This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martinez, A.
Right arrow Articles by Osburne, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martinez, A.
Right arrow Articles by Osburne, M. S.
Agricola
Right arrow Articles by Martinez, A.
Right arrow Articles by Osburne, M. S.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, April 2004, p. 2452-2463, Vol. 70, No. 4
0099-2240/04/$08.00+0     DOI: 10.1128/AEM.70.4.2452-2463.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Genetically Modified Bacterial Strains and Novel Bacterial Artificial Chromosome Shuttle Vectors for Constructing Environmental Libraries and Detecting Heterologous Natural Products in Multiple Expression Hosts

Asuncion Martinez,* Steven J. Kolvek, Choi Lai Tiong Yip, Joern Hopke, Kara A. Brown,{dagger} Ian A. MacNeil,{dagger} and Marcia S. Osburne{dagger}

Cambridge Genomics Center, Aventis Pharmaceuticals Inc., Cambridge, Massachusetts 02139

Received 17 September 2003/ Accepted 3 January 2004


arrow
ABSTRACT
 
The enormous diversity of uncultured microorganisms in soil and other environments provides a potentially rich source of novel natural products, which is critically important for drug discovery efforts. Our investigators reported previously on the creation and screening of an Escherichia coli library containing soil DNA cloned and expressed in a bacterial artificial chromosome (BAC) vector. In that initial study, our group identified novel enzyme activities and a family of antibacterial small molecules encoded by soil DNA cloned and expressed in E. coli. To continue our pilot study of the utility and feasibility of this approach to natural product drug discovery, we have expanded our technology to include Streptomyces lividans and Pseudomonas putida as additional hosts with different expression capabilities, and herein we describe the tools we developed for transferring environmental libraries into all three expression hosts and screening for novel activities. These tools include derivatives of S. lividans that contain complete and unmarked deletions of the act and red endogenous pigment gene clusters, a derivative of P. putida that can accept environmental DNA vectors and integrate the heterologous DNA into the chromosome, and new BAC shuttle vectors for transferring large fragments of environmental DNA from E. coli to both S. lividans and P. putida by high-throughput conjugation. Finally, we used these tools to confirm that the three hosts have different expression capabilities for some known gene clusters.


arrow
INTRODUCTION
 
Natural products have been a rich source of pharmaceutical molecules, accounting for greater than 30% of all human therapeutics and more than 60% of antiinfective and anticancer drugs. Despite the advances in high-throughput screening technology and attempts to isolate and culture microorganisms from exotic environments, the discovery of novel natural products remains difficult. However, it has become clear that the vast majority of microorganisms in the environment are still unknown and that most of them are unculturable under standard laboratory conditions (15, 38). Since the number of such "unculturable" microbial species in the soil represents at least 98% of the total population, these species constitute a potentially large untapped pool of novel natural products. To access their genetic information, the DNA of these microorganisms can be isolated directly from environmental samples, cloned into suitable vectors, and expressed in surrogate hosts that can be grown in the laboratory and manipulated genetically (9, 17, 18, 26, 29, 36).

Previously, our investigators and others reported on methods to isolate and clone environmental DNA and screen for novel bioactivities (9, 17, 18, 26, 29) using Escherichia coli strains and vectors. Although interesting and novel activities have been expressed and identified in this host, the potential advantage of expanding the range of bacterial hosts to capture additional expression capability is clear. We chose to extend our expression host range to include Streptomyces lividans and Pseudomonas putida. Actinomycetes have been a major source of natural products, including polyketides and nonribosomal peptides, are capable of supplying a wide variety of precursors and enzymes, and are able to express heterologous polyketides (16). Among the actinomycetes, S. lividans is one of the easiest species to manipulate genetically. Our initial work with Streptomyces (9) focused on a shuttle cosmid vector which, although useful, required a cumbersome transformation procedure. We therefore sought a more reliable and high-throughput DNA transfer process.

The gram-negative pseudomonads colonize many niches, including soil, fresh water, and biotic and abiotic surfaces (23). They have large genomes (over 6 Mb) and rich metabolic diversity, including gene clusters for degradation of xenobiotics and for production of secondary metabolites such as polyketides and nonribosomal peptides (3, 22, 33, 34). Importantly, many tools have also been developed for pseudomonads (including transformation, conjugation, transposon mutagenesis, and a wide variety of vectors and reporter systems), so that their genetic manipulation is relatively straightforward.

In the present work we describe new tools that facilitate the use of S. lividans and P. putida as expression hosts for environmental DNA libraries. These tools include derivatives of S. lividans that contain complete and unmarked deletions of the act and red endogenous pigment gene clusters, an improved P. putida host strain, and new bacterial artificial chromosome (BAC) shuttle vectors for transferring large fragments of environmental DNA from E. coli to S. lividans and P. putida by conjugation. Finally, we report on a high-throughput method for transferring environmental DNA libraries into both S. lividans and P. putida, using the same shuttle BAC vector library, and demonstrate the utility of screening for expression of heterologous compounds in all three expression hosts.


arrow
MATERIALS AND METHODS
 
Bacterial strains and plasmids.
The strains and plasmids used in this study are listed in Table 1.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Bacterial strains and plasmids

Growth conditions.
E. coli DH10B was grown in Luria-Bertani (LB) medium (27) supplemented with antibiotics as indicated. Streptomyces coelicolor and S. lividans strains were grown at 29°C in YEME, GYM, R2, or R5 medium as reported previously (16). For conjugations, we used a modified R2 medium in which sucrose was omitted. P. putida was routinely grown in LB supplemented with Fe-citrate (6 mg/liter) at 30°C, except for selection of exconjugants, where we used M9 benzoate medium (10). For antibacterial and antifungal screens, Bacillus subtilis and Candida albicans were grown in LB with chloramphenicol (Cam; 15 µg/ml) and yeast-peptone-dextrose (YPD; 10 g of yeast extract, 20 g of peptone, 20 g of dextrose per liter), respectively. Antibiotics were used as indicated (concentrations are given in micrograms per milliliter).

Plasmid constructions.
Standard methods were used for DNA isolation and recombinant procedures (16, 27). PCR was performed using Vent polymerase (New England BioLabs) according to the manufacturer's instructions, with the addition of 7.5 to 10% dimethyl sulfoxide. Strategies for constructing plasmids were as follows.

(i) pSrpsL6 and pSrpsL14.
The wild-type rpsL gene was amplified by PCR from S. coelicolor A3(2) using primers rpsL5' (5'GGAATTCCTTCGTCCGCCACGACACG3') and rpsL3' (5'GGAATTCCGTCTTGCCCGCGTCGATG3'). The 1.3-kb rpsL fragment was digested with EcoRI (restriction sites underlined) and cloned into the EcoRI site of pBKII SK (Stratagene), yielding pBKrpsL122. The rpsL fragment of pBKrpsL122 was isolated by EcoRI digestion and cloned into the EcoRI site of pGM160 (21), resulting in plasmids pSrpsL14 and pSrpsL6, with the insert in opposite orientations (Fig. 1A).



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 1. Deletion of S. lividans endogenous antibiotic gene clusters. (A) Gene replacement plasmid pSrpsl14 was constructed by cloning an EcoRI fragment containing the wild-type rpsL (Sms) gene of S. coelicolor A3(2) into pGM160. ts ori (pSG5), temperature-sensitive origin of replication in Streptomyces; bla, Ampr (E. coli); tsr, Thior (Streptomyces); aac1, gentamicin resistant (E. coli and Streptomyces). Restriction sites available for cloning are indicated. (B) Schematic diagram of the method used to delete the act cluster from S. lividans TK24 using p{Delta}act18. See text for details. (C) Pigment production by S. lividans TK24 (top) and S. lividans {Delta}act{Delta}red (bottom) grown in R5 plates for 7 days and photographed.

