Previous Article | Next Article 
Applied and Environmental Microbiology, April 2004, p. 2349-2353, Vol. 70, No. 4
0099-2240/04/$08.00+0 DOI: 10.1128/AEM.70.4.2349-2353.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Subtilosin Production by Two Bacillus subtilis Subspecies and Variance of the sbo-alb Cluster
Torsten Stein,* Stefanie Düsterhus, Anke Stroh, and Karl-Dieter Entian
Institut für Mikrobiologie, Johann Wolfgang Goethe-Universität, D-60439 Frankfurt am Main, Germany
Received 27 August 2003/
Accepted 6 January 2004

ABSTRACT
Eight different
Bacillus subtilis strains and
Bacillus atrophaeus were found to produce the bacteriocin subtilosin A. On the basis
of the subtilosin gene (
sbo) sequences two distinct classes
of
B. subtilis strains were distinguished, and they fell into
the two
B. subtilis subspecies (
B. subtilis subsp.
subtilis and
B. subtilis subsp.
spizizenii). The entire sequence of the
subtilosin gene cluster of a
B. subtilis subsp.
spizizenii strain,
B. subtilis ATCC 6633, was determined. This sequence exhibited
a high level of homology to the sequence of the
sbo-alb gene
locus of
B. subtilis 168. By using primer extension analysis
the transcriptional start sites of
sbo in
B. subtilis strains
ATCC 6633 and 168 were found to be 47 and 45 bp upstream of
the
sbo start codon, respectively. Our results provide insight
into the incipient evolutionary divergence of the two
B. subtilis subspecies.

INTRODUCTION
Almost 4% of the 4.2-Mbp
Bacillus subtilis 168 genome codes
for proteins similar to the proteins involved in the biosynthesis
of antimicrobial metabolites (
17). However,
B. subtilis 168
produces only a few antibiotics because several of the biosynthetic
pathways are not functional, most likely because of the X-ray
mutation of the original Marburg strain (
6). In contrast, various
other
B. subtilis wild-type strains produce characteristic cocktails
of numerous peptide antibiotics (
1,
18). For example, a well-established
bioindicator strain for sterilization control, ATCC 6633 (
11),
was investigated with respect to biosynthesis of the lantibiotic
subtilin (
4,
8,
16,
27) and its regulation (
26,
28). In a series
of
B. subtilis strains production of the nonribosomally synthesized
cyclic lipopeptides surfactin, fengycin, and the iturins, including
mycosubtilin, with different compositions has been observed
(
9,
18,
20,
31).
Subtilosin is a macrocyclic bacteriocin with three intramolecular bridges (14, 19). An acidic isoelectric point differentiates subtilosin from the basic lantibiotics (13, 24). Subtilosin transcription is increased under oxygen-limited and anaerobic conditions (22; T. Stein, S. Düsterhus, A. Stroh, and K.-D. Entian, 10th Int. Conf. Bacilli, abstr. P103, p. 65, 1999). The production of mature subtilosin is based on the expression of the sbo-alb gene cluster encompassing the subtilosin structural gene sbo and genes involved in posttranslational modification and processing of presubtilosin and in immunity (34, 35).
Here we describe subtilosin production by eight different B. subtilis wild-type strains and Bacillus atrophaeus. The sbo genes of these organisms, as well as the entire subtilosin gene cluster of B. subtilis ATCC 6633, were sequenced in order to analyze the genetic variation between B. subtilis wild-type strains.

MATERIALS AND METHODS
Strains and plasmids.
Strains used in this work are listed in Table
1. Recombinant
plasmids were amplified in
Escherichia coli DH5

or TG1 grown
in Luria-Bertani medium (GIBCO, Neu-Isenburg, Germany).
