographed by exposing the filters to X-ray film (Kodak). A 3.2-kb EcoRI fragment from this cosmid clone was subcloned into the EcoRI site of pUC18 to obtain pUC18MT-45. This plasmid carried the complete gene for the 45/47 kDa protein, together with additional DNA on either side of the gene (1.1 kb upstream and 1.0 kb downstream).

Cloning and expression of the gene encoding the 45/47 kDa protein in S. lividans.
The 3.2-kb EcoRI fragment obtained from pUC18MT-45 was subcloned into the EcoRI site of the high-copy-number Streptomyces plasmid vector pIJ486 (4), resulting in plasmid pIJ486MT-45.

PCR amplification of a 983-bp fragment containing the complete 45/47 kDa protein gene was carried out with oligonucleotides CGGATCCATATGCATCAGGTGGACCC and GGAATTCAGGCCGGTAAGGTCC. The BamHI and NdeI restriction sites in the sense primer and the EcoRI site in the reverse primer (underlined) were included as extensions for further manipulation of the amplified fragments. In particular, the NdeI site (CATATG) was designed to contain the ATG start codon of the gene in order to allow cloning into the Streptomyces expression vector pIJ6021 (4). Amplification was carried out with Taq DNA polymerase (Perkin-Elmer) as recommended by the manufacturer. The PCR protocol consisted of an initial denaturation step of 5 min at 95°C, followed by 30 cycles of 1 min of denaturation at 95°C, 1 min of annealing at 50°C, and 1 min of extension at 72°C and then a 5-min final extension at 72°C. The PCR product was then digested with BamHI and EcoRI and subcloned into BamHI-EcoRI-cut pUC18 to obtain plasmid pUC18MT-45.1. To clone this fragment in the Streptomyces expression vector pIJ6021, pUC18MT-45.1 was digested with NdeI and EcoRI, and the 1-kb insert was subcloned into NdeI-EcoRI-cut pIJ6021 to obtain pIJ6021MT-45.

Growth of Streptomyces cultures.
Spores of S. lividans carrying the different plasmids were obtained on solid R5 medium (4) with the appropriate antibiotics. Freshly harvested spores were used to inoculate Luria-Bertani broth modified by addition of 34% sucrose to obtain dispersed mycelial growth. For growth of S. lividans harboring pIJ486MT-45, thiostrepton was added at a concentration of 50 µg/ml, and cultures were grown at 30°C for 72 h with shaking. For cultures carrying pIJ6021MT-45, kanamycin was added at a concentration of 100 µg/ml, and after 12 h of growth at 30°C, thiostrepton was added at a concentration of 10 µg/ml and growth was continued for an additional 24 to 36 h. Subsequently, recombinant culture filtrates (rCF) were obtained by removing the mycelium by centrifugation at 8,000 x g for 30 min at 4°C and filtration through Whatman no. 1 filter paper disks. Proteins were precipitated from the supernatant with ammonium sulfate (73% saturation), recovered by centrifugation, dialyzed against distilled H2O, and dried by lyophilization.

Growth of M. tuberculosis cultures.
M. tuberculosis H37Rv was cultured on Proskauer-Beck synthetic medium for 4 to 6 weeks. Culture filtrate (CF) proteins and a fraction enriched with the 45/47 kDa protein (F4) were obtained from CF as described elsewhere (6, 7).

Antibodies.
Monoclonal antibody 6A3 (MAb 6A3) raised against the 45/47 kDa protein was obtained as described previously (8). Rabbit polyclonal antiserum against a synthetic peptide (GEVAPTPTTPTPQRTLPAC) derived from the C-terminal sequence of the 45/47 kDa protein was produced in New Zealand rabbits. Animals were immunized subcutaneously on days 0 and 8 with 200 µg of purified peptide in incomplete Freund's adjuvant. Two weeks later they were boosted intraperitoneally with 100 µg of purified peptide, and then they were boosted every fortnight for 2 months. Two weeks after the last immunization the animals were bled, and the resulting antiserum was designated anti-C45.

Human sera.
Sera from patients with pulmonary tuberculosis diagnosed by smear and/or sputum culture were obtained from Hospital General in Mexico. Healthy control sera were obtained from laboratory workers.

SDS-PAGE and Western blotting.
Electrophoresis in 12% polyacrylamide gels containing SDS and subsequent immunoblotting procedures were carried out by using the standard methods (19, 38). Five-microgram portions of S. lividans rCF and M. tuberculosis F4 were electrophoresed in polyacrylamide gels. For antigen detection, proteins were transferred to polyvinylidene difluoride Immunobilon nylon membranes (Millipore) and incubated with MAb 6A3 and with anti-C45. For carbohydrate detection, proteins were stained with concanavalin A (ConA)-peroxidase (Sigma). Nonspecific binding was blocked by incubating blots with 1% (wt/vol) bovine serum albumin (BSA) in phosphate-buffered saline (PBS) containing Tween 20 (0.05%, vol/vol); after washes with PBS-Tween 20, the membranes were incubated for 1 h at room temperature (RT) with either MAb 6A3 diluted 1/500, anti-C45 diluted 1/2,000, or ConA (2.5 µg/ml). After washes with PBS-Tween 20, the membranes were incubated with peroxidase conjugates, anti-mouse immunoglobulin G diluted 1/2,000 (Zymed), or protein A (Sigma) diluted 1/2,000. After incubation for 30 min at RT, the blots were stained for peroxidase activity by adding 3,3-diaminobenzidine (Sigma) and hydrogen peroxide in PBS.