(ii) p{Delta}act18.
The actVIBA genes (left end of the act cluster [11]) were amplified by PCR from S. lividans TK24 using the primers actVI5' (5'GAAGATCTTCGGCAGCGCGTCAGGGTGTCA3') and actVI3' (5'GGAATTCCTACTGCCTGGTGCTCACCGTCCAC3') and digested with BglII and EcoRI. The actVB ORF11 and ORF12 genes at the right end of the act cluster (19) were also PCR amplified from TK24 using primers act.lysR25' (5'GGAATTCCACGAGGGTGGTTGGCGTCGGAACAAGGC3') and act.lysR23' (5'CGGGATCCCAGGAAGCACAGGACGCCGAGGACGAAC3') and digested with EcoRI and BamHI. The actVI and actVB fragments were ligated with pGM160rpsL14 digested with BamHI and BglII and dephosphorylated with shrimp alkaline phosphatase. The resulting plasmid, p{Delta}act18, was used to delete the act cluster from S. lividans.

(iii) p{Delta}red.
The redD gene was PCR amplified from TK24 using the primers redD5'.Xover (5'GACGGCCAAGCTTCCTCGACCTTGTGGACCTCGTCGGTGCGCATCA3') and redD3'.Xover (5'GATCATCGGGTCGTCTGTTTAAACGGTCGTCAGGCGCTGAGCAGGCTGGTGT3'). The PCR product was cloned into pCR4-Blunt-TOPO (Invitrogen), yielding pTOPO-TK3. The S. lividans homolog of SC10A5.02 (chosen as the right end of the red cluster) was amplified using the primers red.oxidase.5'.Xover (5'CGCCTGACGACCGTTTAAACAGACGACCCGATGATCCCCAACCAGTGG3') and red.oxidase.3' (5'CGGGATCCCGCGGGGTCAGTACACGTAGGGGACGAACTTC3') and cloned into the EcoRV site of pBK-SK (Stratagene) to give pBK-TK3. p{Delta}red was created by ligating the redD fragment (as a 1.9-kb HindIII-PmeI fragment of pTOPO-TK3) and the SC10A5.02 homolog fragment (a 1.9-kb PmeI-BamHI fragment from pBK-TK4) into pGM160rpsL6 that had been digested with HindIII and BamHI. p{Delta}red was used to delete the red cluster from S. lividans.

(iv) pMBD7, -9, and -12.
pMBD7 was constructed by cloning a 6.6-kb SpeI-DraI fragment of pOJ436 (5) into a 4.1-kb XbaI-partial PvuII fragment of pDNR-1 (Clontech). DH10B transformants were selected on agar plates containing LB with ampicillin (Amp; 100 µg/ml) and apramycin (Apra; 50 µg/ml) and tested for sensitivity to 7% sucrose (conferred by the sacB gene) prior to restriction analysis. pMBD9 is a derivative of pMBD7 in which a BstXI site at the end of the aac(3)IV gene has been removed by digestion with BstXI, blunting of the ends with T4 DNA polymerase, and religation. pMBD12 is a derivative of pMBD9 in which the unique BamHI site has been removed by the method described above for pMBD9.

(v) pGran.
A 38.2-kb EcoRV fragment of pOJ446-22-24, containing the granaticin gene cluster for Streptomyces violaceoruber Tu22 (2), was cloned into pBTP3 (U.S. patent application 09/596,114) by the adaptor cloning method. Briefly, pOJ446-22-24 was digested with EcoRV, ethanol precipitated, and ligated to BstX1 adaptors (N418-18; Invitrogen) in 1x blunt-end ligation buffer (50 mM Tris-HCl [pH 7.8], 50 µM ATP, 10 mM ß-mercaptoethanol, 5 mM MgCl2), 15% (wt/vol) polyethylene glycol 8000, 400 U of ligase at 16°C overnight. The granaticin fragment was purified from a pulsed-field gel (electrophoresis in a 1% low-melting-point agarose [0.5x Tris-borate-EDTA], 0.1 to 35 s switch time; 6 V; 14°C for 12 h). The gel slice was dialyzed against Tris-EDTA buffer for 2 h prior to digestion with Gelase (Epicenter), according to the manufacturer's recommendations, and ligated to 20 ng of BstX1-cut pBTP3-43 vector (10:1 vector/insert molar ratio) at 16°C for 6 h. After electroporation into ElectroMax DH10B cells, transformants were selected on LB agar plates containing Cam (12.5 µg/ml).

(vi) pSDAPG.
A 6.5-kb XbaI-EcoRI fragment containing the locus encoding 2,4-diacetylphloroglucinol synthesis (DAPG cluster) was excised from pMON5122, blunted using T4 DNA polymerase, and ligated to BstX1 adaptors (N418-18; Invitrogen) in 1x blunt-end ligation buffer (50 mM Tris-HCl [pH 7.8], 50 µM ATP, 10 mM ß-mercaptoethanol, 5 mM MgCl2), 15% (wt/vol) polyethylene glycol 8000, 400 U of ligase at 16°C overnight. The DAPG fragment was gel purified and ligated to 20 ng of BstX1-cut pMBD13 vector (10:1 vector/insert molar ratio) at 16°C for 6 h. After electroporation into ElectroMax DH10B, transformants were selected on LB Cam (12.5 µg/ml) agar plates.

Transfer of the Streptomyces cassette to BAC vectors.
The Streptomyces cassette in plasmids pMBD7, pMBD9, and pMBD12 was transferred to BAC vectors by in vitro cre-lox recombination using the Creator pDNR-1 cloning kit (Clontech) according to the manufacturer's instructions. Recombination products were selected after transformation into ElectroMax DH10B cells (Gibco/BRL) by plating on LB agar containing 7% sucrose, Cam (12.5 µg/ml), Apra (30 µg/ml). Transfer of the pMBD7 and pMBD12 cassettes into pBeloBac11 yielded pMBD10 and pMBD14, respectively. Transfer of the pMBD9 cassette to pBTP3, MG1.1, and pGran yielded pMBD13, pSMG1.1, and pSGran, respectively.

Strain constructions. (i) S. lividans {Delta}act{Delta}red.
Plasmids p{Delta}act and p{Delta}red were used separately to transform TK24 (streptomycin resistant [Smr]) protoplasts by standard methods (16). Transformants were selected in R2YE containing 50 µg of thiostrepton (Thio)/ml at 29°C. Individual transformants were grown twice in YEME containing Thio (8 µg/ml) for 3 to 5 days at 29°C, homogenized, and plated in R2YE plus Thio (50 µg/ml) at 39°C to select for single crossover events. Four to six clones selected at 39°C were grown for 5 days at 39°C in YEME plus Thio (8 µg/ml). A 100-µl aliquot of the culture was inoculated into 100 ml of YEME without Thio. Second crossover events resulting in excision of plasmid sequences were selected by plating on GYM (30) plus Sm (50 µg/ml) at 39°C. Each clone was then tested for Thio sensitivity and pigmented antibiotic production on R2 plates. The presence or absence of each antibiotic cluster on the chromosome was verified by PCR analysis using the following primers: {Delta}act.1 (GTGGGTACCCGTGGGTACCTGTGCTGCTTT), {Delta}act.2 (TTGTTGACCAGTACGTCCACCCTGCCGTGC), {Delta}act.3 (AGATGCAGAAGCTGGACGGCCGTGACTTCG), {Delta}red.1 (GGCCCTGGAGGATCTCATCAGCGCGATGTT), {Delta}red.2 (TAGAGGGCGGACATCCCGACGATGGCGAT), and {Delta}red.3 (AGCCGTGGTACGGGCATTCGATGGTGTTGC).