B. subtilis was grown either on TY (0.8% tryptone, 0.5% yeast extract [Difco,
Detroit, Mich.], 0.5% NaCl) or on Landy medium supplemented
with 0.1% yeast extract (
33). Antibiotics were used at the following
concentrations: 100 µg of ampicillin per ml and 20 µg
of chloramphenicol per ml for
E. coli and 5 µg of chloramphenicol
per ml, 10 µg of kanamycin per ml, and 100 µg of
spectinomycin per ml for
B. subtilis.
Plasmid isolation and PCR.
Established protocols were used for molecular biology techniques
(
25), and
E. coli plasmids were isolated by the rapid alkaline
extraction procedure (
5). DNA amplification with Taq DNA polymerase
was performed according to the instructions of the commercial
supplier (Boehringer GmbH, Mannheim, Germany) by using a Hybaid
R2 Combi-thermal reactor. DNA was cleaved and isolated with
a QIAquick purification kit (Qiagen GmbH, Hilden, Germany).
Oligonucleotides were purchased from ARK Scientific GmbH Biosystems,
Darmstadt, Germany. Sequencing by primer walking was carried
out by Scientific Research and Development, Oberursel/Frankfurt,
Germany; nucleotide sequences were determined at least two times
for each DNA strand.
sbo deletion in B. subtilis 168 and ATCC 6633.
Primers TS13C (GAATTGACACTATCTAGAGAAATGCCG) and TS14 (ATCCGGTGGTGCGGAATTCGATGA) (restriction sites are underlined) were designed by using the genome sequence of B. subtilis 168 (15). A 1,375-bp DNA fragment including the sbo gene was PCR amplified, cleaved with EcoRI and XbaI, and cloned into pUC19. To remove an NdeI restriction site, the resulting plasmid, pTSsbo, was cleaved with NarI and AatII, and blunt ends were generated after exonuclease treatment. The self-ligation product (pSD13) was cleaved with NdeI and the Klenow frag-ment, and the sbo gene was removed by BglII cleavage. Into the resulting blunt and BglII sites, a Sau3A/HincII site-containing cat gene obtained from pCE26 (16) was cloned. The plasmid constructed, pSD15, was linearized and used for transformation of competent B. subtilis 168 cells as described previously (2), with slight modifications as described by Klein et al. (16). An sbo deletion in B. subtilis ATCC 6633 was obtained after transformation with chromosomal DNA obtained from the corresponding B. subtilis 168 strain. For construction of the B. subtilis
spaS/
sbo strain ATCC 6633, the chloramphenicol resistance cassette of the
spaS strain (16) was replaced by a gene conferring resistance to spectinomycin (pJL62) by in vivo recombination (30) prior to deletion of sbo.
Primer extension.
Total RNA was prepared from overnight cultures grown in Landy medium by using an RNeasy mini-kit (Qiagen) and was treated with 20 U of high-performance liquid chromatography (HPLC)-grade DNase. (Amersham Biosciences, Freiburg, Germany) in 40 mM Tris-HCl (pH 7.5)-60 mM MgCl2 in a 50-µl (final volume) mixture for 30 min at 37°C. RNA was isolated, precipitated with ethanol, and dissolved in 20 µl of H2O. Primer extension analyses with primer AS26 (CCCCATAGACCGAATAGACCTG) were performed as previously described (26).
Reversed-phase HPLC and mass spectrometry.
Culture supernatants of B. subtilis strains were separated by reversed-phase HPLC by using C18-Hypersil (particle size, 5 µm; precolumn dimensions, 4 by 10 mm; main column dimensions, 2 by 100 mm; Maisch, Ammerbuch, Germany). Eluents A and B were composed of 0.1% (vol/vol) trifluoroacetic acid and 20% (vol/vol) acetonitrile in water and 0.1% (vol/vol) trifluoroacetic acid in acetonitrile, respectively. A sample was applied with 100% eluent A and eluted with segmented gradients of acetonitrile (20% eluent B for 5 min, 20 to 40% eluent B for 20 min, and 40 to 100% eluent B for 5 min) (29). Delayed-extraction matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectra were recorded with a Voyager-RP-DE instrument (PerSeptive, Framingham, Mass.) by using a 337-nm nitrogen laser for desorption and ionization (19). The total acceleration voltage was 20 kV; 11.6 kV was used for the first grid. Reversed-phase HPLC fractions (0.7 µl) were mixed with 0.7 µl of matrix solution (20 µg of
-cyano-ß-hydroxycinnamic acid [Sigma] µl1 in eluent A) on the sample target and dried in the ambient air. Between 128 and 256 single scans were accumulated for each mass spectrum. The delay time was 375 ns.
