Subtilosin Production by Two Bacillus subtilis Subspecies and Variance of the sbo-alb Cluster

Eight different Bacillus subtilis strains and Bacillus atrophaeuswere found to produce the bacteriocin subtilosin A. On the basisof the subtilosin gene (sbo) sequences two distinct classesof B. subtilis strains were distinguished, and they fell intothe two B. subtilis subspecies (B. subtilis subsp. subtilisand B. subtilis subsp. spizizenii). The entire sequence of thesubtilosin gene cluster of a B. subtilis subsp. spizizenii strain,B. subtilis ATCC 6633, was determined. This sequence exhibiteda high level of homology to the sequence of the sbo-alb genelocus of B. subtilis 168. By using primer extension analysisthe transcriptional start sites of sbo in B. subtilis strainsATCC 6633 and 168 were found to be 47 and 45 bp upstream ofthe sbo start codon, respectively. Our results provide insightinto the incipient evolutionary divergence of the two B. subtilissubspecies.

INTRODUCTION

Top

Introduction

Almost 4% of the 4.2-Mbp Bacillus subtilis 168 genome codesfor proteins similar to the proteins involved in the biosynthesisof antimicrobial metabolites (17). However, B. subtilis 168produces only a few antibiotics because several of the biosyntheticpathways are not functional, most likely because of the X-raymutation of the original Marburg strain (6). In contrast, variousother B. subtilis wild-type strains produce characteristic cocktailsof numerous peptide antibiotics (1, 18). For example, a well-establishedbioindicator strain for sterilization control, ATCC 6633 (11),was investigated with respect to biosynthesis of the lantibioticsubtilin (4, 8, 16, 27) and its regulation (26, 28). In a seriesof B. subtilis strains production of the nonribosomally synthesizedcyclic lipopeptides surfactin, fengycin, and the iturins, includingmycosubtilin, with different compositions has been observed(9, 18, 20, 31).

Subtilosin is a macrocyclic bacteriocin with three intramolecularbridges (14, 19). An acidic isoelectric point differentiatessubtilosin from the basic lantibiotics (13, 24). Subtilosintranscription is increased under oxygen-limited and anaerobicconditions (22; T. Stein, S. Düsterhus, A. Stroh, and K.-D.Entian, 10th Int. Conf. Bacilli, abstr. P103, p. 65, 1999).The production of mature subtilosin is based on the expressionof the sbo-alb gene cluster encompassing the subtilosin structuralgene sbo and genes involved in posttranslational modificationand processing of presubtilosin and in immunity (34, 35).

Here we describe subtilosin production by eight different B.subtilis wild-type strains and Bacillus atrophaeus. The sbogenes of these organisms, as well as the entire subtilosin genecluster of B. subtilis ATCC 6633, were sequenced in order toanalyze the genetic variation between B. subtilis wild-typestrains.

MATERIALS AND METHODS

Top

Materials and Methods

Strains and plasmids.
Strains used in this work are listed in Table 1. Recombinantplasmids were amplified in Escherichia coli DH5 ${alpha}$ or TG1 grownin Luria-Bertani medium (GIBCO, Neu-Isenburg, Germany). B. subtiliswas grown either on TY (0.8% tryptone, 0.5% yeast extract [Difco,Detroit, Mich.], 0.5% NaCl) or on Landy medium supplementedwith 0.1% yeast extract (33). Antibiotics were used at the followingconcentrations: 100 µg of ampicillin per ml and 20 µgof chloramphenicol per ml for E. coli and 5 µg of chloramphenicolper ml, 10 µg of kanamycin per ml, and 100 µg ofspectinomycin per ml for B. subtilis.