Two-dimensional PAGE was performed as follows. Urea was added to 10 µg of rCF from S. lividans transformed with pIJ486MT-45 at a final concentration of 9 M, and then lysis buffer containing urea and Nonidet P-40 was added as described by O'Farrell (27). Samples were separated initially by isoelectric focusing in tube gels containing 4% ampholytes in the pH range from 3.5 to 5.0 (Pharmacia) and then by SDS-PAGE in the second dimension as described above. Proteins were transferred to nylon membranes and incubated with MAb 6A3. Reactivity was developed as described above. Labeling of glycopropteins with biotin-hydrazide and jack bean {alpha}-D-mannosidase digestion were performed as described previously (8).

Purification of proteins.
The pH of rCF extract from S. lividans transformed with pIJ6021MT-45 was adjusted to 5 with acetic acid at 4°C, proteins were recovered by centrifugation at 8,000 x g for 10 min, and the pellet was resuspended in the appropriate buffer. The chromatography procedures were performed with an AKTA-Prime system (Pharmacia Biotech). The ConA-binding protein (47-kDa protein) was separated from the 45-kDa protein by affinity chromatography on a ConA-Sepharose column (Pharmacia Biotech); elution was carried out with a gradient of 0 to 0.05 M {alpha}-methyl-mannopyranoside (Sigma) (7). Flowthrough from the ConA column contained the 45-kDa protein, which was loaded onto a HiTrap Q-Sepharose column equilibrated with 20 mM Tris-HCl (pH 8). Elution was then carried out with a linear 0 to 1 M NaCl gradient. Fractions were collected, dialyzed, concentrated, and analyzed by SDS-PAGE. The r45/47 kDa protein was also purified by anion-exchange chromatography from pH 5 rCF supernatant by using the protocol described above. Protein quantification was carried out with a protein quantification kit (Bio-Rad).

Fingerprinting assay.
Digestion of individually purified recombinant 45- and 47-kDa proteins was performed with the protein fingerprint system (Promega) used according to the manufacturer's protocol. Briefly, 1 µg of purified fractions or 2.5 µg of the r45/47 kDa protein was diluted in electrophoresis cocktail and heat denatured by incubation at 95°C for 5 min. Then 5 µl (0.2 µg) of Lys-C and 5 µl (0.2 µg) of Glu-C were added to each sample; after digestion, samples were transferred to polyvinylidene difluoride nylon membranes after SDS-15% PAGE. Blots were stained with Coomassie blue, and the bands were cut out and subjected to automated Edman degradation with a gas phase sequencer (PE-Applied Biosystems, Weiterstadt, Germany).

Protein preparation for mass spectrometric analysis.
r45/47 kDa protein purified by anion-exchange chromatography was separated by SDS-PAGE. Individual 45- and 47-kDa bands were excised from the gel after Coomassie blue staining. The gel slides were washed several times with 200 µl of water, dehydrated in 50 µl of acetonitrile, and dried. Then the gel pieces were washed twice with 100 mM NH4HCO3, dehydrated with acetonitrile, and dried. Digestion of proteins was carried out in 50 mM NH4HCO3 containing 4 ng of trypsin (Promega Corp.) per µl at 37°C overnight (<15 h). The resulting peptides were extracted with 25 mM NH4HCO3-acetonitrile and then with 5% formic acid (HCOOH)-acetonitrile. After drying, the dried peptides were reconstituted in 20 µl of 0.5% HCOOH-5% methanol (MeOH). The peptides were then purified on reversed-phase C18 ZipTip pipette tips (Millipore Corp.). Briefly, ZipTips were washed with 0.5% HCOOH-65% MeOH and equilibrated with 0.5% HCOOH-5% MeOH. The peptides were applied to the ZipTips and eluted with 1.0% HCOOH-65% MeOH.

Matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry (MS) of tryptic peptides. A 0.5- to 1-µl portion of each concentrated peptide solution was mixed with the same volume of a saturated matrix solution of {alpha}-cyano-4-hydoxycinnamic acid (Bruker Daltonics) in 0.5% HCOOH-65%MeOH, spotted onto a 384 MTP target, and dried at RT. The molecular masses of the tryptic peptides were determined in the positive-ion mode with a Bruker Ultraflex TOF mass spectrometer (Bruker Daltonics GmbH, Leipzig, Germany) by using the reflectron and delayed extraction facilities for enhanced resolution, an N2 laser (337 nm) operating with a 3-ns pulse width and 107 to 108 W/cm2 at the surface of 0.2-mm2 spots, and an acceleration voltage of 25 kV.