(ii) P. putida MBD1.
The {phi}C31 attB sequence of S. lividans was PCR amplified using the primers attB5' (ACCATCGTGATCGGCGTGTGCGTGATGCCG) and attB3' (GCCCGTGATCCCGATGTTCACCGGCCTGAAG) and Vent polymerase (New England BioLabs). The resulting 939-bp fragment was cloned into pCR-BluntII Topo (Invitrogen), yielding pTOPOattB. Next, a 1.1-kb PstI fragment from plasmid p1000 containing the {phi}CTX (P. aeruginosa phage) attP site (37) was cloned into the PstI site of pTOPOattB. The resulting plasmid, p2.10, was cotransformed with pIHB (37) into electrocompetent P. putida KT-2440. After electroporation, cells were recovered in 2 ml of SOC (27) at 30°C prior to selection. Transformants in which p2.10 had integrated at the {phi}CTX attB site were selected on LB containing 25 µg of kanamycin (Kan)/ml, resulting in strain P. putida MBD1. The presence of the {phi}C31 attB site in the P. putida chromosome was verified by Southern hybridization using the 938-bp {phi}C31 attB fragment as a probe.

Southern hybridizations.
Chromosomal DNA was prepared using DNeasy columns (Qiagen). Southern hybridization was performed by standard procedures (27). BamBAC8 plasmid DNA and the gel-purified {phi}C31attB fragment from pTOPOattB were used as probes. Probes were labeled with [{alpha}-32P]dCTP using the Readyprime II kit (Amersham).

Environmental DNA library.
Megabase environmental DNA was isolated from a local soil sample as previously described (17). The megabase DNA plug was dialyzed against 15 ml of 1x BamHI buffer with bovine serum albumin at 4°C for 1 h. The gel slice was melted at 65°C for 5 min, equilibrated to 37°C for 5 min, and digested with 0.8 U of BamHI at 37°C for 1 h. The digestion was stopped by addition of EDTA (50 mM final concentration). After pulsed-field electrophoresis in 1% low-melting-point agarose (0.5x Tris-borate-EDTA; 0.5 to 35 s switch time; 6 V; 14°C for 10 h), a gel slice containing 50 to 100 kb of DNA was excised from the gel and digested with Gelase (Epicenter). Two nanograms of soil DNA was ligated at 16°C overnight with 20 ng of pMBD14 digested with BamHI and dephosphorylated with calf intestinal phosphatase. Two microliters of the ligation mixture was used to transform ElectroMax DH10B cells (Gibco/BRL) by electroporation (0.2-cm cuvette; 2.5 kV). Transformants were selected on LB Cam (12 µg/ml) Amp (30 µg/ml) agar plates.

Standard conjugations into S. lividans and P. putida.
For S. lividans, conjugations of individual plasmids were performed as described previously (16) using ET12567/pUB307 or DH10B/pUB307 as the donor strain. For P. putida standard conjugations, the E. coli donor strain DH10B/pUB307 containing the BAC construct to be transferred was grown overnight at 37°C in LB containing Cam (12 µg/ml), Apra (30 µg/ml), and Kan (50 µg/ml). The recipient, P. putida MBD1, was also grown overnight at 30°C in LB Kan (50 µg/ml). Donor and recipient were diluted 1:100 into fresh medium and grown for 4 h. The recipient was incubated at 42°C for 15 min to inactivate restriction enzymes. Donor and recipient (1:3) were mixed in a microcentrifuge tube, centrifuged for 1 min, and resuspended in 50 µl of LB. The mix was placed on an LB agar plate and incubated at 30°C for 24 h, and cells were then scraped from the plate and resuspended in 1 ml of LB. Dilutions were plated on LB agar plus nalidixic acid (Nal; 20 µg/ml) and Apra (25 µg/ml). Exconjugants were picked after 2 days at 30°C.

High-throughput transfer of BAC libraries into S. lividans {Delta}act{Delta}red and P. putida MBD1.
High-throughput transfer of environmental libraries was performed as follows. Pools of DH10B environmental library clones were grown in selective medium as above, and plasmid DNA was isolated. The pooled plasmids were then used to transform electrocompetent DH10B/pUB307. Transformants were picked with a Q-bot robot (Genetix) into 96-well deep plates containing LB CHL 12, APRA 30, KAN 50, and grown overnight at 37°C to a final optical density at 600 nm of 3.5 to 4.0. Donor E. coli cells were then diluted 1:10 using LB without antibiotics in a 96-well plate. For conjugations into S. lividans, a 96-pin stamper (no. 140500; Boekel Scientific) was dipped into the donor wells and then into the recipient wells containing 100 µl of heat-shocked S. lividans {Delta}act{Delta}red recipient spores (108/ml). The same stamper was used to deliver droplets of the donor-recipient mix onto R2 plates (minus sucrose). The droplets were allowed to dry before overnight incubation at 30°C. Q-bot plates were then dried for 2 h under a tissue culture hood. Fifteen milliliters of an aqueous solution containing selective agents (75 µg of Apra, 25 µg of Nal, and 50 µg of hygromycin/ml, final concentrations) was added by flooding the plate and rotating it continuously until the liquid was absorbed. Plates were then incubated further for 3 to 4 days. Soil DNA exconjugants were replicated once onto R5 containing Nal (25 µg/ml) and Apra (75 µg/ml) before replicating onto the screening medium.

For P. putida high-throughput conjugations, cultures of the E. coli donor strain DH10B/pUB307 containing library clones were prepared and diluted 1:10 as described above for the Streptomyces conjugations. A 96-pin replicator was used to deliver an aliquot of the donor cultures into 96-well plates containing 50 µl of a P. putida MBD1 exponential culture that had been incubated at 42°C for 15 min to inactivate restriction systems. The same replicator was used to deliver aliquots of the mixes onto an LB Q-bot plate, which was then incubated overnight at 30°C. P. putida exconjugants containing library clones were selected by replicating the colonies onto an M9 benzoate plate (10) with Apra (25 µg/ml) and Nal (20 µg/ml), on which only exconjugants can grow. Exconjugant colonies were visible after 2 to 3 days of incubation.

High-throughput antibacterial and antifungal screens.
S. lividans {Delta}act{Delta}red exconjugants were grown on R5 plates (16) for 7 days at 30°C. Plates were then overlaid with top agar (27) containing exponentially growing B. subtilis strain BR151/pPL608 (Bacillus Genetic Stock Center, Columbus, Ohio) or C. albicans NCCLS11 (ATCC 90028) and incubated overnight at 30°C followed by several days at room temperature. Clones producing antibacterial or antifungal activities were identified by a zone of inhibition in the lawn surrounding the clone. For P. putida MBD1, exconjugants were picked from the selection plate after conjugation onto a fresh M9 benzoate plate containing Nal (20 µg/ml) and Apra (25 µg/ml), using a 96-pin replicator. This second round of growth in the presence of selection was used to eliminate residual donor E. coli cells. A 96-pin replicator was used again to inoculate shallow 96-well plates containing 150 µl of liquid LB medium supplemented with Fe-citrate (6 mg/liter). Cultures were grown at 29°C in a humidified container for 5 to 7 days and then dried using a Savant Speed-Vac Plus SC210A. One volume of methanol was added to the pellets. After 15 min at room temperature in covered plates, the extracts were removed with a multichannel pipettor, avoiding the solid residue. Extracts were divided in two and dried to completion in the Speed-Vac prior to assays. For antibacterial assays, extracts were resuspended in 145 µl of LB. Five microliters of a 1:10 dilution of an early-log-phase culture of B. subtilis BR151/pPL608 was added to the resuspended extracts, and the plates were incubated at 37°C overnight with shaking (250 rpm). Growth of the B. subtilis tester strain was evaluated visually. For antifungal assays, extracts were resuspended in 145 µl of YPD medium (10 g of yeast extract, 20 g of peptone, 20 g of glucose) plus 5 µl of C. albicans ATCC 90028 from a frozen glycerol stock, diluted 1:100. Plates were incubated at 35°C overnight. Growth of the C. albicans tester strain was evaluated visually.