View this table:
[in this window]
[in a new window]
TABLE 1. Strains used

Plasmid isolation and PCR.
Established protocols were used for molecular biology techniques(25), and E. coli plasmids were isolated by the rapid alkalineextraction procedure (5). DNA amplification with Taq DNA polymerasewas performed according to the instructions of the commercialsupplier (Boehringer GmbH, Mannheim, Germany) by using a HybaidR2 Combi-thermal reactor. DNA was cleaved and isolated witha QIAquick purification kit (Qiagen GmbH, Hilden, Germany).Oligonucleotides were purchased from ARK Scientific GmbH Biosystems,Darmstadt, Germany. Sequencing by primer walking was carriedout by Scientific Research and Development, Oberursel/Frankfurt,Germany; nucleotide sequences were determined at least two timesfor each DNA strand.

sbo deletion in B. subtilis 168 and ATCC 6633.
Primers TS13C (GAATTGACACTATCTAGAGAAATGCCG) and TS14 (ATCCGGTGGTGCGGAATTCGATGA)(restriction sites are underlined) were designed by using thegenome sequence of B. subtilis 168 (15). A 1,375-bp DNA fragmentincluding the sbo gene was PCR amplified, cleaved with EcoRIand XbaI, and cloned into pUC19. To remove an NdeI restrictionsite, the resulting plasmid, pTSsbo, was cleaved with NarI andAatII, and blunt ends were generated after exonuclease treatment.The self-ligation product (pSD13) was cleaved with NdeI andthe Klenow frag-ment, and the sbo gene was removed by BglIIcleavage. Into the resulting blunt and BglII sites, a Sau3A/HincIIsite-containing cat gene obtained from pCE26 (16) was cloned.The plasmid constructed, pSD15, was linearized and used fortransformation of competent B. subtilis 168 cells as describedpreviously (2), with slight modifications as described by Kleinet al. (16). An sbo deletion in B. subtilis ATCC 6633 was obtainedafter transformation with chromosomal DNA obtained from thecorresponding B. subtilis 168 strain. For construction of theB. subtilis ${Delta}$ spaS/ ${Delta}$ sbo strain ATCC 6633, the chloramphenicol resistancecassette of the ${Delta}$ spaS strain (16) was replaced by a gene conferringresistance to spectinomycin (pJL62) by in vivo recombination(30) prior to deletion of sbo.

Primer extension.
Total RNA was prepared from overnight cultures grown in Landymedium by using an RNeasy mini-kit (Qiagen) and was treatedwith 20 U of high-performance liquid chromatography (HPLC)-gradeDNase. (Amersham Biosciences, Freiburg, Germany) in 40 mM Tris-HCl(pH 7.5)-60 mM MgCl₂ in a 50-µl (final volume) mixturefor 30 min at 37°C. RNA was isolated, precipitated withethanol, and dissolved in 20 µl of H₂O. Primer extensionanalyses with primer AS26 (CCCCATAGACCGAATAGACCTG) were performedas previously described (26).

Reversed-phase HPLC and mass spectrometry.
Culture supernatants of B. subtilis strains were separated byreversed-phase HPLC by using C₁₈-Hypersil (particle size, 5µm; precolumn dimensions, 4 by 10 mm; main column dimensions,2 by 100 mm; Maisch, Ammerbuch, Germany). Eluents A and B werecomposed of 0.1% (vol/vol) trifluoroacetic acid and 20% (vol/vol)acetonitrile in water and 0.1% (vol/vol) trifluoroacetic acidin acetonitrile, respectively. A sample was applied with 100%eluent A and eluted with segmented gradients of acetonitrile(20% eluent B for 5 min, 20 to 40% eluent B for 20 min, and40 to 100% eluent B for 5 min) (29). Delayed-extraction matrix-assistedlaser desorption ionization-time of flight (MALDI-TOF) massspectra were recorded with a Voyager-RP-DE instrument (PerSeptive,Framingham, Mass.) by using a 337-nm nitrogen laser for desorptionand ionization (19). The total acceleration voltage was 20 kV;11.6 kV was used for the first grid. Reversed-phase HPLC fractions(0.7 µl) were mixed with 0.7 µl of matrix solution(20 µg of ${alpha}$ -cyano-ß-hydroxycinnamic acid [Sigma]µl^–1 in eluent A) on the sample target and driedin the ambient air. Between 128 and 256 single scans were accumulatedfor each mass spectrum. The delay time was 375 ns.