Enzyme-linked immunosorbent assay (ELISA).
Polystyrene 96-well microtiter plates (Costar 3590) were coated with 100 µl of 2.5 µg of 45-kDa protein per ml, glycosylated 47-kDa protein, and jack bean {alpha}-mannosidase-treated 47-kDa protein in 0.05 M carbonate-bicarbonate buffer (pH 9.6) at 37°C overnight. The plates were blocked with 2% BSA in PBS-0.05% Tween 20 for 1 h at RT. Four human tuberculosis sera previously found to react against native 45/47 kDa protein and four healthy sera were chosen for the assay. One hundred microliters of a 1:100 dilution of each serum and a 1:1,000 dilution of MAb 6A3 were added to each well in triplicate in PBS-Tween 20-BSA and incubated for 1 h at RT. After the plates were washed with PBS-Tween 20-BSA, they were incubated with the appropriate horseradish conjugates diluted in PBS-Tween 20-BSA containing protein A diluted 1:2,000 and anti-mouse immunoglobulin G diluted 1:2,000. The plates were incubated for 1 h and then washed. Enzyme activity was assayed by incubation for 5 min at RT with 50 µl of o-phenylendiamine (Sigma). The reaction was stopped with 50 µl of 3 N HCl, and the optical density at 492 nm was determined with an automatic microtiter plate reader (Labsystem).


arrow
RESULTS
 
Expression of the 45/47 kDa protein gene of M. tuberculosis from its own promoter and from the PtipA promoter.
The M. tuberculosis gene encoding the 45/47 kDa protein was cloned in the Streptomyces vector pIJ486, resulting in pIJ486MT-45. Total extracellular protein from S. lividans carrying either pIJ486 or pIJ486MT-45 was electrophoresed on SDS-PAGE gels. The 45/47 kDa protein bands could not be clearly distinguished from those of S. lividans carrying only the vector (Fig. 1A, lanes 1 and 2). However, Western blot analysis showed that the gene was expressed in cultures of S. lividans carrying pIJ486MT-45 and that the 45/47 kDa protein was released into the medium (Fig. 1B, lane 2) (see below). Since in pIJ486MT-45 the cloned gene is located downstream of a transcriptional terminator (17), transcription must originate from a promoter present in the cloned fragment. Overexpression of the 45/47 kDa protein was achieved by cloning the gene in the expression vector pIJ6021 under the thiostrepton-inducible promoter PtipA, resulting in plasmid pIJ6021MT-45 (Fig. 1A, lane 4). Total extracellular protein from S. lividans carrying either pIJ6021 or pIJ6021MT-45 was analyzed by SDS-PAGE (Fig. 1A, lanes 3 and 4); it was evident that large amounts of the 45/47 kDa protein were secreted into the culture medium, where it represented about 25% of the total extracellular protein (Fig. 1A, lane 4).



View larger version (55K):
[in this window]
[in a new window]
  		FIG. 1. Expression of M. tuberculosis 45/47 kDa protein in S. lividans. (A) Coomassie blue-stained SDS-PAGE gel of rCF from S. lividans carrying different plasmids. Lane 1, pIJ486 control vector without insert; lane 2, pIJ486MT-45 recombinant vector; lane 3, pIJ6021 vector with thiostrepton-inducible Streptomyces promoter PtipA; lane 4, pIJ6021MT-45 recombinant vector. (B) Western blot of native and rCF proteins. Lanes 1 and 3, M. tuberculosis 45/47 kDa CF-enriched fraction (F4) as a positive control; lanes 2 and 4, rCF from S. lividans carrying pIJ486MT-45, which overexpressed the 45/47 kDa protein. Lanes 1 and 2 were developed with MAb 6A3, while lanes 3 and 4 were developed with anti-C45 polyclonal antibody. (C) Two-dimensional PAGE analysis of rCF from S. lividans carrying pIJ486MT-45. The blot was developed with MAb 6A3.

Characterization of recombinant proteins by SDS-PAGE and Western blotting.
CF protein extracts from S. lividans carrying pIJ486MT-45 were prepared and subjected to Western blot analysis with MAb 6A3 and anti-C45 rabbit polyclonal antibody. MAb 6A3 recognized a double band, which migrated slightly above the native protein from M. tuberculosis H37Rv in SDS-PAGE gels (Fig. 1B, lanes 1 and 2). The polyclonal anti-C45 antibody recognized only the 47-kDa upper band of the native protein and the 45-kDa lower band of the r45/47 kDa protein (Fig. 1B, lanes 3 and 4). When the recombinant protein was analyzed by two-dimensional gel electrophoresis, the upper and lower bands had identical acidic isoelectric points (Fig. 1C), in contrast to the native protein bands, which have been shown to migrate as several spots having different isoelectric points (8).