Preparation of extracts and HPLC analysis.
Inertsil ODS-3 (5 µm; 120 Å, 150 by 4.6 mm; GL Sciences) and Polaris C-18A (5 µm; 120 Å; 4.6 by 150 mm; Metachem) columns were used for analytical reverse-phase high-pressure liquid chromatography (HPLC) on a Waters 600 system with 996 PDA detector (210 to 610 nm; 1.2-nm resolution; Millennium 4.0 software). The mobile phase was 0.08% trifluoroacetic acid (TFA) in water (solution A) and 0.08% TFA in acetonitrile (solution B).

To analyze antibiotic production in S. lividans, the appropriate strains were grown in 25 ml of YEME with Apra (50 µg/ml) at 30°C for 4 days. Cultures were lyophilized (Labconco Freezone 4.5) and extracted with methanol-ethyl acetate (3:1). Extracts were filtered, concentrated (N2 stream; Pierce Reacti-Therm), cleaned by solid-phase extraction (Waters SepPak C18 cartridges; 3 ml; 200 mg), and dried under an N2 stream. Extracts were redissolved in 1 ml of methanol and filtered (Whatman 4-mm, 0.2-µm polytetrafluoroethylene syringe filters) prior to HPLC analysis. Elution started with an solution A/solution B ratio (A/B) of 95:5 for 2 min, and then a linear gradient was run from an A/B of 95:5 to an A/B of 2:98 for 25 min with an 8-min hold at an A/B of 2:98. The flow rate was 1.5 ml/min, and the injection volume was 25 µl. The absorbance of the effluent at 240 and 500 nm was recorded.

For HPLC analysis of secondary metabolite production in P. putida MBD1, liquid cultures of P. putida MBD1 exconjugants containing pMBD14, pSgran, pSMG1.1, or pSDAPG were grown for 7 days at 27°C in 50 ml of YM medium (1) containing Apra (25 µg/ml). Ethyl acetate extracts were prepared as described previously (6). The extracts were reconstituted in 1 ml of H2O-CH3CN (50:50 [vol/vol]) containing 0.08% TFA. Samples were filtered (Whatman 4-mm, 0.2-µm polytetrafluoroethylene syringe filters) prior to HPLC analysis. Elution began with 100% solution A for 2 min, and then a linear gradient was run from 0 to 100% solution B for 20 min with a 10 min hold at 100% B. The flow rate was 1 ml/min, and the injection volume was 10 µl. Identification of 2,4-diacetylphloroglucinol (DAPG) was based on the UV spectrum (6).


arrow
RESULTS
 
Deletion of S. lividans endogenous antibiotic gene clusters.
Optimally, host strains used to express environmental libraries should lack endogenous activities and pigments that may both interfere with the detection of heterologous compounds and potentially waste available metabolites that could be used to produce heterologous compounds. To obtain such appropriate strains of S. lividans, the act and red gene clusters encoding actinorhodin and undecylprodiginine, respectively, were deleted from the S. lividans chromosome by positive selection of unmarked allelic exchange mutants. This method involves a two-step strategy that combines the use of a temperature-sensitive replicon and a counterselectable marker (reviewed in reference 25). It has been shown previously that the wild-type rpsL gene of Streptomyces roseosporus is counterselectable in an Smr background since, as in other bacteria, it confers dominant sensitivity to Sm (14). Our gene replacement vector, pSrpsL14 (Fig. 1A), contains the wild-type rpsL gene of S. coelicolor A3(2) cloned into pGM160, a shuttle vector with an SG5 ori which is naturally temperature sensitive for replication in S. lividans (21). The scheme for selection of unmarked mutations was analogous to that described for Mycobacterium tuberculosis (24). The ends of the well-defined act cluster, the actVIAB genes (left end of the cluster [11]), and the actVB ORF11-12 genes (right end of the cluster [19]) were cloned into gene replacement vector pSrpsL14 (Fig. 1A) to yield vector p{Delta}act18, which was then used to effect the deletion of the act cluster as shown schematically in Fig. 1B. Briefly, p{Delta}act18 was introduced into TK24 by transformation, and transformants were selected by resistance to Thio at 29°C, the permissive temperature for plasmid replication. Single crossover events resulting in integration of the plasmid into the chromosome were selected with Thio at 39°C. The three possible integration products are shown in Fig. 1B. After a round of growth in liquid medium at 39°C without antibiotic selection, those cells that had undergone a second crossover event leading to the excision and loss of the plasmid-borne rpsL gene were selected by plating on Sm medium at 39°C. Using this method, 3 out of 12 Sm-resistant clones contained an unmarked deletion of the act cluster, as determined by PCR screening. Using the complete genome sequence of S. coelicolor A3(2) as reference (4), the resulting {Delta}act deletion encompasses 24.2 kb (nucleotides 143959 to 168217; GenBank accession number SCO939122).

Although the red cluster is not as well characterized as the act cluster, it is known that the S. coelicolor red genes are clustered in a region of approximately 37 kb, with the pathway-specific regulator redD at one end (8, 18). We used data from the S. coelicolor sequencing project (http://www.sanger.ac.uk/Projects/S_coelicolor/) to define the right end of the desired red cluster deletion. We chose SC10A5.02, which encodes a probable oxidase (the last clearly recognizable putative enzyme), as the right end of the red cluster deletion. According to a recent analysis by Cerdeño et al. (7), the right end of the red cluster extends past SC10A5.02 (redG) to include the next gene, SC10A5.02 (redF), which they proposed to be an oxidoreductase. Here, the S. lividans redD and SC10A5.02 (redG) homologs defined the cluster ends in the gene replacement vector p{Delta}red. This plasmid was used to delete the red cluster from S. lividans TK24 and {Delta}act by the method described for the act cluster, yielding S. lividans {Delta}red and {Delta}act{Delta}red, respectively. The presence of the red cluster deletion in the new strains was verified by PCR. Using the complete genome sequence of S. coelicolor A3(2) as reference (4), the resulting {Delta}red deletion encompasses 28.6 kb (nucleotides 144623 to 173286; GenBank accession number SCO939125).

Figure 1C shows the antibiotic production phenotypes of S. lividans {Delta}act{Delta}red and TK24. As expected, {Delta}act{Delta}red did not produce actinorhodin or undecylprodiginine and thus provides an improved background for heterologous natural product expression and analysis. Both the double and single cluster deletion strains grew and sporulated as well as the TK24 parent strain (data not shown).

E. coli-S. lividans conjugative BAC vectors.
We constructed a new series of plasmids (pMBD7, -9, and -12) (Fig. 2) that encompass the elements required for conjugation of DNA into Streptomyces (oriT) and subsequent DNA integration into the chromosome (the {phi}C31 integrase and attachment site and an Apra resistance marker), all flanked by loxP sites. These plasmids can act as donors in an in vitro cre-lox recombination reaction (28) to transfer the sequences between the two loxP sites (the CIS cassette [conjugative and integrative into Streptomyces]) to any loxP-containing plasmid. Plasmids pMBD7, pMBD9, and pMBD12 were conjugated into S. lividans using E. coli ET12567/pUB307 (12) as a donor strain. Conjugation efficiency was similar to that of the parent plasmid, pOJ436 (10–5 to 10–6 exconjugants per recipient under our conditions), indicating that the CIS cassettes in the donor plasmids were fully functional.



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 2. Plasmids containing CIS cassettes. pMBD7, -9, and -12 (top) are CIS cassette donor plasmids; CIS cassettes contain {phi}C31 integrase (int) and attachment site (attP), aac3(IV) for APRAr, flanked by loxP sites; sacB confers sensitivity to sucrose. pMBD13 (bottom left) is a BAC plasmid containing the pMBD9 CIS cassette; BstXI sites can be used for cloning by the adaptor method (see Materials and Methods). pMBD14 (bottom right) is a pBeloBac11 derivative with the CIS cassette from pMBD12; unique SphI and BamHI sites within lacZ{alpha} are available for cloning.