Nucleotide sequence accession number.
The nucleotide sequence reported here has been deposited in the EMBL nucleotide sequence database under accession number AJ430547.

RESULTS AND DISCUSSION
Antibiotic production by different
B. subtilis strains was investigated
by performing antimicrobial activity tests, reversed-phase HPLC
separation of culture supernatants, and MALDI-TOF mass spectrometry
(Fig.
1). For strain ATCC 6633, a representative strain, subtilin
and its isoform [
N-alpha-succinyl-Trp1]-subtilin are responsible
for the main anti-
Micrococcus activity. Consequently, the
spaS subtilin deletion strain exhibited no subtilin production. For
the previously unidentified active antimicrobial compound in
peak II (Fig.
1B) an
m/z value of 3400.7 was determined (Fig.
1C). Both the
m/z value and the elution position are consistent
with the properties of authentic subtilosin produced by
B. subtilis 168 (
3,
19). In addition, peak II (subtilosin) was not observed
in the supernatant of the
spaS/
sbo double mutant (Fig.
1B),
clearly demonstrating that the newly identified ATCC 6633 bacteriocin
is based on
sbo gene expression and demonstrating that it is
identical to subtilosin. In fractions eluting around 20 min
(Fig.
1B) the lipopeptides surfactin and mycosubtilin were observed.
The production of these compounds was not affected in the gene
deletion mutants (data not shown). Surprisingly, all eight
B. subtilis wild-type strains investigated, including
B. atrophaeus (black-pigmented
B. subtilis; formerly
B. subtilis DSM 2207
or ATCC 51189) (
11), that are listed in Table
1 have been found
to produce subtilosin. This finding was unprecedented because
most of the known
B. subtilis wild-type strains produce individual
antibiotic cocktails. For example, subtilin production has been
described only for the ATCC 6633 strain, and distinct lipopeptides
are produced only by a few individual strains. The widespread
occurrence of subtilosin might reflect an important physiological
role. As subtilosin is produced at the end of exponential growth,
particularly under stress conditions, a specific function of
subtilosin as an antibiotic, killing factor (
12) or as a pheromone
during anaerobic or biofilm growth of
B. subtilis (
15) has to
be considered.
During cloning of
B. subtilis ATCC 6633 DNA we observed restriction
sites not present in the genome of strain 168 (
15), while proposed
sites were absent. We sequenced the
sbo genes and flanking regions
of all investigated
B. subtilis wild-type strains in order to
analyze the structural basis of these observations and to evaluate
possible evolutionary relationships among the subtilosin producers.
The main result of a comparison of the
sbo alleles was identification
of two distinct
B. subtilis classes (Fig.
2A). Class 1 (168-like)
includes strains 60015 (Marburg strain), 168, and 10
T (type
strain), as well as DSM 1088 and DSM 2109. Class 2 (W23-like)
comprises strains ATCC 6633 and DSM 618, as well as DSM 6405,
a mutant of the W23 strain. This observation is in good agreement
with the recent classification of strain 168 as
B. subtilis subsp.
subtilis and the recent classification of W23-related
strains as
B. subtilis subsp.
spizizenii based on DNA reassociation
studies (
21).
Remarkably, the nucleotide sequences of the
sbo genes and flanking
regions are identical in strains belonging to the same subspecies,
and the sequences differ by three nucleotides in the two subspecies
(Fig.
