Previous Article | Next Article 
Applied and Environmental Microbiology, April 2004, p. 2514-2519, Vol. 70, No. 4
0099-2240/04/$08.00+0 DOI: 10.1128/AEM.70.4.2514-2519.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Growth and Sporulation of Bacillus cereus ATCC 14579 under Defined Conditions: Temporal Expression of Genes for Key Sigma Factors
Ynte P. de Vries,1,2,3* Luc M. Hornstra,1,3 Willem M. de Vos,1 and Tjakko Abee1,2
Wageningen Centre for Food Sciences,1
Laboratory of Food Microbiology, Wageningen UR,2
Agrotechnology and Food Innovations A&F, Wageningen, The Netherlands3
Received 4 August 2003/
Accepted 26 December 2003

ABSTRACT
An airlift fermentor system allowing precise regulation of pH
and aeration combined with a chemically defined medium was used
to study growth and sporulation of
Bacillus cereus ATCC 14579.
Sporulation was complete and synchronous. Expression of
sigA,
sigB,
sigF, and
sigG was monitored with real-time reverse transcription-PCR,
and the pattern qualitatively resembled that of
Bacillus subtilis.
This method allows reproducible production of stable spores,
while the synchronous growth and defined conditions are excellently
suitable for further gene expression studies of cellular differentiation
of
B. cereus.

INTRODUCTION
Bacillus cereus is a gram-positive, facultative anaerobic rod-shaped
endospore-forming bacterium.
B. cereus occurs ubiquitously in
soil and in many raw and processed foods such as rice, milk
and dairy products, spices, and vegetables (
4,
7,
14,
34,
36).
Many strains of
B. cereus are able to produce toxins and cause
distinct types of food poisoning (
13,
22). Concerns over
B. cereus contamination have increased because of the rapidly expanding
number of chilled foods that may be pasteurized but may still
contain viable spores (
4,
14). Spores from
B. cereus can germinate
and outgrow during storage, even at low temperatures (
4,
6,
14). Major efforts to battle this increasing problem are focusing
on determining the causes of the spore's resistance and the
mechanisms of germination.
There is ample literature on spores and sporulation of B. cereus, but for most sporulation studies that focus on genetics, derivatives of Bacillus subtilis 168 are used, due to their easy handling and genetic accessibility (9). B. subtilis has a much smaller genome (21) than that of B. cereus and contains no plasmids, while B. cereus strains are commonly known to harbor one or more plasmids (15). Genome analysis indicates that B. cereus and B. subtilis have completely different ecological backgrounds: whereas B. subtilis can be seen as a benign soil dweller specialized in degrading plant-derived polysaccharides, B. cereus seems to be adapted to thrive as a pathogen or parasite, preferring a more carnivorous diet of proteins and amino acids (17, 29). Differences include important sporulation genes, for example, in gerA-type operons, the products of which are essential to nutrient- and nonnutrient-mediated germination of spores (28, 42). The B. subtilis genome contains five gerA-type operons of which only three are expressed during sporulation (28), while data mining of the B. cereus genome has revealed the presence of seven gerA-like operons, which are all expressed during sporulation (L. M. Hornstra, Y. P. de Vries, M. H. Bennik, W. M. de Vos, and T. Abee, presented at Functional Genomics of Gram-Positive Microorganisms, 12th International Conference on Bacilli, Baveno, Italy, 22 to 27 June 2003). Furthermore, B. cereus spores are surrounded by an exosporium, whereas B. subtilis spores are not (20, 39). Thus, although many of the genes that play a role in sporulation are believed to be conserved among bacilli (10, 37), there may be important differences between B. cereus and B. subtilis sporulation genes and their expression.
It has been well established that bacterial spore properties are affected by the conditions during sporulation (2, 11, 12, 23, 33), but in most studies spores are routinely produced from fortified agar or rich liquid media, which results in heterogeneous sporulation conditions for the individual cells. Homogeneous sporulation conditions and precise regulation of growth and sporulation parameters are of great importance for obtaining reproducible and homogeneous spore batches. Furthermore, the study of gene expression during cell differentiation requires homogeneous and synchronized cultures.
In this study we describe defined conditions for growth and sporulation of B. cereus ATCC 14579, which has been characterized at the genome level (17), in a chemically defined medium combined with an airlift fermentor system. We monitored the expression of four genes coding for sigma factors involved in housekeeping, stress response, and sporulation (
A,
B,
F, and
G) during growth and sporulation. Important properties of the resulting spores are established and discussed, and the temporal expression of the sigma factor genes is compared to the sporulation model developed for B. subtilis.

