Previous Article | Next Article ![]()
Applied and Environmental Microbiology, March 2004, p. 1466-1474, Vol. 70, No. 3
0099-2240/04/$08.00+0 DOI: 10.1128/AEM.70.3.1466-1474.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, and Instituto de Biologia Experimental e Tecnológica, 2780-156 Oeiras, Portugal,1 Institute of Food Research, Norwich Research Park, Colney, Norwich NR4 7UA, United Kingdom2
Received 28 July 2003/ Accepted 12 December 2003
| ABSTRACT |
|---|
|
|
|---|
ldh
mtlA and
ldh
mtlF) strains. The new strains, FI10091 and FI10089, respectively, do not possess any selection marker and are suitable for use in the food industry. The metabolism of glucose in nongrowing cell suspensions of the mutant strains was characterized by in vivo 13C-nuclear magnetic resonance. The intermediate metabolite, mannitol-1-phosphate, accumulated intracellularly to high levels (up to 76 mM). Mannitol was a major end product, one-third of glucose being converted to this hexitol. The double mutants, in contrast to the parent strain, were unable to utilize mannitol even after glucose depletion, showing that mannitol was taken up exclusively by PEP-PTSMtl. Disruption of this system completely blocked mannitol transport in L. lactis, as intended. In addition to mannitol, approximately equimolar amounts of ethanol, 2,3-butanediol, and lactate were produced. A mixed-acid fermentation (formate, ethanol, and acetate) was also observed during growth under controlled conditions of pH and temperature, but mannitol production was low. The reasons for the alteration in the pattern of end products under nongrowing and growing conditions are discussed, and strategies to improve mannitol production during growth are proposed. | INTRODUCTION |
|---|
|
|
|---|
Mannitol is assumed to have several health-promoting properties; thus the enrichment of foods with mannitol by in situ production during fermentation could be a positive, clean strategy to obtain healthier fermented food products. In the human gut, mannitol can be converted to short-chain fatty acids (such as butyrate), which have been claimed to confer protection against the development of colon cancer (42). Moreover, mannitol is a scavenger of hydroxyl radicals and a low-calorie sweetener that is partially and slowly absorbed in the small intestine (8, 40).
Lactic acid bacteria (LAB) are a group of microorganisms widely used as starter cultures in dairy fermentations. Hence, these food-associated organisms could be ideal agents for the in situ production of mannitol in foods. The ability of heterofermentative LAB to produce mannitol during fructose fermentation, via the enzyme mannitol dehydrogenase, has been known for many years and is very well documented (11, 37, 38, 43, 44). On the other hand, production of mannitol from sugar substrates other than fructose or sucrose has not been reported.
Mannitol formation in homofermentative LAB, in contrast to the heterofermentative LAB, has been detected only in strains whose ability to regenerate NAD+ is severely impaired (7, 28, 30). Our team has reported the synthesis of mannitol and mannitol-1-phosphate (Mtl1P) in L. lactis strains deficient in lactate dehydrogenase (LDH) (28). Production of mannitol in these strains was rationalized as an alternative way to fulfill the redox balance during glucose catabolism, since conversion of fructose-6-phosphate (F6P) to Mtl1P is associated with regeneration of NAD+. We also observed that the mannitol produced was taken up and rapidly metabolized after glucose depletion; therefore, it was apparent that the design of a mannitol-producing strain would have to consider the ability of L. lactis to utilize mannitol as an energy source for growth (27). Thus, the disruption of the mannitol transport system in L. lactis was envisaged in the metabolic strategy pursued herein.