We then transferred the CIS cassette to several BAC constructs by cre-lox recombination and measured their efficiency of conjugation into S. lividans. Vector pMBD10, derived from E. coli plasmid pBeloBac11 (31), was conjugated into Streptomyces with high efficiency (10–4 to 10–5). Similar high efficiency of conjugal transfer was measured for BAC plasmids pSMG1.1 (containing a 27-kb soil DNA fragment encoding antibacterial activities in E. coli [17]) and pSGran (which contains a 38-kb fragment encoding the granaticin gene cluster of S. violaceoruber Tu22 [2]). These results demonstrated that the CIS cassette confers all the functions required for efficient mobilization of single-copy BAC vectors with inserts of at least 38 kb.

Two additional BAC vectors, pMBD13 and pMBD14, were built in order to facilitate the construction of DNA libraries (Fig. 2). pMBD13 is designed for cloning using BstXI adaptors, while pMBD14 contains unique BamHI and SphI sites within the lacZ {alpha}-complementation region, permitting blue-white color selection of recombinant clones. The BamHI site in pMBD14 was used to construct a 13,000-clone soil DNA library (the BamBAC library), with insert sizes ranging from 11.5 to at least 85 kb (see Materials and Methods). Individual clones from this library were used to test the size limit for conjugation into S. lividans, comparing two different E. coli donor strains (ET12567/pUB307 [Dam Dcm], which is used routinely to transfer DNA into methyl DNA-restricting streptomycetes [12], and DH10B/pUB307). Although DH10B is not DNA methylation deficient, we reasoned that it could be a more suitable donor for the transfer of libraries into S. lividans, which is largely nonrestricting, since it is known to be particularly efficient for the uptake of large DNA (40) and thus might discriminate less against large clones in the BamBAC library. Both donor strains efficiently transferred BamBAC clones with inserts as large as 85 kb, significantly larger than any reported previously. Southern analysis of several exconjugants showed that the 85-kb insert construct integrated into the S. lividans chromosome, although some contained deletions at one integration junction (data not shown). However, most of the environmental insert DNA was present in the chromosome of the exconjugants, resulting in long contiguous stretches of environmental DNA integrated in the new host and available for expression. Similar analysis showed that a BamBAC construct containing a 38-kb insert (BamBAC8) could be successfully transferred and stably maintained in its entirety in S. lividans {Delta}act{Delta}red (see Fig. 5).



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 5. Southern analysis of BamBAC8 exconjugants. (A) Chromosomal DNA of P. putida MBD1 and three BamBAC8 exconjugants was digested with HindIII and hybridized to the {phi}C31 probe (left) or BamBAC8 probe (right). The first lane contains HindIII-digested BamBAC8 plasmid. (B) Chromosomal DNA of S. lividans {Delta}act{Delta}red and three BamBAC8 exconjugants was digested with NotI and hybridized to the {phi}C31 probe (left) or BamBAC8 probe (right). The first lane contains NotI-digested BamBAC8 plasmid. In both cases, the band containing the {phi}C31 attB site in the parental strain (lane 2) was replaced in the exconjugants by two new bands (marked by arrows) containing the attL and attR sites created by integration of BamBAC8 in the chromosome.

Heterologous antibiotic expression in S. lividans {Delta}act{Delta}red.
The conjugative BAC construct pSGran contains the S. violaceoruber Tu22 granaticin cluster (2). Conjugation of pSGran into the unpigmented S. lividans {Delta}act{Delta}red strain led to production of purple pigment that was clearly detectable both visually and by HPLC analysis (Fig. 3). One hundred percent of the S. lividans exconjugants tested produced the pigment, indicating that the new vectors were stable in both E. coli and S. lividans. The absence of endogenous antibiotics in S. lividans {Delta}act{Delta}red also allowed the clear detection of the antibiotic activity of granaticin against B. subtilis (data not shown). These results confirmed that biosynthetic clusters can be efficiently introduced into the unpigmented S. lividans {Delta}act{Delta}red strain by conjugation and detectably expressed from the chromosome.



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 3. Heterologous granaticin production from pSgran in S. lividans {Delta}act{Delta}red. S. lividans {Delta}act{Delta}red exconjugants containing the negative control construct pMBD10 (left) or pSgran (right) were analyzed for granaticin production. Purple pigment production in R5 plates is shown on the top. HPLC profiles of extracts of liquid (YEME) cultures are shown on the bottom. The arrow indicates granaticin peaks in the extract of the pSGran exconjugant (top trace), which were absent in the control (bottom trace).

Construction of a P. putida host strain for expression of environmental libraries.
To further extend our host range for expression of environmental libraries, we chose the well-characterized nonpathogenic soil organism P. putida KT-2440 (22, 34). We then engineered the P. putida strain to accept our E. coli-Streptomyces BAC shuttle vectors and libraries by inserting the {phi}C31 (Streptomyces phage) attB site into the chromosome of P. putida, in the hope that the {phi}C31 integrase and attP site could be used by this host. We used the site-specific integration system of P. aeruginosa phage {phi}CTX (37) to deliver the {phi}C31 attB site to the P. putida chromosome, according to the scheme shown in Fig. 4. The resulting strain was named P. putida MBD1.



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 4. Construction of P. putida strain MBD1. Plasmid p2.10, which contains the {phi}C31 attB site and the {phi}CTX attP site, and plasmid pIHB were cotransformed into P. putida KT-2440. Both are suicide plasmids, but the {phi}CTX integrase encoded in pIHB can mediate recombination in trans between the {phi}CTX attP and attB sites, resulting in the integration of p2.10 (and thus the Streptomyces phage {phi}C31 attB site) into the chromosome of P. putida KT-2440.

Crude methanol extracts of P. putida MBD1 were tested for antibacterial and antifungal activity (see Materials and Methods). P. putida MBD1 produced no detectable antibacterial or antifungal compounds under conditions where a positive control (P. fluorescens ATCC 49323) produced mupiromicin. Thus, P. putida MBD1 appears to provide a "clean" background for production and detection of antifungal and antibacterial compounds.

E. coli-Streptomyces shuttle BAC vectors can be transferred into and maintained in P. putida MBD1.
The RK2 system (used to introduce pMBD14 and derivatives into Streptomyces) is routinely used to transfer plasmids from E. coli to pseudomonads via conjugation. Therefore, we used standard protocols (see Materials and Methods) to conjugate DH10B/pUB307 containing pMBD14 with P. putida MBD1. Conjugation resulted in stable Apra-resistant P. putida MBD1 colonies, indicating that the {phi}C31 integrase gene and the Apra resistance gene in pMBD14 were expressed and functional in P. putida.

To test the strain further, we conjugated shuttle BAC vectors containing DNA inserts of various sizes, including pSGran (37 kb), pSMG1.1 (27 kb), and pSDAPG (described below; 6.5 kb), as well as various plasmids from a soil DNA library constructed in BAC vector pMBD14, into P. putida. All of these vectors transferred easily into P. putida MBD1, regardless of the size of their insert DNA. Exconjugants containing one of the soil DNA clones, BamBAC8 (38-kb insert), were analyzed by Southern hybridization to demonstrate that the BAC vector integrated into the P. putida MBD1 chromosome at the {phi}C31 site. Results (Fig. 5A) showed that the band containing the {phi}C31 attB site in MBD1 (lane 2) was replaced in the exconjugants (lanes 3 to 5) by two new bands containing the attL and attR sites created by integration of BamBAC8 into the chromosome. The same two new bands also hybridized to the BamBAC8 probe, showing that they indeed contained the chromosome-integrated vector junctions. Other than the new junction bands, the band pattern following hybridization to the BamBAC8 probe in the exconjugants was identical to that of purified BamBAC8, demonstrating that no major deletions or rearrangements of the plasmid occurred in the 38-kb insert. The same results were obtained for S. lividans {Delta}act{Delta}red exconjugants (Fig. 5B).