2A). However, the encoded Sbo prepeptides are identical
in all cases. Primer extension analyses of
sbo transcripts in
representatives of both
B. subtilis classes revealed transcriptional
start sites that are 47 nucleotides (class 2 strain ATCC 6633)
and 45 nucleotides (class 1 strain 168) upstream of the start
ATG codon of
sbo (Fig.
3). Similar 5' transcriptional start
sites are utilized by both
B. subtilis classes. Due to a two-nucleotide
insertion into class 2 sequences, the sizes of the transcripts
differ by two nucleotides. The 10 and 35 regions
derived from the transcriptional start sites resemble promoter
regions utilized by sigma factor A (Fig.
2A). Remarkably, within
the 10 region two nucleotide substitutions in both
B. subtilis classes were observed, which suggests that there is
an effect on
sbo expression. However, a region upstream of the
35 region (positions 70 to 110) is perfectly
conserved. This region represents a perfect sigma factor H binding
site; however, involvement of this region in regulation of subtilosin
biosynthesis has not been shown yet.
Downstream of
sbo a gene cluster with seven open reading frames
(
ywiA and
ywhRQPOMN) has been identified and sequenced in
B. subtilis ATCC 6633, a representative of the
B. subtilis subsp.
spizizenii strains (accession number
AJ430547). The identified
gene cluster exhibits a high level of homology to the
sbo-alb gene cluster of
B. subtilis 168 involved in the biosynthesis
of subtilosin, including the structural gene, as well as genes
encoding the posttranslational modification machinery and subtilosin
immunity proteins. BLAST alignments (Table
2) revealed that
the first four genes are highly conserved with those of
B. subtilis subsp.
subtilis (96 to 100% amino acid identity), while the
remaining four genes are less conserved (83 to 88% identity).
These differences reveal incipient evolutionary divergence of
the
B. subtilis subspecies. This low level of conservation is
unprecedented; for example, thymidylate synthases A (
thyA) in
B. subtilis subsp.
spizizenii ATCC 6633 and W23 and
B. subtilis subsp.
subtilis (168) exhibit more than 95% amino acid identity
(
32). Even the average level of amino acid identity for the
DNA gyrases (
gyrA) in seven
Bacillus type strains was 95.1%
(
7).
The nucleotide sequences of the closely related species and
subspecies can be used for identification of genes and highly
conserved regions in the gene products putatively corresponding
to functional domains. For example, in strain 168 a new gene
with an unknown function,
sboX, encoding a bacteriocin-like
product, was hypothesized (Fig.
2A) (
34), which resides in an
open reading frame overlapping the coding region of
sbo. Notably,
the expression of
sboX would result in a 22-amino-acid truncated
peptide in W23-like strains compared to the peptide produced
by 168-like strains (Fig.
2B), which makes it unlikely that
SboX is produced by W23-like strains.
YwiA (AlbA) is involved in subtilosin biosynthesis, most likely in the posttranslational modification of presubtilosin (34, 35), although its molecular function is unknown. The amino acid sequences of YwiA in the two B. subtilis subspecies (Fig. 4) were compared, and two highly conserved regions (amino acids 1 to 90 and 109 to 450) separated by a less conserved linker region (amino acids 91 to 105) were identified. The large conserved domain from amino acid 109 to amino acid 450 exhibits homology to proteins belonging to the MoaA-NifB-PqqE family, which carry Fe-S centers in their active sites. Also, this cysteine-rich cofactor binding region is conserved in YwiA (core 1), as is a second CXXC motif near the C terminus (core 2). A pattern search for core 2 of YwiA proteins (Fig. 4) revealed homology to arylsulfatases and metallothioneins. Upstream of this signature sequence an unusual sulfur-rich motif (CMXXXC) with an unknown function has been found in YwiA proteins.
As this study revealed, two distinct
B. subtilis subspecies
(
B. subtilis subsp.
subtilis and
B. subtilis subsp.
spizizenii)
are distinguishable only on the basis of their
sbo genes. Comparisons
between the subtilosin gene clusters of the two subspecies led
to identification of highly conserved protein domains and also
provided insight into incipient evolutionary divergence.