Transport of mannitol in L. lactis is most likely mediated by a phosphoenolpyruvate (PEP)-mannitol phosphotransferase system (PTSMtl), since the genome sequence of L. lactis IL1403 revealed the existence of an operon (mtlARFD) encoding proteins with high sequence similarity to subunits B and C of EIIMtl, MtlR (regulatory protein), subunit A of EIIMtl, and mannitol-1-phosphate dehydrogenase (Mtl1PDH) of other organisms (1). A similar organization of the mannitol operon is found in L. lactis MG1363 (N. Mansour, personal communication). The protein EIICBMtl, encoded by the mtlA gene, is involved in the phosphorylation and mannitol permeation across the membrane, whereas protein EIIAMtl (encoded by mtlF) is responsible for phosphotransfer between the histidine protein (HPr) and EIIBCMtl (34). The role of the regulatory protein, MtlR, in the expression of the mannitol operon is not entirely clear. In Bacillus stearothermophilus, MtlR is probably involved in the regulation of this operon, and its affinity for DNA is controlled via phosphorylation by HPr and EIICBMtl (12). However, in Streptococcus mutans, the mtlR gene product is not necessary for growth on mannitol or for expression of the operon (15).
In this paper, we describe the construction of L. lactis strains able to form mannitol as an end product of glucose metabolism, using a food-grade LDH-deficient strain as genetic basis for knocking out the gene mtlA (encoding EIICBMtl) or mtlF (encoding EIIAMtl). Nongrowing cells of the double mutants (
ldh/
mtlA) and (
ldh
mtlF) yielded mannitol, ethanol, 2,3-butanediol, and lactate as major end products, with approximately one-third of the carbon from glucose being successfully channeled to the production of mannitol.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
Construction of gene replacement vectors.
The pORI280/pVE6007 two-plasmid system (18, 19) was used to generate food-grade deletions of the mtlF or mtlA genes in the
ldh FI9630 strain (30). For deletion of the mtlF gene, the upstream and downstream flanking fragments were amplified from L. lactis MG1363 (10) genomic DNA by using the primers MtlF1 (5' CTTATCTAGATTCGGTCTATG 3') plus MtlF2 (5' GTAAAAAGTTCAAATAGGATCCCACACGCCGTAAAC 3') and MtlF3 (5' GTTTACGGCGTGTGGGATCCTATTTGAACTTTTTAC 3') plus MtlF4 (5' GTTAGAATTCAAGTCAGAAAATCCA 3'), respectively. The primers were designed on the basis of available sequence data for the mannitol operon from strain MG1363, and the specific restriction sites XbaI, BamHI, and EcoRI were added (underlined in primer sequences). The upstream and downstream amplified fragments were cloned into pGEM-T (Promega), giving pFI2421 and pFI2422, respectively, and their sequences were confirmed. The upstream and downstream fragments were cloned sequentially into pORI280 to give pFI2425. The correct orientation of the fragments cloned in pFI2425 was confirmed by PCR analysis.
Inactivation of the mtlA gene was achieved by deletion of the 1.07-kb EcoRI-EcoRI region present inside the gene. For this, MG1363 genomic DNA was amplified with MtlA1 (5' ACTGGATCCATTTGGTATTTATTGCATAG 3', based on the IL1403 genome sequence) and MtlA2 (5' CAAGATCTGACGAATTTTATAGGAGAA 3', based on the MG1363 genome sequence) primers, generating a 3.11-kb BamHI-BglII fragment containing the complete mtlA gene and flanking regions, where the BamHI and BglII restriction sites have been engineered (underlined in primer sequences). This fragment was cloned into pGEM-T, giving pFI2426. Digestion of this construct with EcoRI followed by religation resulted in plasmid pFI2427, in which the internal 1.07-kb EcoRI fragment within the mtlA gene has been deleted, leaving a 2.04-kb BamHI-BglII fragment that covers 750 bp of the mtlA gene and flanking regions. pFI2427 and pORI280 were digested with BamHI and ligated together, giving pFI2428. Further digestion of this construct with BglII followed by religation gave pFI2429 (pORI280 containing the 2.04-kb BamHI-BglII fragment), a
mtlA gene replacement vector.
Gene replacement protocol.
The pFI2425 and pFI2429 constructs were electroporated into strain FI10021 (FI9630/pVE6007), giving FI10022 and FI10090, respectively. These strains were taken through the temperature shift protocol for single and double crossovers (19), yielding L. lactis strains FI10089 (
ldh
mtlF double mutant) and FI10091 (
ldh
mtlA double mutant), respectively. The correctness of both mutants was confirmed by PCR analysis.