Strains, medium, and fermentation.
B. cereus strain ATCC 14579 was obtained from the American Type
Culture Collection and grown on a chemically defined medium
modified from the work of Nakata (
25), which contained the following
components (final concentrations):
D-glucose (10 mM),
L-glutamic
acid (20 mM),
L-leucine (6 mM),
L-valine (2.6 mM),
L-threonine
(1.4 mM),
L-methionine (0.47 mM),
L-histidine (0.32 mM), sodium-
DL-lactate
(5 mM), acetic acid (1 mM), FeCl
3 (50 µM), CuCl
2 (2.5
µM), ZnCl
2 (12.5 µM), MnSO
4 (66 µM), MgCl
2 (1 mM), (NH
4)
2SO
4 (5 mM), Na
2MoO
4 (2.5 µM), CoCl
2 (2.5
µM), and Ca(NO
3)
2 (1 mM). The medium was buffered at pH
7.2 with 100 mM potassium phosphate buffer.
The fermentor system consisted of an autoclavable 2-liter glass bioreactor from Applikon (Schiedam, The Netherlands), equipped with an ADI 1020 biocontroller unit, an ADI 1012 motor controller, and an ADI 1018 thermocirculator. Sterile air was fed through the culture at a constant rate while the oxygen concentration was kept at 50% saturation level by automatic adjustment of the stirring speed. Fermentations were carried out at a constant temperature of 30°C. The fermentor was inoculated with approximately 4 x 108 B. cereus spores that had been pasteurized at 75°C for 15 min and subsequently germinated with a mixture of L-alanine and inosine (25 and 1 mM, respectively) in 10 mM potassium phosphate buffer at pH 8.0 for 5 min at 30°C.

Analytical procedures.
Concentrations of
D- and
L-lactic acid and glucose were determined
in culture supernatant by the UV method with enzymatic bioanalysis
kits from Boehringer Mannheim (Darmstadt, Germany). Phase-contrast
microscopy was performed with an Axioskop microscope from Zeiss,
equipped with a Coolpix 995 digital camera from Nikon.

Spore handling and properties.
Spores were harvested through airlifting as the spores stabilized
the foam formed in the top of the fermentor vessel. The foam
containing the spores passed through the fermentor air outlet
and was fed through two bottles in which it slowly collapsed.
What remained was a highly concentrated suspension containing
90 to 99% phase-bright spores, as monitored by phase-contrast
microscopy. This suspension was centrifuged at 10,000
x g for
30 min. The spores formed a solid pellet with a light cream
color, on top of which in some cases a thin, loosely packed,
dark brownish upper layer was present. This upper layer consisted
of cell debris and was discarded while the remainder of the
pellet was resuspended in sterile water. The spores were kept
at room temperature and subjected to daily washes in water until
there was no cell debris, vegetative cells, or phase-dark spores
left (typically after three to seven washings). Subsequently,
the spores were suspended in 10 mM KPO
4 buffer at pH 7 and stored
in the dark at 4°C.
The heat resistance assay was modified from reference 19. Spores (106 to 107/ml) were injected at regular time intervals in screw-cap tubes containing 10 mM KPO4 (pH 7) at 100°C in an oil bath. After a set time, all tubes were cooled simultaneously on ice. Serial dilutions were made in 10 mM KPO4 (pH 7) and plated onto diluted nutrient broth (2.6 g/liter; Difco) solidified with 1.5% agar. Colonies were counted after 3 days of incubation at 30°C.
Spore surface hydrophobicity was measured according to the method described in reference 35. Spores were suspended in water, and after measurement of the A660 (A before; values of 0.4 to 0.5), 0.1 ml of n-hexadecane (Sigma Aldrich) was added to 2 ml of spore suspension in a glass tube. This mixture was vortexed for 1 min, after which the phases were allowed to separate for 15 min. Then, the A660 of the aqueous phase was determined (A after), and the percent transfer to the n-hexadecane was deduced by calculating 100 [(A after/A before) x 100].
The wet density of the whole spore was measured according to the method in reference 38. Spores were concentrated in 0.15 M NaCl, added to 90% (vol/vol) Percoll (Amersham Pharmacia Biotech) solution with 0.15 M NaCl, and subsequently centrifuged for 20 min at 30,000 x g. Whole-spore wet density was derived by comparison of the positions of the spores with those of density marker beads (Amersham Pharmacia Biotech) in the self-established gradient.