ACKNOWLEDGMENTS
We greatly acknowledge Michael Karas, University Frankfurt,
for the opportunity to use his MALDI-TOF mass spectrometric
equipment and J. Hofemeister for valuable discussions and for
the kind gift of various
B. subtilis wild-type strains.

FOOTNOTES
* Corresponding author. Mailing address: Institut für Mikrobiologie, Johann Wolfgang Goethe-Universität, Marie-Curie-Strasse 9-11, D-60439 Frankfurt am Main, Germany. Phone: 49/69-79829522. Fax: 49/69-79829527. E-mail:
T.Stein{at}em.uni-frankfurt.de.


REFERENCES
1 - Ahimou, F., P. Jacques, and M. Deleu. 2000. Surfactin and iturin A effects on Bacillus subtilis surface hydrophobicity. Enzyme Microb. Technol. 27:749-754.[CrossRef][Medline]
2 - Anagnostopoulos, C., and J. Spizizen. 1961. Requirements for transformation in Bacillus subtilis. J. Bacteriol. 81:741-746.[Free Full Text]
3 - Babasaki, K., T. Takao, Y. Shimonishi, and K. Kurahashi. 1985. Subtilosin A, a new antibiotic peptide produced by Bacillus subtilis 168: isolation, structural analysis, and biogenesis. J. Biochem. (Tokyo) 98:585-603.[Abstract/Free Full Text]
4 - Banerjee, S., and J. N. Hansen. 1988. Structure and expression of a gene encoding the precursor of subtilin, a small protein antibiotic. J. Biol. Chem. 263:9508-9514.[Abstract/Free Full Text]
5 - Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7:1513-1523.[Abstract/Free Full Text]
6 - Burkholder, P. R., and N. H. Giles. 1947. Induced biochemical mutants in Bacillus subtilis. Am. J. Bot. 34:345-348.[CrossRef]
7 - Chun, J., and K. S. Bae. 2000. Phylogenetic analysis of Bacillus subtilis and related taxa based on partial gyrA gene sequences. Antonie Leeuwenhoek 78:123-127.
8 - Corvey, C., T. Stein, S. Düsterhus, M. Karas, and K.-D. Entian. 2003. Activation of subtilin precursors by Bacillus subtilis extracellular serine proteases subtilisin (AprE), WprA, and Vpr. Biochem. Biophys. Res. Commun. 304:48-54.[CrossRef][Medline]
9 - Duitman, E. H., L. W. Hamoen, M. Rembold, G. Venema, H. Seitz, W. Saenger, F. Bernhard, R. Reinhardt, M. Schmidt, C. Ullrich, T. Stein, F. Leenders, and J. Vater. 1999. The mycosubtilin synthetase of Bacillus subtilis ATCC 6633: a multifunctional hybrid between a peptide synthetase, an amino transferase, and a fatty acid synthase. Proc. Natl. Acad. Sci. USA 96:13294-13299.[Abstract/Free Full Text]
10 - Freese, E., and P. Fortnagel. 1967. Analysis of sporulation mutants. I. Response of uracil incorporation to carbon sources, and other mutant properties. J. Bacteriol. 94:1957-1969.[Abstract/Free Full Text]
11 - Fritze, D., and R. Pukall. 2001. Reclassification of bioindicator strains Bacillus subtilis DSM 675 and Bacillus subtilis DSM 2277 as Bacillus atrophaeus. Int. J. Syst. Evol. Microbiol. 51:35-37.[Abstract]
12 - Gonzalez-Pastor, J. E., E. C. Hobbs, and R. Losick. 2003. Cannibalism by sporulating bacteria. Science 301:510-513.[Abstract/Free Full Text]
13 - Jack, R. W., and G. Jung. 2000. Lantibiotics and microcins: polypeptides with unusual chemical diversity. Curr. Opin. Chem. Biol. 4:310-317.[CrossRef][Medline]