Quantification of fermentation products during growth.
Strains were grown in a 2-liter fermentor in chemically defined medium (CDM) (33) containing 1% (wt/vol) glucose at 30°C and pH 6.5. The pH was kept constant by automatic addition of NaOH. Growth was evaluated by measuring the turbidity (optical density of the culture at 600 nm [OD600]) and calibrating against cell dry mass measurements. Culture samples (5 ml) were taken at different growth stages and centrifuged (2,000 xg, 5 min, 4°C), and the supernatant solutions were stored at -20°C until analyzed by high-performance liquid chromatography (HPLC). Glucose, mannitol, acetate, ethanol, formate, lactate, acetoin, and 2,3-butanediol were quantified in an HPLC apparatus equipped with a refractive index detector (Shodex RI-101, Showa Denko K.K., Oita, Japan) using an HPX-87H anion-exchange column (Bio-Rad Laboratories, Inc., Richmond, Calif.) at 60°C, with 5 mM H2SO4 as the elution fluid and a flow rate of 0.5 ml min-1.
Quantification of intracellular metabolites in cell extracts by 13C-NMR.
Mutant FI10089 was grown under controlled conditions as described above, except that a mixture of [1-13C]glucose and nonlabeled glucose (1:10) was used. At mid-exponential and stationary growth phases, samples were collected and extracted with ethanol as described previously (36). Samples were analyzed by 13C nuclear magnetic resonance (13C-NMR); assignment of resonances was done as in previous studies (28, 35). In particular, this methodology was used to assess intracellular mannitol in growing cultures.
In vivo NMR experiments and quantification of metabolites.
Cells were grown in CDM as described above and harvested in the mid-exponential growth phase, washed twice in 5 mM potassium phosphate (KPi), and suspended in 50 mM KPi buffer (pH 6.5), to a protein concentration in the range 13 to 15 mg of protein ml-1. In vivo NMR experiments were performed with the system described previously (29). [1-13C]glucose or [6-13C]glucose (40 mM) was supplied to the cell suspension, and the time courses for substrate consumption, product formation, and intracellular metabolite pools were monitored in vivo. After substrate exhaustion and when no changes in the resonances due to end products and intracellular metabolites were observed, a 10-ml aliquot was passed through a French press, and an NMR sample extract was prepared as reported previously (30). Lactate, acetoin, acetate, and formate were quantified in the NMR sample extract by 1H-NMR in a Bruker AMX300 (29). The concentrations of mannitol, 2,3-butanediol, ethanol, minor products, and metabolic intermediates that remained inside the cells (phosphoenolpyruvate, 3-phosphoglycerate) were determined in fully relaxed 13C spectra of the NMR sample extracts as described by Neves et al. (28).
Due to the fast pulsing conditions used for acquiring in vivo 13C spectra, quantification of the intracellular metabolites required the use of correction factors that allow the conversion of resonance areas into concentrations. Correction factors of 0.73 ± 0.04, 0.65 ± 0.03, and 0.71 ± 0.04 were used for resonances of fructose-1,6-bisphosphate, mannitol or Mtl1P, and PEP or 3-phosphoglycerate, respectively (28). Intracellular metabolite concentrations were calculated by using a value of 2.9 µl mg of protein-1 for the intracellular volume (32). The concentration limit for detection of intracellular metabolites under the conditions used to acquire in vivo spectra (30-s total acquisition time for each spectrum) was 3 to 4 mM. Although individual experiments are illustrated in each figure, each type of in vivo NMR experiment was repeated at least twice. The values reported are averages of two to three experiments, and the accuracy varied from 2% (end products) to 15% in the case of intracellular metabolites.
Quantification of intracellular and extracellular mannitol in nongrowing cells.