Nucleotide sequence accession number.
The nucleotide sequence reported here has been deposited inthe EMBL nucleotide sequence database under accession numberAJ430547.

RESULTS AND DISCUSSION

Top

Results and Discussion

Antibiotic production by different B. subtilis strains was investigatedby performing antimicrobial activity tests, reversed-phase HPLCseparation of culture supernatants, and MALDI-TOF mass spectrometry(Fig. 1). For strain ATCC 6633, a representative strain, subtilinand its isoform [N-alpha-succinyl-Trp1]-subtilin are responsiblefor the main anti-Micrococcus activity. Consequently, the ${Delta}$ spaSsubtilin deletion strain exhibited no subtilin production. Forthe previously unidentified active antimicrobial compound inpeak II (Fig. 1B) an m/z value of 3400.7 was determined (Fig.1C). Both the m/z value and the elution position are consistentwith the properties of authentic subtilosin produced by B. subtilis168 (3, 19). In addition, peak II (subtilosin) was not observedin the supernatant of the ${Delta}$ spaS/ ${Delta}$ sbo double mutant (Fig. 1B),clearly demonstrating that the newly identified ATCC 6633 bacteriocinis based on sbo gene expression and demonstrating that it isidentical to subtilosin. In fractions eluting around 20 min(Fig. 1B) the lipopeptides surfactin and mycosubtilin were observed.The production of these compounds was not affected in the genedeletion mutants (data not shown). Surprisingly, all eight B.subtilis wild-type strains investigated, including B. atrophaeus(black-pigmented B. subtilis; formerly B. subtilis DSM 2207or ATCC 51189) (11), that are listed in Table 1 have been foundto produce subtilosin. This finding was unprecedented becausemost of the known B. subtilis wild-type strains produce individualantibiotic cocktails. For example, subtilin production has beendescribed only for the ATCC 6633 strain, and distinct lipopeptidesare produced only by a few individual strains. The widespreadoccurrence of subtilosin might reflect an important physiologicalrole. As subtilosin is produced at the end of exponential growth,particularly under stress conditions, a specific function ofsubtilosin as an antibiotic, killing factor (12) or as a pheromoneduring anaerobic or biofilm growth of B. subtilis (15) has tobe considered.

View larger version (62K):
[in this window]
[in a new window]
FIG. 1. Analysis of B. subtilis peptide antibiotics. (A) Micrococcus luteus growth inhibition assay. Streak 1, B. subtilis wild-type strain ATCC 6633; streak 2, strain ATCC 6633 ${Delta}$ spaS deletion mutant; streak 3, strain ATCC 6633 ${Delta}$ sbo deletion mutant; streak 4, strain ATCC 6633 ${Delta}$ spaS/ ${Delta}$ sbo deletion mutant; streak 5, strain 168 ${Delta}$ sbo deletion mutant; streak 6, B. subtilis wild-type strain 168. (B) Reversed-phase HPLC separation of B. subtilis ATCC 6633 culture supernatants. The flow rate was 0.4 ml/min, and 400-µl fractions were collected. Aliquots (20 µl) of the wild type (top panel), the ${Delta}$ spaS mutant (middle panel), and the ${Delta}$ spaS/ ${Delta}$ sbo double mutant (bottom panel) were used to inhibit the growth of M. luteus. (C) Detail of MALDI-TOF mass spectra of peak I (m/z 3319.4 and 3419.4 correspond to subtilin and succinylated subtilin, respectively) and peak II (m/z 3400.7 corresponds to subtilosin A). The variance of the m/z measurements was ±0.2 Da.