To determine whether the recombinant protein produced by S. lividans was able to bind to ConA, as previously described for the M. tuberculosis native 45/47 kDa protein (7, 8), rCF proteins were transferred to a nylon membrane after SDS-PAGE and incubated with ConA-peroxidase. Only the upper band showed positive staining with the lectin (Fig. 2A, lane 3). Accordingly, only this band showed an apparent reduction in molecular mass of about 0.5 kDa after digestion with {alpha}-D-mannosidase, which caused it to migrate at the same level as the lower band (Fig. 2A, lane 2). In addition, {alpha}-D-mannosidase digestion eliminated the ConA reactivity of the upper band (Fig. 2A, lane 4). To assess whether the recombinant lower band was glycosylated, recombinant and control S. lividans CF extracts were labeled with biotin-hydrazide after periodate oxidation and then transferred to a nylon membrane and incubated with streptavidine-peroxidase. Although several proteins in the S. lividans control CF were labeled with biotin-hydrazide, the r45/47 kDa bands could be clearly distinguished when the rCF was used. Differences in the intensity of biotin-hydrazide labeling between the bands were observed; the lower band was most intensively labeled, probably due to differences in glycosylation between the bands (Fig. 2B, lanes 1 and 2). Control membranes were developed with MAb 6A3 (Fig. 2B, lanes 3 and 4).



View larger version (39K):
[in this window]
[in a new window]
  		FIG. 2. {alpha}-D-Mannosidase treatment and biotin-hydrazide labeling of r45/47 kDa protein. (A) Effects of treatment with {alpha}-D-mannosidase of rCF extracts from S. lividans carrying the pIJ486MT-45 vector. Lanes 1 and 3, rCF extracts not treated with {alpha}-D-mannosidase; lanes 2 and 4, rCF extracts treated with {alpha}-D-mannosidase. Lanes 1 and 2 were developed with MAb 6A3, while lanes 3 and 4 were developed with ConA-peroxidase. The arrow in lane 4 indicates the position of the {alpha}-D-mannosidase enzyme which reacted with ConA. (B) Biotin-hydrazide labeling. Lane 1, rCF from S. lividans carrying pIJ486; lane 2, rCF from S. lividans carrying pIJ486MT-45. Blots were developed with streptavidine-peroxidase. Lanes 3 and 4 were the same as lanes 1 and 2, but the blots were developed with MAb 6A3.

Protein purification.
The r45/47 kDa protein was purified from culture supernatants by anion-exchange chromatography, and both forms of the protein eluted in one peak at 0.3 M NaCl. About 5 mg of protein was obtained from 1 liter of culture. The protein was further separated into ConA-binding and nonbinding fractions by ConA affinity chromatography. The fraction bound to the ConA-Sepharose column was eluted with {alpha}-methyl-mannopyranoside and migrated as the 47-kDa upper band in SDS-PAGE gels. On the other hand, the fraction did not bind to the ConA-Sepharose column and was recovered from the flowthrough from a HiTrap Q-Sepharose column, and it migrated as a 45-kDa band in SDS-PAGE gels (Fig. 3).



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 3. Purification of r45/47 kDa protein: profile of ConA affinity chromatography. The left lane of the inset shows the protein that was retained by the ConA column after elution (47-kDa band), which was rechromatographed by anion-exchange chromatography and analyzed by SDS-PAGE. The right lane of the inset shows protein that was not retained by the ConA column (45-kDa band), which was rechromatographed by anion-exchange chromatography and analyzed by SDS-PAGE. B in the y axis is NaCl gradient from 0 to 1 M.

Fingerprinting.
Endoproteinase digestion of the 47- and 45-kDa proteins (upper and lower bands, respectively) produced identical proteolytic patterns. Lys-C digestion released two peptides with apparent molecular masses of about 20 and 30 kDa, while Glu-C digestion produced two peptides with apparent molecular masses of about 19 and 31 kDa (results not shown). The N-terminal sequences of the undigested 47- and 45-kDa proteins were determined; the two sequences were identical, and this showed that the signal peptide was cleaved off at precisely the same position as in the native protein. This result agrees with the presence in S. lividans of a signal peptidase that cleaves at the consensus amino acid sequence AXA in the leader peptide (29). On the other hand, the N-terminal sequences of the proteolytic fragments generated from digestion of the 47- and 45-kDa proteins were also identical. Figure 4 shows the proteolytic enzyme digestion sites based on the N-terminal sequences of the different peptides.



View larger version (24K):
[in this window]
[in a new window]
  		FIG. 4. Cleavage sites of r45/47 kDa protein with proteolytic enzymes. The cleavage sites for each enzyme are indicated by arrows, and the N-terminal sequence obtained for each fragment is indicated by boldface type. The individual glycosylation sites of native protein are enclosed in brackets, and glycosylated recombinant peptides are underlined.

The MALDI-TOF MS peptide map of the tryptically digested recombinant 47-kDa protein is shown in Fig. 5. All major peaks could be assigned. The signal comprising amino acids 150 to 165 had a molecular ion 76 Da lower than expected. MS-MS analysis unequivocally demonstrated that there was a change from Y to S at position 161 (data not shown). This change could have been due to an error during PCR amplification of the gene. Both the N-terminal peptide T1-73 and the C-terminal peptide T239-282 were found to be posttranslationally modified by hexose residues, which could be identified as mannose due to the binding characteristics of the protein to ConA. Zero to nine mannose residues were detected in the T1-73 peptide, as indicated by a ladder of molecular ions differing by 162 Da, which is characteristic of hexose residues, whereas zero to four mannose residues were found to be linked to the T239-282 peptide (Fig. 5). Glycosylation on the 45-kDa protein was also found at the same position of the 47-kDa protein but with a different mannosylation pattern, the unglycosylated N-terminal peptide had the highest signal intensity, and peptides with one to five mannose residues were detectable with less than one-third the intensity of the unglycosylated peptide. In the C-terminal peptide, the intensity of the glycopeptides with one to three mannose residues was less than 20% of the intensity of the unglycosylated peptide (data not shown).