Intracellular and extracellular pools of mannitol were quantified in independent experiments performed with the experimental setup used for in vivo NMR measurements. After glucose addition, 1-ml samples were withdrawn at 5-min intervals. The samples were centrifuged, the pellets were discarded, and the supernatants were used for quantification of extracellular mannitol. For the determination of total mannitol (intracellular plus extracellular), 5-ml samples were taken at 10, 20, 30, and 60 min after addition of [1-13C]glucose. Perchloric acid (final concentration, 0.6 M) was added to the samples. After stirring for 20 min on ice, the pH of the samples was adjusted to neutrality with 2 M KOH and centrifuged. The supernatant solutions were used for mannitol quantification by 13C-NMR.
NMR spectroscopy.
13C spectra were acquired at 125.77 MHz on a Bruker DRX500 spectrometer. All in vivo experiments were run with a quadruple-nucleus probe head at 30°C, as described before (29). For the quantitative analysis of the NMR sample extracts by 13C-NMR, a repetition delay of 60.5 s was used. The 13C-NMR spectra of the perchloric and ethanol extracts were obtained with a quadruple-nucleus probe head with a pulse width of 13 µs (flip angle, 60°) and recycle delays of 3.5 and 1.5 s, respectively. Correction factors to take into account incomplete relaxation of resonances were calculated by comparison with spectra acquired under fully relaxed conditions (recycle delay, 60.5 s). 13C-NMR spectra of supernatant solutions were acquired with a 5-mm-diameter selective probe head using a pulse width corresponding to a 60° flip angle and a recycle delay of 5.5 s. Chemical shifts were referenced to the resonance of external methanol designated at 49.3 ppm.
Enzyme activity measurements.
Cells were grown and harvested in the mid-exponential phase as described for in vivo NMR experiments, and crude extracts were prepared as described by Neves et al. (28). Enzyme activities were assayed in a spectrophotometer (Shimadzu UV-1601) equipped with a cell compartment thermostatted at 30°C, in a total volume of 1 ml. One unit of enzyme activity is the amount of enzyme catalyzing the conversion of 1 µmol of substrate per min under the experimental conditions used. LDH activity was assayed as described by Garrigues et al. (9). The reverse reaction (F6P
Mtl1P) catalyzed by Mtl1PDH was assayed as reported before (28).
Chemicals.
[1-13C]glucose and [6-13C]glucose (99% enrichment) were supplied by Campro Scientific (Veenendaal, The Netherlands). All other chemicals were reagent grade and were obtained from Merck or Aldrich.
| RESULTS |
|---|
|
|
|---|
|
Characterization of growth of strains FI10089 and FI9630 on glucose.
The profiles of growth, glucose consumption, and product formation by strains FI10089 (
ldh
mtlF double-deletion mutant) and FI9630 (parent strain) under anaerobic conditions are shown in Fig. 2. The major end products from the metabolism of 59 mM glucose by the
ldh
mtlF double mutant were formate (77.6 mM), ethanol (47.5 mM), acetate (26.1 mM), and acetoin (9.3 mM); minor amounts of lactate (5.2 mM), 2,3-butanediol (5.7 mM), and mannitol (2.3 mM) were also detected. The fermentation profiles of the two strains were very similar, except for mannitol: a transient production of this polyol was observed in the
ldh strain (maximal concentration, 0.7 mM), whereas in the double mutant, the level of mannitol increased to 2.3 mM and remained constant even after glucose depletion. Quantification of mannitol in an ethanol extract derived from
ldh
mtlF cells in the stationary growth phase revealed that 95% of the total mannitol present at that stage was in the extracellular medium; a value of 25 mM was determined for the intracellular concentration of mannitol. The growth features of the
ldh
mtlA strain (FI10091) were similar to those of the
ldh
mtlF strain (data not shown). In particular, the growth rates were identical (0.87 ± 0.02 h-1). A comparison of the relevant growth and bioenergetic parameters for strains FI10089 (
ldh
mtlF) and FI9630 (parent strain) is shown in Table 2.
|
|
|
|
|
|
Measurements of enzyme activities.