These results confirmed that the E. coli-Streptomyces shuttle BAC vectors and large-insert environmental library clones can be introduced and maintained in P. putida MBD1, and they also provided the first example of BAC vectors that can be shuttled by conjugation from E. coli to both Streptomyces and Pseudomonas.

Heterologous expression of gene clusters in P. putida MBD1 versus that in E. coli DH10B and S. lividans {Delta}act{Delta}red.
To explore the expression of heterologous gene clusters in the various host strains, we introduced into the three hosts a series of BAC constructs (pSgran, pSMG1.1, and pSDAPG) containing gene clusters encoding the synthesis of known antibiotics. P. putida MBD1 exconjugants containing these plasmids or the pMBD14 vector alone were grown for 6 days at 27°C, and ethyl acetate extracts were prepared and analyzed as described in Materials and Methods. DAPG was clearly detectable in the extracts of the P. putida MBD1 clone containing the pSDAPG construct (Fig. 6A). However, DAPG could not be detected in extracts of E. coli DH10B or S. lividans {Delta}act{Delta}red cells containing the same construct. Conversely, the products of the MG1.1 and granaticin gene clusters, expressed in E. coli and S. lividans, respectively, could not be detected in P. putida by either HPLC analysis of extracts or by antibacterial or antifungal assays. These results (summarized in Table 2) clearly underscore the advantages of the three-way conjugative shuttle BAC vectors and the use of multiple host systems in that the same genes can be transferred to a diverse set of bacterial hosts, thus increasing the chances of detecting expression of molecules of interest.



View larger version (9K):
[in this window]
[in a new window]
 
FIG. 6. Production of heterologous DAPG in P. putida MBD1, as shown by the reverse-phase HPLC elution profile at 270 nm for extracts of P. putida MBD1 exconjugants containing pMBD14 (lower trace) and pSDAPG (upper trace). The UV spectrum for the peak at a retention time of 22.7 min is shown.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Comparison of heterologous antibiotic expression patterns for E. coli DH10B, S. lividans {Delta}act{Delta}red, and P. putida MBD1

High-throughput transfer of environmental DNA libraries into S. lividans and P. putida and analysis of extracts.
Our high-throughput method for transferring pMBD14-based large-insert libraries from E. coli to S. lividans (see Material and Methods) (Fig. 7) resulted in a 95% success rate for conjugation. We also developed a high-throughput conjugation method for P. putida MBD1 that can be performed in parallel to the E. coli-Streptomyces conjugations (see Materials and Methods) (Fig. 7), with a success rate for conjugation of over 90%. The simplicity and efficiency of this transfer method thus enable the straightforward analysis of environmental libraries in all three hosts.



View larger version (41K):
[in this window]
[in a new window]
 
FIG. 7. High-throughput conjugative transfer of BAC libraries into S. lividans {Delta}act{Delta}red and P. putida MBD1. Plates exhibiting typical conjugation efficiencies are shown. See text for details.


arrow
DISCUSSION
 
Accessing biodiversity by means of shotgun cloning environmental DNA is an exciting new technology that holds promise for natural products drug discovery. To facilitate this process, we expanded on our previous technology by devising new strains and vectors that enhance the chances of detecting activities encoded by environmental DNA.

In the course of this work, we developed new tools that are useful in both this and other applications. Our gene replacement vector contains a counterselectable marker for Streptomyces (rpsL) that allows positive selection of rare genetic events that lead to loss of plasmid sequences. This is an improvement over a previous Streptomyces gene replacement plasmid, pRHB514 (14), because the new vector does not leave a drug resistance marker in the chromosome. This attribute is critical for many applications, including defining structure-function relationships and the production of vaccine candidates. In addition, the new vector can be used in successive rounds of gene replacement in the same strain without the need to use multiple drug resistance markers. Finally, the presence of the selection marker in the plasmid allows the excised molecule to be recovered, thus permitting the replaced allele to be isolated.

We have constructed S. lividans and P. putida host strains that are optimized to express environmental libraries. Our S. lividans strains contain complete and unmarked deletions of one or both pigmented antibiotic gene clusters (act and red), providing a cleaner background for heterologous expression, and no residual antibiotic resistance markers. Prior published Streptomyces strains (S. coelicolor CH999 [{Delta}act::ermE redE60] [20]) and K4-114 and K4-115 (S. lividans TK24 [{Delta}act::ermE] [39]) do not have deletions of both clusters. Our P. putida MBD1 host strain uses the {phi}C31 integration system to integrate BAC vectors into the chromosome. We anticipate that this system can be extended to other host strains in the future, which will augment the panel of expression hosts available.

We developed BAC vectors that can be used to construct libraries containing large DNA inserts in E. coli and that can then be transferred by high-throughput conjugation to both S. lividans and P. putida MBD1. Importantly, we have shown that an environmental library generated in pMBD14 can be efficiently transferred to S. lividans and P. putida by conjugation, including clones containing inserts of up to 85 kb. To our knowledge, this is the first example of conjugative transfer of such high-molecular-weight plasmids from E. coli to Streptomyces. Sosio et al. (32) have constructed E. coli-Streptomyces shuttle BACs that also use {phi}C31-mediated site-specific recombination to integrate in the Streptomyces chromosome, and they showed that inserts up to 120 kb can be introduced and maintained in S. lividans. Their vectors, however, do not contain the oriT sequence and thus have to be transferred into Streptomyces by protoplast transformation, which is not amenable to high throughput. The simplicity and high efficiency of the conjugative transfer method described here makes feasible the transfer and screening of entire large-insert DNA libraries in Streptomyces and Pseudomonas. Environmental DNA clones can be transferred on a one-to-one basis using this process, enabling the E. coli counterpart of any interesting Streptomyces or Pseudomonas clone to be easily identified.

Environmental libraries offer a potentially rich source of novel and useful natural products. However, converting this intriguing idea into a realistic discovery program is a challenging endeavor. Prior data concerning the frequency of genes and gene clusters in environmental libraries of various sizes have been published by us and others (9, 17, 26). For example, one E. coli BAC library generated a hit rate for antibacterial activities of roughly 1 antibacterial clone per 60 Mb of soil-derived DNA (17). Another library of 5,000 cosmid clones yielded 11 partial clusters with homologies to type I polyketide synthases (9). Based on these frequencies, it is our view that in order to maximize the chances of discovery, environmental libraries need to be generated continuously and screened in a high-throughput fashion, using as many different expression hosts as practical. The strains, vectors, and technologies reported here provide an important step forward by offering practical solutions to increasing both the host range and the throughput for screening environmental libraries. The data presented here demonstrate that the three expression hosts (E. coli, S. lividans, and P. putida) differ in their abilities to express gene clusters encoding chemically diverse small molecules and should, thus, facilitate the capture of increasingly numerous and diverse natural product activities, greatly increasing the chances of success for this innovative technology.


arrow
ACKNOWLEDGMENTS
 
We thank the John Innes Centre, Andreas Bechthold, Wolfgang Wohlleben, Linda Tomashow, George O'Toole, and Frieder Lutz for generously providing strains and plasmids used in this study.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Aventis Pharmaceuticals Inc., Cambridge Genomics Center, 26 Landsdowne St., Cambridge, MA 02139. Phone: (617) 768-4023. Fax: (617) 374-8811. E-mail: Asuncion.martinez{at}aventis.com. Back