During cloning of B. subtilis ATCC 6633 DNA we observed restrictionsites not present in the genome of strain 168 (15), while proposedsites were absent. We sequenced the sbo genes and flanking regionsof all investigated B. subtilis wild-type strains in order toanalyze the structural basis of these observations and to evaluatepossible evolutionary relationships among the subtilosin producers.The main result of a comparison of the sbo alleles was identificationof two distinct B. subtilis classes (Fig. 2A). Class 1 (168-like)includes strains 60015 (Marburg strain), 168, and 10^T (typestrain), as well as DSM 1088 and DSM 2109. Class 2 (W23-like)comprises strains ATCC 6633 and DSM 618, as well as DSM 6405,a mutant of the W23 strain. This observation is in good agreementwith the recent classification of strain 168 as B. subtilissubsp. subtilis and the recent classification of W23-relatedstrains as B. subtilis subsp. spizizenii based on DNA reassociationstudies (21).

View larger version (45K):
[in this window]
[in a new window]
FIG. 2. Comparison of sbo alleles of two B. subtilis classes. (A) Subtilosin A-encoding gene sequence sbo and flanking regions and the derived amino acid sequence. rbs, standard prokaryotic ribosome binding site. Transcriptional start sites (see Fig. 3) are indicated by arrows, and the positions of derived –10 and –35 regions are indicated. H1 and H2 indicate a putative sigma factor H region located 80 to 100 bp upstream of the transcriptional start site of sbo. A putative termination loop is enclosed in a box. The putative open reading frame sboX (150 nucleotides) is indicated by brackets. (B) Alignment of the amino acid sequences of the putative SboX gene product. The arrow indicates the putative processing site (double Gly motif). Differences between the two alleles are indicated by shading.

Remarkably, the nucleotide sequences of the sbo genes and flankingregions are identical in strains belonging to the same subspecies,and the sequences differ by three nucleotides in the two subspecies(Fig. 2A). However, the encoded Sbo prepeptides are identicalin all cases. Primer extension analyses of sbo transcripts inrepresentatives of both B. subtilis classes revealed transcriptionalstart sites that are 47 nucleotides (class 2 strain ATCC 6633)and 45 nucleotides (class 1 strain 168) upstream of the startATG codon of sbo (Fig. 3). Similar 5' transcriptional startsites are utilized by both B. subtilis classes. Due to a two-nucleotideinsertion into class 2 sequences, the sizes of the transcriptsdiffer by two nucleotides. The –10 and –35 regionsderived from the transcriptional start sites resemble promoterregions utilized by sigma factor A (Fig. 2A). Remarkably, withinthe –10 region two nucleotide substitutions in both B.subtilis classes were observed, which suggests that there isan effect on sbo expression. However, a region upstream of the–35 region (positions –70 to –110) is perfectlyconserved. This region represents a perfect sigma factor H bindingsite; however, involvement of this region in regulation of subtilosinbiosynthesis has not been shown yet.

View larger version (79K):
[in this window]
[in a new window]
FIG. 3. Primer extension analysis of sbo: mapping of the transcriptional start site of sbo by primer extension analysis with RNA from B. subtilis ATCC 6633 and 168 (middle lanes). The outside lanes show the results of autoradiography of dideoxynucleotide sequencing reactions with primer AS26 complementary to the 5' region of sbo. The transcriptional start sites are indicated by arrows, and the –10 regions are enclosed by boxes in the derived nucleotide sequence.

Downstream of sbo a gene cluster with seven open reading frames(ywiA and ywhRQPOMN) has been identified and sequenced in B.subtilis ATCC 6633, a representative of the B. subtilis subsp.spizizenii strains (accession number AJ430547). The identifiedgene cluster exhibits a high level of homology to the sbo-albgene cluster of B. subtilis 168 involved in the biosynthesisof subtilosin, including the structural gene, as well as genesencoding the posttranslational modification machinery and subtilosinimmunity proteins. BLAST alignments (Table 2) revealed thatthe first four genes are highly conserved with those of B. subtilissubsp. subtilis (96 to 100% amino acid identity), while theremaining four genes are less conserved (83 to 88% identity).These differences reveal incipient evolutionary divergence ofthe B. subtilis subspecies. This low level of conservation isunprecedented; for example, thymidylate synthases A (thyA) inB. subtilis subsp. spizizenii ATCC 6633 and W23 and B. subtilissubsp. subtilis (168) exhibit more than 95% amino acid identity(32). Even the average level of amino acid identity for theDNA gyrases (gyrA) in seven Bacillus type strains was 95.1%(7).