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 5. MALDI-TOF peptide map of the tryptically digested recombinant 47-kDa protein. The signal comprising amino acids 150 to 165 showed a molecular ion 76 Da lower than expected. MS-MS analysis unequivocally demonstrated that there was a change from Y to S at position 161. Both the N-terminal peptide T1-73 and the C-terminal peptide T239-282 were found to be posttranslationally modified by hexose residues.

ELISA.
Comparison of reactivities of human tuberculosis and control sera by the ELISA showed that only the ConA-binding 47-kDa protein was recognized by sera of individuals infected with M. tuberculosis; in contrast, MAb 6A3 recognized both the 45- and 47-kDa proteins (Fig. 6). The interaction of antibodies with the 47-kDa protein was lost after treatment with jack bean {alpha}-D-mannosidase.



View larger version (11K):
[in this window]
[in a new window]
  		FIG. 6. ELISA of purified 45- and 47-kDa proteins: reactivities of antibodies with the ConA-binding 47-kDa protein (open bars), with the {alpha}-D-mannosidase-treated 47-kDa protein (gray bars), and with the non-ConA-binding 45-kDa protein (solid bars). Reactivity was tested with MAb 6A3 (6A3), with sera from human tuberculosis patients (TB) (2), and with sera from healthy individuals (Healthy) (3). The results are expressed as mean optical. densities and are representative of three separate experiments.


arrow
DISCUSSION
 
There have been several reports of mycobacterial gene expression in Streptomyces. In particular, expression of M. bovis BCG and M. leprae genes in S. lividans has been reported elsewhere (16, 20). More recently, two major antigens of M. tuberculosis, the 38- and 19-kDa proteins (Rv0934 and Rv3763), were overproduced by S. lividans as secreted extracellular proteins when their genes were cloned in an engineered expression-secretion vector (39). In this work, the 45/47 kDa glycoprotein of M. tuberculosis was expressed in S. lividans. The gene that encodes this protein (modD) is the fourth gene of a putative molybdenum transport operon. Even though the fragment cloned in the vector pIJ486 does not carry the entire operon, expression was observed. Transcriptional readthrough from the vector can be ruled out as the cause of expression, since the gene was cloned downstream of a strong transcriptional terminator (4). Therefore, it is very likely that the fragment cloned in pIJ486, which carried 1 kb of DNA upstream of the gene, carried an internal promoter capable of driving expression of the M. tuberculosis 45/47 kDa protein gene in S. lividans. This shows that Streptomyces is able to recognize M. tuberculosis promoters, which is not surprising given the relatedness of these organisms in the actinomycetes group, which has been shown to extend to the genome level (1). The presence of promoters which are internal to operons in mycobacteria has been described recently for the phosphate-specific transport operon, which encodes the PstS-1 protein, and for genes of the putative mpt70-mpt83 operon (14, 37).

Studies on glycosylation of mycobacterial proteins by S. lividans are scarce. However, a few reports have shown that this microorganism has protein glycosylation ability (18, 21, 28).

In the present work, the well-known M. tuberculosis 45/47 kDa glycoprotein was expressed in S. lividans, and we showed that the protein is glycosylated. Like the native protein, the recombinant protein was secreted into the medium and migrated as a double band in SDS-PAGE gels; however, in contrast to the native mycobacterial protein, only the upper 47-kDa band of the recombinant protein from S. lividans reacted with ConA. This suggests either that the protein is glycosylated in S. lividans by sugars other than mannose or that it is glycosylated in a configuration not recognized by ConA. In addition, only the 45-kDa lower band of the recombinant protein could be recognized by the anti-C45 antibody. This difference in reactivity between the native and recombinant proteins can be explained by differences in glycosylation. The same explanation can be extrapolated to the native 45/47 kDa protein, in which the existence of the two bands can be attributed to changes in glycosylation rather than to degradation or C-terminal modifications. Our observations support the hypothesis that differences in glycosylation are the cause of the two forms of the recombinant protein, since no differences in N-terminal sequences or isoelectric points could be found between the 45- and 47-kDa proteins. In addition, evidence supporting the hypothesis that the recombinant protein is glycosylated at the same position as the native protein was obtained from the ConA reactivity of all peptides generated by Glu-C and Lys-C digestion of the S.lividans r45/47 kDa protein (data not shown). This finding was further supported by the MALDI-TOF MS analysis that showed that, as in the native protein, the glycosylation sites of the r45/47 kDa protein are located in both the N and C termini of the molecule. Interestingly, the glycosylation pattern of the recombinant N terminus from zero to nine hexose residues was very similar to that of the native proteins from three M. tuberculosis reference strains (12). In contrast, differences in the degree of glycosylation were found between recombinant 47- and 45-kDa forms of the protein, as reported elsewhere for the native protein (12); these differences could explain the existence of two forms of the molecule, as well as the differences in ConA reactivity and biotin labeling. Therefore, it is important to determine if the individual glycosylation sites of the r45/47 kDa protein are the same as those defined for the native protein (5). Finally, an interesting observation was the different reactivities of human tuberculosis-infected sera with the ConA-binding 47-kDa protein and the nonbinding 45-kDa protein, as analyzed by the ELISA. Antibodies from tuberculosis patients recognized only the upper ConA-binding fraction, suggesting that antibodies in the sera had been generated against the carbohydrate residues. This observation was confirmed by the loss of antibody binding to deglycosylated 47-kDa protein.