{dagger} Present address: ActivBiotics, Inc., Lexington, MA 02421. Back


arrow
REFERENCES
 
    1
  1. Banguera, M. G., and L. S. Thomashow. 1996. Characterization of a genomic locus required for synthesis of the antibiotic 2,4-diacetylphloroglucinol by the biological control agent Pseudomonas fluorescens Q2-87. Mol. Plant-Microbe Interact. 9:83-90.[Medline]
  2. 2
  3. Bechthold, A., J. K. Sohng, T. M. Smith, X. Chu, and H. G. Floss. 1995. Identification of Streptomyces violaceoruber Tu22 genes involved in the biosynthesis of granaticin. Mol. Gen. Genet. 248:610-620.[CrossRef][Medline]
  4. 3
  5. Bender, C., V. Rangaswamy, and J. Loper. 1999. Polyketide production by plant-associated pseudomonads. Annu. Rev. Phytopathol. 37:175-196.[CrossRef][Medline]
  6. 4
  7. Bentley, S. D., K. F. Chater, A. M. Cerdeno-Tarraga, G. L. Challis, N. R. Thomson, K. D. James, D. E. Harris, M. A. Quail, H. Kieser, D. Harper, A. Bateman, S. Brown, G. Chandra, C. W. Chen, M. Collins, A. Cronin, A. Fraser, A. Goble, J. Hidalgo, T. Hornsby, S. Howarth, C. H. Huang, T. Kieser, L. Larke, L. Murphy, K. Oliver, S. O'Neil, E. Rabbinowitsch, M. A. Rajandream, K. Rutherford, S. Rutter, K. Seeger, D. Saunders, S. Sharp, R. Squares, S. Squares, K. Taylor, T. Warren, A. Wietzorrek, J. Woodward, B. G. Barrell, J. Parkhill, and D. A. Hopwood. 2002. Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature 417:141-147.[CrossRef][Medline]
  8. 5
  9. Bierman, M., R. Logan, K. O'Brien, E. T. Seno, R. N. Rao, and B. E. Schoner. 1992. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116:43-49.[CrossRef][Medline]
  10. 6
  11. Bonsall, R. F., D. M. Weller, and L. S. Thomashow. 1997. Quantification of 2,4-diacetylphloroglucinol produced by fluorescent Pseudomonas spp. in vitro and in the rhizosphere of wheat. Appl. Environ. Microbiol. 63:951-955.[Abstract]
  12. 7
  13. Cerdeño, A. M., M. J. Bibb, and G. L. Challis. 2001. Analysis of the prodiginine biosynthesis cluster of Streptomyces coelicolor A3(2): new mechanisms for chain initiation and termination in modular multienzymes. Chem. Biol. 8:817-829.[CrossRef][Medline]
  14. 8
  15. Coco, E. A., K. E. Narva, and J. S. Feitelson. 1991. New classes of Streptomyces coelicolor A3(2) mutants blocked in undecylprodigiosin (Red) biosynthesis. Mol. Gen. Genet. 227:28-32.[CrossRef][Medline]
  16. 9
  17. Courtois, S., C. M. Cappellano, M. Ball, F. X. Francou, P. Normand, G. Helynck, A. Martinez, S. J. Kolvek, J. Hopke, M. S. Osburne, P. R. August, R. Nalin, M. Guerineau, P. Jeannin, P. Simonet, and J. L. Pernodet. 2003. Recombinant environmental libraries provide access to microbial diversity for drug discovery from natural products. Appl. Environ. Microbiol. 69:49-55.[Abstract/Free Full Text]
  18. 10
  19. Espinosa-Urgel, M., A. Salido, and J. L. Ramos. 2000. Genetic analysis of functions involved in adhesion of Pseudomonas putida to seeds. J. Bacteriol. 182:2363-2369.[Abstract/Free Full Text]
  20. 11
  21. Fernandez-Moreno, M. A., E. Martinez, J. L. Caballero, K. Ichinose, D. A. Hopwood, and F. Malpartida. 1994. DNA sequence and functions of the actVI region of the actinorhodin biosynthetic gene cluster of Streptomyces coelicolor A3(2). J. Biol. Chem. 269:24854-24863.[Abstract/Free Full Text]
  22. 12
  23. Flett, F., V. Mersinias, and C. P. Smith. 1997. High efficiency intergeneric conjugal transfer of plasmid DNA from Escherichia coli to methyl DNA-restricting streptomycetes. FEMS Microbiol. Lett. 155:223-229.[CrossRef][Medline]
  24. 13
  25. Franklin, F. C. H., M. Bagdasarian, M. M. Bagdasarian, and K. N. Timmis. 1981. Molecular and functional analysis of the TOL plasmid pWWO from Pseudomonas putida and cloning of the genes for the entire regulated aromatic ring meta-cleavage pathway. Proc. Natl. Acad. Sci. USA 78:7458-7462.[Abstract/Free Full Text]
  26. 14
  27. Hosted, T. J., and R. H. Baltz. 1997. Use of rpsL for dominance selection and gene replacement in Streptomyces roseosporus. J. Bacteriol. 179:180-186.[Abstract/Free Full Text]
  28. 15
  29. Hugenholtz, P., C. Pitulle, K. L. Hershberger, and N. R. Pace. 1998. Novel division level bacterial diversity in a Yellowstone hot spring. J. Bacteriol. 180:366-376.[Abstract/Free Full Text]
  30. 16
  31. Kieser, T., M. J. Bibb, M. J. Buttner, K. F. Chater, and D. A. Hopwood. 2000. Practical Streptomyces genetics. The John Innes Foundation, Norwich, England.
  32. 17
  33. MacNeil, I. A., C. L. Tiong, C. Minor, P. R. August, T. H. Grossman, K. A. Loiacono, B. A. Lynch, T. Phillips, S. Narula, R. Sundaramoorthi, A. Tyler, T. Aldredge, H. Long, M. Gilman, D. Holt, and M. S. Osburne. 2001. Expression and isolation of antimicrobial small molecules from soil DNA libraries. J. Mol. Microbiol. Biotechnol. 3:301-308.[Medline]
  34. 18
  35. Malpartida, F., J. Niemi, R. Navarrete, and D. A. Hopwood. 1990. Cloning and expression in a heterologous host of the complete set of genes for biosynthesis of the Streptomyces coelicolor antibiotic undecylprodigiosin. Gene 93:91-99.[CrossRef][Medline]
  36. 19
  37. Martinez-Costa, O. H., A. J. Martin-Triana, E. Martinez, M. A. Fernandez-Moreno, and F. Malpartida. 1999. An additional regulatory gene for actinorhodin production in Streptomyces lividans involves a LysR-type transcriptional regulator. J. Bacteriol. 181:4353-4364.[Abstract/Free Full Text]
  38. 20
  39. McDaniel, R., S. Ebert-Khosla, D. A. Hopwood, and C. Khosla. 1993. Engineered biosynthesis of novel polyketides. Science 262:1546-1550.[Abstract/Free Full Text]
  40. 21
  41. Muth, G., B. Nussbaumer, W. Wohlleben, and A. Puhler. 1989. A vector system with temperature-sensitive replication for gene disruption and mutational cloning in streptomycetes. Mol. Gen. Genet. 219:341-348.[CrossRef]
  42. 22
  43. Nelson, K. E., C. Weinel, I. T. Paulsen, R. J. Dodson, H. Hilbert, V. A. Martins dos Santos, D. E. Fouts, S. R. Gill, M. Pop, M. Holmes, L. Brinkac, M. Beanan, R. T. DeBoy, S. Daugherty, J. Kolonay, R. Madupu, W. Nelson, O. White, J. Peterson, H. Khouri, I. Hance, P. Chris Lee, E. Holtzapple, D. Scanlan, K. Tran, A. Moazzez, T. Utterback, M. Rizzo, K. Lee, D. Kosack, D. Moestl, H. Wedler, J. Lauber, D. Stjepandic, J. Hoheisel, M. Straetz, S. Heim, C. Kiewitz, J. A. Eisen, K. N. Timmis, A. Dusterhoft, B. Tummler, and C. M. Fraser. 2002. Complete genome sequence and comparative analysis of the metabolically versatile Pseudomonas putida KT2440. Environ. Microbiol. 4:799-808.[CrossRef][Medline]
  44. 23
  45. Palleroni, N. 1984. Family I. Psedomonadaceae, p. 141-199. In N. R. Kreig (ed.), Bergey's manual of systematic bacteriology, vol. 1. Williams & Wilkins, Baltimore, Md.
  46. 24
  47. Pelicic, V., M. Jackson, J.-M. Reyrat, W. B. Jacobs, Jr., B. Gicquel, and C. Guilhot. 1997. Efficient allelic exchange and transposon mutagenesis in Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. USA 94:10955-10960.[Abstract/Free Full Text]
  48. 25
  49. Reyrat, J. M., V. Pelicic, B. Gicquel, and R. Rappuoli. 1998. Counterselectable markers: untapped tools for bacterial genetics and pathogenesis. Infect. Immun. 66:4011-4017.[Free Full Text]
  50. 26
  51. Rondon, M. R., P. R. August, A. D. Bettermann, S. F. Brady, T. H. Grossman, M. R. Liles, K. A. Loiacono, B. A. Lynch, I. A. MacNeil, C. Minor, C. L. Tiong, M. Gilman, M. S. Osburne, J. Clardy, J. Handelsman, and R. M. Goodman. 2000. Cloning the soil metagenome: a strategy for accessing the genetic and functional diversity of uncultured microorganisms. Appl. Environ. Microbiol. 66:2541-2547.[Abstract/Free Full Text]
  52. 27
  53. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
  54. 28
  55. Sauer, B. 1994. Site-specific recombination: developments and applications. Curr. Opin. Biotechnol. 5:521-527.[CrossRef][Medline]
  56. 29
  57. Seow, K. T., G. Meurer, M. Gerlitz, E. Wendt-Pienkowski, C. R. Hutchinson, and J. Davies. 1997. A study of iterative type II polyketide synthases, using bacterial genes cloned from soil DNA: a means to access and use genes from uncultured microorganisms. J. Bacteriol. 179:7360-7368.[Abstract/Free Full Text]
  58. 30
  59. Shima, J., A. Hesketh, S. Okamoto, S. Kawamoto, and K. Ochi. 1996. Induction of actinorhodin production by rpsL (encoding ribosomal protein S12) mutations that confer streptomycin resistance in Streptomyces lividans and Streptomyces coelicolor A3(2). J. Bacteriol. 179:7276-7284.
  60. 31
  61. Shizuya, H., B. Birren, U. J. Kim, V. Mancino, T. Slepak, Y. Tachiiri, and M. Simon. 1992. Cloning and stable maintenance of 300-kilobase-pair fragments of human DNA in Escherichia coli using an F-factor-based vector. Proc. Natl. Acad. Sci. USA 89:8794-8797.[Abstract/Free Full Text]
  62. 32
  63. Sosio, M., F. Giusino, C. Cappellano, E. Bossi, A. M. Puglia, and S. Donadio. 2000. Artificial chromosomes for antibiotic-producing actinomycetes. Nat. Biotechnol. 18:343-345.[CrossRef][Medline]
  64. 33
  65. Stover, C. K., X. Q. Pham, A. L. Erwin, S. D. Mizoguchi, P. Warrener, M. J. Hickey, F. S. Brinkman, W. O. Hufnagle, D. J. Kowalik, M. Lagrou, R. L. Garber, L. Goltry, E. Tolentino, S. Westbrock-Wadman, Y. Yuan, L. L. Brody, S. N. Coulter, K. R. Folger, A. Kas, K. Larbig, R. Lim, K. Smith, D. Spencer, G. K. Wong, Z. Wu, I. T. Paulsen, J. Reizer, M. H. Saier, R. E. Hancock, S. Lory, and M. V. Olson. 2000. Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen. Nature 406:959-964.[CrossRef][Medline]
  66. 34
  67. Timmis, K. N. 2002. Pseudomonas putida: a cosmopolitan opportunist par excellence. Environ. Microbiol. 4:779-781.[CrossRef][Medline]
  68. 35
  69. Vincent, M. N., L. A. Harrison, J. M. Brakin, P. A. Kovacevich, P. Mukerji, D. M. Weller, and D. A. Pierson. 1991. Genetic analysis of the antifungal activity of a soil-borne Pseudomonas aureofaciens strain. Appl. Environ. Microbiol. 57:2928-2934.[Abstract/Free Full Text]
  70. 36
  71. Wang, G. Y., E. Graziani, B. Waters, W. Pan, X. Li, J. McDermott, G. Meurer, G. Saxena, R. J. Andersen, and J. Davies. 2000. Novel natural products from soil DNA libraries in a streptomycete host. Org. Lett. 2:2401-2404.[CrossRef][Medline]
  72. 37
  73. Wang, Z., G. Xiong, and F. Lutz. 1995. Site-specific integration of the phage phi CTX genome into the Pseudomonas aeruginosa chromosome: characterization of the functional integrase gene located close to and upstream of attP. Mol. Gen. Genet. 246:72-79.[CrossRef][Medline]
  74. 38
  75. Ward, D. M., R. Weller, and M. M. Bateson. 1990. 16S rRNA sequences reveal numerous uncultured microorganisms in a natural community. Nature 345:63-65.[CrossRef][Medline]
  76. 39
  77. Ziermann, R., and M. C. Betlach. 1999. Recombinant polyketide synthesis in Streptomyces: engineering of improved host strains. BioTechniques 26:106-110.[Medline]
  78. 40
  79. Zimmer, R., and A. M. Verrinder Gibbins. 1997. Construction and characterization of a large-fragment chicken bacterial artificial chromosome library. Genomics 42:217-226.[CrossRef][Medline]