14 - Kawulka, K., T. Sprules, R. T. McKay, P. Mercier, C. M. Diaper, P. Zuber, and J. C. Vederas. 2003. Structure of subtilosin A, an antimicrobial peptide from Bacillus subtilis with unusual posttranslational modifications linking cysteine sulfurs to alpha-carbons of phenylalanine and threonine. J. Am. Chem. Soc. 125:4726-4767.[CrossRef][Medline]
15 - Kearns, D. B., and R. Losick. 2003. Swarming motility in undomesticated Bacillus subtilis. Mol. Microbiol. 49:581-590.[CrossRef][Medline]
16 - Klein, C., C. Kaletta, N. Schnell, and K.-D. Entian. 1992. Analysis of genes involved in biosynthesis of the lantibiotic subtilin. Appl. Environ. Microbiol. 58:132-142.[Abstract/Free Full Text]
17 - Kunst, F., N. Ogasawara, I. Moszer, A. M. Albertini, G. Alloni, V. Azevedo, M. G. Bertero, P. Bessieres, A. Bolotin, S. Borchert, R. Borriss, L. Boursier, A. Brans, M. Braun, S. C. Brignell, S. Bron, S. Brouillet, C. V. Bruschi, B. Caldwell, V. Capuano, N. M. Carter, S. K. Choi, J. J. Codani, I. F. Connerton, A. Danchin, et al. 1997. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390:249-256.[CrossRef][Medline]
18 - Leenders, F., T. H. Stein, B. Kablitz, P. Franke, and J. Vater. 1999. Rapid typing of Bacillus subtilis strains by their secondary metabolites using matrix-assisted laser desorption/ionization mass spectrometry of intact cells. Rapid Commun. Mass Spectrom. 13:943-949.[CrossRef]
19 - Marx, R., T. Stein, K.-D. Entian, and S. J. Glaser. 2001. Structure of the Bacillus subtilis peptide antibiotic subtilosin A determined by 1H-NMR and matrix assisted laser desorption/ionization time-of-flight mass spectrometry. J. Protein Chem. 6:501-506.
20 - Menkhaus, M., C. Ullrich, B. Kluge, J. Vater, D. Vollenbroich, and R. M. Kamp. 1993. Structural and functional organization of the surfactin synthetase multienzyme system. J. Biol. Chem. 268:7678-7684.[Abstract/Free Full Text]
21 - Nakamura, L. K., M. S. Roberts, and F. M. Cohan. 1999. Relationship of Bacillus subtilis clades associated with strains 168 and W23: a proposal for Bacillus subtilis subsp. subtilis subsp. nov. and Bacillus subtilis subsp. spizizenii subsp. nov. Int. J. Syst. Bacteriol. 49:1211-1215.[Abstract/Free Full Text]
22 - Nakano, M. M., G. Zheng, and P. Zuber. 2000. Dual control of sbo-alb operon expression by the Spo0 and ResDE systems of signal transduction under anaerobic conditions in Bacillus subtilis. J. Bacteriol. 182:3274-3277.[Abstract/Free Full Text]
23 - Raleigh, E. A., R. Trimarchi, and H. Revel. 1989. Genetic and physical mapping of the mcrA (rglA) and mcrB (rglB) loci of Escherichia coli K-12. Genetics 122:279-296.[Abstract/Free Full Text]
24 - Sahl, H. G., and G. Bierbaum. 1998. Lantibiotics: biosynthesis and biological activities of uniquely modified peptides from gram-positive bacteria. Annu. Rev. Microbiol. 52:41-79.[CrossRef][Medline]
25 - Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
26 - Stein, T., S. Borchert, P. Kiesau, S. Heinzmann, S. Klöss, C. Klein, M. Helfrich, and K.-D. Entian. 2002. Dual control of subtilin biosynthesis and immunity in Bacillus subtilis. Mol. Microbiol. 44:403-416.[CrossRef][Medline]