Carbohydrates that decorate the surfaces of infectious agents are considered pathogen-associated molecular patterns, and they are recognized by pattern recognition receptors, such as the mannose receptor and the dendritic cell-specific intracellular adhesion molecule 3-grabbing nonintegrin receptor, which play a key role in innate and adaptive immunity (9, 35). ConA-binding carbohydrates have been found in lipoarabinomannan and other important antigens of M. tuberculosis, like the 19- and 38-kDa antigens (7, 11, 13). The interaction of LAM with the mannose receptor has been widely documented (3, 15), and more recently the dendritic cell-specific intracellular adhesion molecule 3-grabbing nonintegrin receptor has been defined as the major M. tuberculosis receptor on human dendritic cells with the capacity to discriminate between Mycobacterium species through selective recognition of the mannose caps on LAM (22, 36). These observations suggest that the presence of mannose residues in mycobacterial molecules could be an important signal for host recognition through mannose receptors or other carbohydrate recognition receptors, and therefore, carbohydrate motifs in glycoproteins of mycobacteria could play an important role in both the cellular (12, 32) and humoral immune responses.


arrow
ACKNOWLEDGMENTS
 
This work was supported by grant IN221599 from DGAPA-Universidad Nacional Autónoma de México and by grants 33580-M and CONACYT-DLR from CONACYT.

The Tropist 3 cosmid library of M. tuberculosis DNA was kindly provided by K. De Smet (Tuberculosis and Related Infections Unit, Medical Research Council, Clinical Sciences Centre, London, United Kingdom). We thank Rafael Cervantes and Gabriela González-Cerón for technical assistance, Rita Getzlaff for protein sequencing, and Isabel Pérez Montfort for reviewing the English version of the manuscript.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Instituto de Investigaciones Biomédicas, Departamento de Inmunología, Apartado Postal 70-228, 04510 México, D.F., México. Phone (525) 6223818. Fax: (525) 6223369. E-mail: espitia{at}servidor.unam.mx. Back