Applied and Environmental Microbiology, April 2004, p. 2452-2463, Vol. 70, No. 4
0099-2240/04/$08.00+0     DOI: 10.1128/AEM.70.4.2452-2463.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Porter, J. L., Tobias, N. J., Hong, H., Tuck, K. L., Jenkin, G. A., Stinear, T. P. (2009). Transfer, stable maintenance and expression of the mycolactone polyketide megasynthase mls genes in a recombination-impaired Mycobacterium marinum. Microbiology 155: 1923-1933 [Abstract] [Full Text]  
  • Chung, E. J., Lim, H. K., Kim, J.-C., Choi, G. J., Park, E. J., Lee, M. H., Chung, Y. R., Lee, S.-W. (2008). Forest Soil Metagenome Gene Cluster Involved in Antifungal Activity Expression in Escherichia coli. Appl. Environ. Microbiol. 74: 723-730 [Abstract] [Full Text]  
  • Zwolinski, M. D. (2007). DNA Sequencing: Strategies for Soil Microbiology. Soil Sci. 71: 592-600 [Abstract] [Full Text]  
  • Cottrell, M. T., Yu, L., Kirchman, D. L. (2005). Sequence and Expression Analyses of Cytophaga-Like Hydrolases in a Western Arctic Metagenomic Library and the Sargasso Sea. Appl. Environ. Microbiol. 71: 8506-8513 [Abstract] [Full Text]  
  • Martinez, A., Kolvek, S. J., Hopke, J., Tiong Yip, C. L., Osburne, M. S. (2005). Environmental DNA Fragment Conferring Early and Increased Sporulation and Antibiotic Production in Streptomyces Species. Appl. Environ. Microbiol. 71: 1638-1641 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martinez, A.
Right arrow Articles by Osburne, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martinez, A.
Right arrow Articles by Osburne, M. S.
Agricola
Right arrow Articles by Martinez, A.
Right arrow Articles by Osburne, M. S.