27 - Stein, T., and K.-D. Entian. 2002. Maturation of the lantibiotic subtilin: matrix-assisted laser desorption/ionization time-of-flight mass spectrometry to monitor precursors and their proteolytic processing in crude bacterial cultures. Rapid Commun. Mass Spectrom. 16:103-110.[CrossRef][Medline]
28 - Stein, T., S. Heinzmann, P. Kiesau, B. Himmel, and K.-D. Entian. 2003. The spa-box for transcriptional activation of subtilin biosynthesis and immunity in Bacillus subtilis. Mol. Microbiol. 47:1627-1636.[CrossRef][Medline]
29 - Stein, T., S. Heinzmann, I. Solovieva, and K.-D. Entian. 2003. Function of Lactococcus lactis nisin immunity genes nisI and nisFEG after coordinated expression in the surrogate host Bacillus subtilis. J. Biol. Chem. 278:89-94.[Abstract/Free Full Text]
30 - Steinmetz, M., and R. Richter. 1994. Plasmids designed to alter the antibiotic resistance expressed by insertion mutations in Bacillus subtilis, through in vivo recombination. Gene 142:79-83.[CrossRef][Medline]
31 - Steller, S., D. Vollenbroich, F. Leenders, T. Stein, B. Conrad, J. Hofemeister, P. Jacques, P. Thonart, and J. Vater. 1999. Structural and functional organization of the fengycin synthetase multienzyme system from Bacillus subtilis b213 and A1/3. Chem. Biol. 6:31-41.[CrossRef][Medline]
32 - Tam, N. H., and R. Borriss. 1998. Genes encoding thymidylate synthases A and B in the genus Bacillus are members of two distinct families. Mol. Gen. Genet. 258:427-430.[Medline]
33 - Ullrich, C., B. Kluge, Z. Palacz, J. Vater, F. Baumgart, B. Kluge, C. Ullrich, J. Vater, and D. Ziessow. 1991. Cell-free biosynthesis of surfactin, a cyclic lipopeptide produced by Bacillus subtilis. Identification of amino acid substitutions in the lipopeptide surfactin using 2D NMR spectroscopy. Biochemistry 30:6503-6508.[CrossRef][Medline]
34 - Zheng, G., R. Hehn, and P. Zuber. 2000. Mutational analysis of the sbo-alb locus of Bacillus subtilis: identification of genes required for subtilosin production and immunity. J. Bacteriol. 182:3266-3273.[Abstract/Free Full Text]
35 - Zheng, G., L. Z. Yan, J. C. Vederas, and P. Zuber. 1999. Genes of the sbo-alb locus of Bacillus subtilis are required for production of the antilisterial bacteriocin subtilosin. J. Bacteriol. 181:7346-7355.[Abstract/Free Full Text]
Applied and Environmental Microbiology, April 2004, p. 2349-2353, Vol. 70, No. 4
0099-2240/04/$08.00+0 DOI: 10.1128/AEM.70.4.2349-2353.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Huang, T., Geng, H., Miyyapuram, V. R., Sit, C. S., Vederas, J. C., Nakano, M. M.
(2009). Isolation of a Variant of Subtilosin A with Hemolytic Activity. J. Bacteriol.
191: 5690-5696
[Abstract]
[Full Text]
-
Shelburne, C. E., An, F. Y., Dholpe, V., Ramamoorthy, A., Lopatin, D. E., Lantz, M. S.
(2007). The spectrum of antimicrobial activity of the bacteriocin subtilosin A. J Antimicrob Chemother
59: 297-300
[Abstract]
[Full Text]
-
Leclere, V., Bechet, M., Adam, A., Guez, J.-S., Wathelet, B., Ongena, M., Thonart, P., Gancel, F., Chollet-Imbert, M., Jacques, P.
(2005). Mycosubtilin Overproduction by Bacillus subtilis BBG100 Enhances the Organism's Antagonistic and Biocontrol Activities. Appl. Environ. Microbiol.
71: 4577-4584
[Abstract]
[Full Text]