arrow
REFERENCES
 
    1
  1. Bentley, S. D., K. F. Chater, A. M. Cerdeno-Tarraga, G. L. Challis, N. R. Thomson, K. D James, D. E. Harris, M. A. Quail, H. Kieser, D. Harper, A. Bateman, S. Brown, G. Chandra, C. W. Chen, M. Collins, A. Cronin, A. Fraser, A. Goble, J. Hidalgo, T Hornsby, S. Howarth, C. H. Huang, T. Kieser, L. Larke, L. Murphy, K. Oliver, S. O'Neil, E. Rabbinowitsch, M. A. Rajandream, K. Rutherford, S. Rutter, K. Seeger, D. Saunders, S. Sharp, R. Squares, S. Squares, K. Taylor, T. Warren, A. Wietzorrek, J. Woodward, B. G. Barrell, J. Parkhill, and D. A. Hopwood. 2002. Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature 417:141-147.[CrossRef][Medline]
    2. 2
  2. Benz, I., and M. A. Schmidt. 2002. Never say never again: protein glycosylation in pathogenic bacteria. Mol. Microbiol. 45:267-276.[CrossRef][Medline]
    3. 3
  3. Bernardo, J., A. M. Billingslea, R. L. Blumenthal, K. F. Seetoo, E. R. Simons, and M. J. Fenton. 1998. Differential responses of human mononuclear phagocytes to mycobacterial lipoarabinomannans: role of CD14 and the mannose receptor. Infect. Immun. 66:28-35.[Abstract/Free Full Text]
    4. 4
  4. De Smet, K. A., S. Jamil, and N. G. Stoker. 1993. Tropist3: a cosmid vector for simplified mapping of both G+C rich and A+T rich genomic DNA. Gene 136:215-219.[CrossRef][Medline]
    5. 5
  5. Dobos, K. M., K. H. Khoo, K. M. Swiderek, P. J. Brennan, and J. T. Belisle. 1996. Definition of the full extent of glycosylation of the 45-kilodalton glycoprotein of Mycobacterium tuberculosis. J. Bacteriol. 178:2498-2506.[Abstract/Free Full Text]
    6. 6
  6. Espitia, C., I. Cervera, R. Gonzalez, and R. Mancilla. 1989. A 38-kD Mycobacterium tuberculosis antigen associated with infection. Its isolation and serologic evaluation. Clin. Exp. Immunol. 77:373-377.[Medline]
    7. 7
  7. Espitia, C., and R. Mancilla. 1989. Identification, isolation and partial characterization of Mycobacterium tuberculosis glycoprotein antigens. Clin. Exp. Immunol. 77:378-383.[Medline]
    8. 8
  8. Espitia, C., R. Espinosa, R. Saavedra, R. Mancilla, F. Romain, A. Laqueyrerie, and C. Moreno. 1995. Antigenic and structural similarities between Mycobacterium tuberculosis 50- to 55-kilodalton and Mycobacterium bovis BCG 45- to 47-kilodalton antigens. Infect. Immun. 63:580-584.[Abstract]
    9. 9
  9. Feinberg, H., D. A. Mitchell, K. Drickamer, and W. I. Weis. 2001. Structural basis for selective recognition of oligosaccharides by DC-SIGN and DC-SIGNR. Science 294:2163-2166.[Abstract/Free Full Text]
    10. 10
  10. Fifis, T., C. A. J. Costopoulos, A. Bacic, and P. R. Wood. 1991. Purification and characterization of major antigens from a Mycobacterium bovis culture filtrate. Infect. Immun. 59:800-807.[Abstract/Free Full Text]
    11. 11
  11. Garbe, T., D. Harris, M. Vordemeier, R. Lathigra, J. Ivanyi, and D. Young. 1993. Expression of the Mycobacterium tuberculosis 19-kilodalton antigen in Mycobacterium smegmatis: immunological analysis and evidence of glycosylation. Infect. Immun. 61:260-267.[Abstract/Free Full Text]
    12. 12
  12. Horn, C., A. Namane, P. Pescher, M. Riviere, F. Romain, G. Puzo, O. Barzu, and G. Marchal. 1999. Decreased capacity of recombinant 45/47-kDa molecules (Apa) of Mycobacterium tuberculosis to stimulate T lymphocyte responses related to changes in their mannosylation pattern. J. Biol. Chem. 274:32023-32030.[Abstract/Free Full Text]
    13. 13
  13. Hunter, S. W., H. Gaylord, and P. J. Brennan. 1986. Structure and antigenicity of the phosphorylated lipopolysaccharide antigens from the leprosy and tubercle bacilli. J. Biol. Chem. 261:12345-12351.[Abstract/Free Full Text]
    14. 14
  14. Juarez, M. D., A. Torres, and C. Espitia. 2001. Characterization of the Mycobacterium tuberculosis region containing the mpt83 and mpt70 genes. FEMS. Microbiol. Lett. 203:95-102.[Medline]
    15. 15
  15. Kang, B. K., and L. S. Schlesinger. 1998. Characterization of mannose receptor-dependent phagocytosis mediated by Mycobacterium tuberculosis lipoarabinomannan. Infect. Immun. 66:2769-2777.[Abstract/Free Full Text]
    16. 16
  16. Kieser, T., M. T. Moss, J. W. Dale, and D. A. Hopwood. 1986. Cloning and expression of Mycobacterium bovis BCG DNA in "Streptomyces lividans." J. Bacteriol. 168:72-80.[Abstract/Free Full Text]
    17. 17
  17. Kieser, T., M. J. Bribb, M. J. Buttner, K. F. Chater, and P. A. S. Hopwood. 2000. Practical Streptomyces genetics. The John Innes Foundation, Norwich, United Kingdom.
    18. 18
  18. Kluepfel, D., S. Vats-Mehta, F. Aumont, F. Shareck, and R. Morosoli. 1990. Purification and characterization of a new xylanase (xylanase B) produced by Streptomyces lividans 66. Biochem. J. 267:45-50.[Medline]
    19. 19
  19. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 277:680-685.
    20. 20
  20. Lamb, F. I., A. E. Kingston, I. Estrada, and M. J. Colston. 1988. Heterologous expression of the 65-kilodalton antigen of Mycobacterium leprae and murine T-cell responses to the gene product. Infect. Immun. 56:1237-1241.[Abstract/Free Full Text]
    21. 21
  21. MacLeod, A. M., N. R. Gilkes, L. Escote-Carlson, R. A. Warren, D. G. Kilburn, and R. C. Miller, Jr. 1992. Streptomyces lividans glycosylates an exoglucanase (Cex) from Cellulomonas fimi. Gene 121:143-147.[CrossRef][Medline]