Specific activities of LDH and Mtl1PDH were measured in crude extracts derived from cultures of FI10089. LDH activity was not detected, confirming that the ldh gene encoded by the las operon has been deleted. An activity of 2.5 ± 0.4 U mg of protein-1 was determined for Mtl1PDH (reverse reaction, F6P
Mtl1P), a value similar to that measured in the parent strain FI9630 grown under similar conditions (30).
| DISCUSSION |
|---|
|
|
|---|
Our previous work on the metabolic characterization of L. lactis MG1363 strains deficient in LDH revealed formation of mannitol during glucose catabolism. However, these strains were able to metabolize mannitol, and this metabolite was consumed once glucose was depleted (27, 28, 30). To obtain an effective mannitol-producing strain, the mannitol transport system of an LDH-deficient strain was disrupted: the mtlA or mtlF genes were deleted by gene replacement in L. lactis FI9630, a food-grade LDH-deficient strain derived from MG1363. The new constructs, FI10091 and FI10089, do not possess any selection marker and are suitable for use in the food industry.
Nongrowing cells of these double mutants produced mannitol as an end product of glucose metabolism with high yield. Our NMR results showed conversion of Mtl1P to mannitol (Fig. 4). Thus, synthesis of mannitol from glucose proceeds via Mtl1P and implies the involvement of an enzyme responsible for converting Mtl1P to mannitol (Fig. 6). It is intriguing that no genes coding for mannitol-1-phosphatase have been identified in L. lactis or in any other organism, with the exception of Eimeria tenella (22).
|
It is well known that in L. lactis, glucose exerts a strong exclusion or expulsion effect on some PTS substrates, including mannitol (26). During inducer expulsion, accumulated sugar-P is hydrolyzed by an intracellular phosphatase and expelled from the cells. A membrane-associated phosphatase that initiates the inducer expulsion process has been reported to show affinity for Mtl1P (45). Although BLASTP searches of the available sequences of L. lactis IL1403 or MG1363 gave no hits for mannitol-1-phosphatase, there are at least four genes assigned as putative protein phosphatases in the L. lactis IL1403 genome. So there are a number of potential candidates to catalyze the dephosphorylation of Mtl1P to mannitol.
LDH-deficient strains of L. lactis metabolize sugars via a mixed-acid fermentation as a way to fulfill the redox balance (2, 14, 27, 28, 30, 31). In the FI10089 strain studied in this work, as in other LDH-deficient strains, glucose catabolism under anaerobic conditions proceeded via a mixed-acid fermentation in either growing or resting cells. Growth on glucose yielded formate, ethanol, and acetate as the main end products. In contrast, glucose metabolism by nongrowing cells produced mannitol as a major end product and approximately equimolar amounts of lactate, ethanol, and 2,3-butanediol. The comparison of the pattern of end products in nongrowing cells of the strain deficient in the transport of mannitol (FI10089) and the parent strain (FI9630) reflects the expected increased utilization of NADH-oxidizing reactions, other than Mtl1PDH, for balancing redox equivalents (Table 3). Interestingly, the relative proportions of the reduced products derived from pyruvate (lactate, ethanol, and 2,3-butanediol) were similar in both strains, but the acetoin/2,3-butanediol ratio was considerably enhanced in the mannitol-producing mutant. This is explained by the efficient utilization of the Mtl1PDH pathway for the regeneration of NAD+, which is expected to decrease the NADH/NAD+ ratio in the cell and thus alleviate the pressure on the NAD+-regenerating reactions downstream of the pyruvate node.
Lactate production was observed despite a stable LDH deletion in these strains, suggesting the existence of an alternative ldh gene that is expressed when the ldh gene in the las operon is deleted. In fact, four genes homologous to ldh genes from other organisms are present in the genome of L. lactis IL1403 (1), and an alternative LDH has been isolated from an LDH-deficient strain obtained by single-crossover deletion of the ldh gene in L. lactis MG1614 (P. Gaspar, P. Coelho, A. R. Neves, C. A. Shearman, M. J. Gasson, A. Ramos, and H. Santos, unpublished results).