View this table:
[in this window]
[in a new window]
TABLE 2. Proteins derived from the subtilosin gene cluster

The nucleotide sequences of the closely related species andsubspecies can be used for identification of genes and highlyconserved regions in the gene products putatively correspondingto functional domains. For example, in strain 168 a new genewith an unknown function, sboX, encoding a bacteriocin-likeproduct, was hypothesized (Fig. 2A) (34), which resides in anopen reading frame overlapping the coding region of sbo. Notably,the expression of sboX would result in a 22-amino-acid truncatedpeptide in W23-like strains compared to the peptide producedby 168-like strains (Fig. 2B), which makes it unlikely thatSboX is produced by W23-like strains.

YwiA (AlbA) is involved in subtilosin biosynthesis, most likelyin the posttranslational modification of presubtilosin (34,35), although its molecular function is unknown. The amino acidsequences of YwiA in the two B. subtilis subspecies (Fig. 4)were compared, and two highly conserved regions (amino acids1 to 90 and 109 to 450) separated by a less conserved linkerregion (amino acids 91 to 105) were identified. The large conserveddomain from amino acid 109 to amino acid 450 exhibits homologyto proteins belonging to the MoaA-NifB-PqqE family, which carryFe-S centers in their active sites. Also, this cysteine-richcofactor binding region is conserved in YwiA (core 1), as isa second CXXC motif near the C terminus (core 2). A patternsearch for core 2 of YwiA proteins (Fig. 4) revealed homologyto arylsulfatases and metallothioneins. Upstream of this signaturesequence an unusual sulfur-rich motif (CMXXXC) with an unknownfunction has been found in YwiA proteins.

View larger version (25K):
[in this window]
[in a new window]
FIG. 4. Domain structure of YwiA (AlbA): schematic representation of the putative domain structure of YwiA resulting from amino acid alignment of the sequences of B. subtilis ATCC 6633 and 168. Highly conserved regions (cores) are indicated by solid boxes; a gray box indicates a less conserved region. The first cysteine cluster (core 1) is highly homologous to active sites of proteins belonging to the MoaA-NifB-PqqE family carrying Fe-S centers, like NifB from Pseudomonas aeruginosa (NIFB PSEAE), NarA from B. subtilis (NARA BACSU), PqqE from Methylobacterium extorquens (PQQE METEX), and MoaA from Arthrobacter nicotinovorans (MOAA ARTNI).

As this study revealed, two distinct B. subtilis subspecies(B. subtilis subsp. subtilis and B. subtilis subsp. spizizenii)are distinguishable only on the basis of their sbo genes. Comparisonsbetween the subtilosin gene clusters of the two subspecies ledto identification of highly conserved protein domains and alsoprovided insight into incipient evolutionary divergence.

ACKNOWLEDGMENTS

We greatly acknowledge Michael Karas, University Frankfurt,for the opportunity to use his MALDI-TOF mass spectrometricequipment and J. Hofemeister for valuable discussions and forthe kind gift of various B. subtilis wild-type strains.

FOOTNOTES

* Corresponding author. Mailing address: Institut für Mikrobiologie, Johann Wolfgang Goethe-Universität, Marie-Curie-Strasse 9-11, D-60439 Frankfurt am Main, Germany. Phone: 49/69-79829522. Fax: 49/69-79829527. E-mail: T.Stein{at}em.uni-frankfurt.de.

REFERENCES

Top