    22. 22
  22. Maeda, N., J. Nigou, J. L. Herrmann, M. Jackson, A. Amara, P. H. Lagrange, G. Puzo, B. Gicquel, and O. Neyrolles. 2003. The cell surface receptor DC-SIGN discriminates between Mycobacterium species through selective recognition of the mannose caps on lipoarabinomannan. J. Biol. Chem. 278:5513-5516.[Abstract/Free Full Text]
    23. 23
  23. Messner, P. 1997. Bacterial glycoproteins. Glycocon. J. 14:3-11.[CrossRef][Medline]
    24. 24
  24. Michell, S. L., A. O. Whelan, P. R. Wheeler, M. Panico, R. L. Easton, T. Etienne, S. M. Haslam, A. Dell, H. R. Morris, A. J. Reason, L. Herrmann, D. B. Young, and G. Hewinson. 2003. The MPB83 antigen from Mycobacterium bovis contains O-linked mannose and (1->3)-mannobiose moieties. J. Biol. Chem. 278:16423-16432.[Abstract/Free Full Text]
    25. 25
  25. Moens, S., J. F. Vanderleyden, and A. Janssens. 1997. Glycoproteins in prokaryotes. Arch. Microbiol. 168:169-175.[CrossRef][Medline]
    26. 26
  26. Morosoli, R., F. Shareck, D. Kluepfel. 1997. Protein secretion in streptomycetes. FEMS Microbiol. Lett. 146:167-174.[CrossRef][Medline]
    27. 27
  27. O'Farrel, P. H. 1975. High resolution two-dimensional electrophoresis of proteins. J. Biol. Chem. 250:4007-4021.[Abstract/Free Full Text]
    28. 28
  28. Ong, E., D. G. Kilburn, R. C. Miller, Jr., and R. A. Warren. 1994. Streptomyces lividans glycosylates the linker region of a beta-1,4-glycanase from Cellulomonas fimi. J. Bacteriol. 176:999-1008.[Abstract/Free Full Text]
    29. 29
  29. Page, N., D. Kluepfel, F. Shareck, and A. R. Morosoli. 1996. Effect of signal peptide alterations and replacement on export of xylanase in Streptomyces lividans. Appl. Environ. Microbiol. 62:109-114.[Abstract]
    30. 30
  30. Pozidis, C., E. Lammertyn, A. S. Politou., J. Anne, A. S. Tsiftsoglou, G. Sianidis, and A. Economou. 2001. Protein secretion biotechnology using Streptomyces lividans: large-scale production of functional trimeric tumor necrosis factor alpha. Biotechnol. Bioeng. 72:611-619.[CrossRef][Medline]
    31. 31
  31. Ratliff, T. L., R. McCarthy, W. B. Telle, and E. J. Brown. 1993. Purification of a mycobacterial adhesin for fibronectin. Infect. Immun. 61:1889-1894.[Abstract/Free Full Text]
    32. 32
  32. Romain, F., C. Horn, P. Pescher, A. Namane, M. Riviere, G. Puzo, O. Barzu, and G. Marchal. 1999. Deglycosylation of the 45/47 kilodalton antigen complex of Mycobacterium tuberculosis decreases its capacity to elicit in vivo or in vitro cellular immune responses. Infect. Immun. 67:5567-5572.[Abstract/Free Full Text]
    33. 33
  33. Schorey, J. S., Q. Li, D. W. McCourt, M. Bong-Mastek, J. E. Clark-Curtiss, T. L. Ratliff, and E. J. Brown. 1995. Mycobacterium leprae gene encoding a fibronectin binding proteins is used for efficient invasion of epithelial cells and Schwann cells. Infect. Immun. 63:2652-2657.[Abstract]
    34. 34
  34. Schorey, J. S., M. A. Holsti, T. L. Ratliff, P. M. Allen, and E. J. Brown. 1996. Characterization of the fibronectin-attachment protein of Mycobacterium avium reveals a fibronectin-binding motif conserved among mycobacteria. Mol. Microbiol. 21:321-329.[CrossRef][Medline]
    35. 35
  35. Stahl, P. D., and R. A. Ezekowitz. 1998. The mannose receptor is a pattern recognition receptor involved in host defense. Curr. Opin. Immunol. 10:50-55.[CrossRef][Medline]
    36. 36
  36. Tailleux, L., O. Schwartz, J. L. Herrmann, E. Pivert, M. Jackson, A. Amara, L. Legres, D. Dreher, L. P. Nicod, J. C. Gluckman, P. H. Lagrange, B. Gicquel, and O Neyrolles. 2003. DC-SIGN is the major Mycobacterium tuberculosis receptor on human dendritic cells. J. Exp. Med. 197:121-127.[Abstract/Free Full Text]
    37. 37
  37. Torres, A., M. D. Juarez, R. Cervantes, and C. Espitia. 2001. Molecular analysis of Mycobacterium tuberculosis phosphate specific transport system in Mycobacterium smegmatis. Characterization of recombinant 38 kDa (PstS-1). Microb. Pathog. 5:289-297.
    38. 38
  38. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. 76:4350-4354.[Abstract/Free Full Text]
    39. 39
  39. Tremblay, D., J. Lemay, M. Gilbert, Y. Chapdelaine, C. Dupont, and R. Morosoli. 2002. High-level heterologous expression and secretion in Streptomyces lividans of two major antigenic proteins from Mycobacterium tuberculosis. Can. J. Microbiol. 48:43-48.[CrossRef][Medline]
    40. 40
  40. Wieles, B., M. V. Agterveld, A. Janson, J. E. Clark-Curtiss, T. Rinke De Wit, M. Harboe, and J. Thole. 1994. Characterization of Mycobacterium leprae antigen related to the secreted Mycobacterium tuberculosis protein MPT 32. Infect. Immun. 62:252-258.[Abstract/Free Full Text]

Applied and Environmental Microbiology, February 2004, p. 679-685, Vol. 70, No. 2
0099-2240/04/$08.00+0     DOI: 10.1128/AEM.70.2.679-685.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lara, M.
Right arrow Articles by Espitia, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lara, M.
Right arrow Articles by Espitia, C.
Agricola
Right arrow Articles by Lara, M.
Right arrow Articles by Espitia, C.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»