Mannitol production was drastically depressed during growth as compared to the level in nongrowing cells. Several lines of evidence suggest three different aspects that could control mannitol production during growth, namely: (i) the F6P pool, (ii) ATP demand, and (iii) pressure to regenerate NAD+. The Km values of Mtl1PDH for F6P in L. lactis have not been reported; however, a Km value of 1.7 mM in Streptococcus mutans has been found (BRENDA enzyme database at http://www.brenda.uni-koeln.de). Assuming a similar Km for L. lactis Mtl1PDH, the F6P concentration could constitute a limiting factor for mannitol production, since the F6P pools are generally low. In nongrowing cells, we were unable to detect 13C-NMR resonances due to F6P during the metabolism of glucose, meaning that the pool of F6P is below the detection limit (3 mM); moreover, a maximum of 0.7 mM F6P was measured for the intracellular pool in cell extracts derived from L. lactis MG5267 during the metabolism of glucose under nongrowing conditions (29). Because F6P is also a substrate of phosphofructokinase (PFK), the affinity of this enzyme should be taken into account in this discussion. A Km of 0.25 mM was reported for the L. lactis enzyme (BRENDA database), and therefore, as far as affinity for the substrate is concerned, PFK can compete efficiently for the common substrate. The activities of these enzymes are comparable: 2.5 U mg of protein-1 for Mtl1PDH in cell extracts of FI10089 (this work), and 1 U mg of protein-1 for PFK in cell extracts of MG1363 (27). Therefore, the overexpression of the gene encoding Mtl1PDH could be potentially useful to improve mannitol production during growth.
The ATP demand for anabolic processes could limit mannitol synthesis during growth. One could consider increasing the ATP supply through the operation of alternative ATP-generating pathways, such as citrate or arginine catabolism, thus allowing conversion of more sugar carbon to mannitol.
On the other hand, if mannitol production depends on the NADH/NAD+ pools, an increased pressure to oxidize NADH by pathways other than ethanol synthesis could improve accumulation of mannitol in actively growing cells. A comparison of ethanol production in growing and resting cells suggests that enhanced pressure to regenerate NAD+ (obtained by inactivation of acetaldehyde dehydrogenase) is required to achieve higher yields of mannitol. The ATP yield is expected to decrease if considerable amounts of glucose are deviated to mannitol, but it appears that there is still a reasonable working range to reduce the ATP yield without affecting severely the growing ability of L. lactis, since the ATP yield and the specific growth rate of strain FI10089 were not considerably lower than those for the model strain MG1363 (Table 2).
The present work demonstrates that in L. lactis, mannitol is transported exclusively by the PEP-PTSMtl encoded in L. lactis by mtlARFD, since deletions of the mtlA or mtlF genes led to an inability to utilize mannitol. However, blockage of mannitol transport is not enough to obtain high levels of mannitol synthesis during growth of L. lactis, which would be an essential feature of a mannitol overproducer in dairy fermentations. A combination of strategies that increase the pressure to regenerate NAD+, such as deletion of acetaldehyde dehydrogenase and overproduction of Mtl1PDH (to enhance flux via this enzyme in detriment of PFK), will be attempted. Furthermore, insight into how the transcription of the mannitol operon in L. lactis is regulated will provide useful clues for manipulating mannitol production in this organism.
In conclusion, the engineering strategy followed here led to the construction of L. lactis strains able to produce a high yield of mannitol (33%) from glucose. These features make FI10089 a strain with potential interest for the production of this polyol by resting cells in processes involving, for example, cell recycling or cell immobilization. Moreover, the yield of mannitol can be further improved by implementing genetic manipulations along the lines discussed above. Work is in progress to enhance mannitol production by L. lactis, especially during growth.
| ACKNOWLEDGMENTS |
|---|
We thank Cristina Leitão for assistance with the HPLC determinations.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
-acetolactate synthase in strains deficient in lactate dehydrogenase as a function of culture conditions. Appl. Environ. Microbiol. 61:3967-3971.[Abstract]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | Microbiol. Mol. Biol. Rev. | Eukaryot. Cell | All ASM Journals |
|---|