RNA isolation and real-time reverse transcription-PCR.
For RNA extraction we used the RNeasy kit from Qiagen. Cells
from 2 ml of culture were resuspended in 0.6 ml of RLT buffer
provided in the RNeasy kit and lysed by bead beating (3 min
at 30 Hz) with 0.6 g of zirconia silica beads (0.1-mm diameter)
from Biospec (Bartlesville, Okla.). The lysate was centrifuged
for 2 min at the highest speed in an Eppendorf centrifuge, and
the supernatant was used in the protocol provided with the RNeasy
kit. The purified RNA was treated with RNase-free DNase (Amersham
Pharmacia Biotech). One hundred twenty nanograms of total RNA
of each sample was used for cDNA synthesis. In silico analyses
were performed with the ERGO genome and discovery system (
27)
from Integrated Genomics (Chicago, Ill.). Appropriate primers
(all 5' to 3') were designed for
sigA (
sigAF, CTATGTAGGCCGTTGGTATGCCT;
sigAR, AGGCGATGTTGCTTCTTGGTCTT),
sigB (
sigBF, GAAATCGCAAATCATTTAGG;
sigBR, CTTTTAATACGAGAAACGTG),
sigF (
sigFF, GGATGTATTGGGCTCTTGAAATCGG;
sigFR, CGGCTCGCTTCTTGTGCTAGAACAAC), and
sigG (
sigGF, GCAAAGTGGAGAGATAAGCGCAAGAG;
sigGR, TACGCGAATCGGATTATTATCACGC). Copy DNA was synthesized
with Superscript II (Invitrogen) according to the manufacturer's
instructions, in a final volume of 20 µl. For real-time
PCR we used the qPCR core kit for Sybr Green I-No ROX, from
Eurogentec. Amplification reaction mixtures contained 2 µl
of cDNA template and 10 pmol of each primer (R + F) in a final
volume of 50 µl. In deviation from the protocol delivered
with the qPCR core kit, 0.5 µl of 1,000-fold-diluted Sybr
Green I solution from Molecular Probes was used instead of the
Sybr Green from the qPCR core kit. The amplification profile
was 30 s at 94°C, 30 s at 58°C, and 60 s at 72°C
for
sigA,
sigB, and
sigF. For
sigB the temperature of step 2
was lowered from 58 to 55°C. PCR products were detected
directly by monitoring the increase in fluorescence caused by
Sybr Green I intercalation with the iCycler system (Bio-Rad
Laboratories). A threshold was set, which intersected the amplification
curves in the linear region of the semilog plot. The original
amounts of cDNA in unknown samples are compared to each other
by interpolation from a standard curve of Ct (threshold crossing)
values generated from different concentrations (10, 1, 0.1,
and 0.01 ng/µl) of genomic DNA, isolated from exponentially
growing
B. cereus cells according to the method in reference
31. The sigma factor expression level was calculated as expression
level =
aebCt, in which a and
b are constants dependent on the
primer set and amplification parameters, experimentally derived
from the standard curve with the genomic DNA as a template.
Ct is the threshold crossing value found in the amplification
reaction with the specific primer set, reaction parameters,
and cDNA from the specific time point as a template. All reactions
were carried out in duplicate, and the Ct values of the duplicates
differed in all cases less than 5%. All of the amplified fragments
used to generate data points had melting curves identical to
those of the positive controls and formed single bands of the
expected sizes on an agarose gel, confirming that the rise in
fluorescence measured by the iCycler system was caused by amplification
of only the specific gene fragments that we targeted.

Growth and substrate utilization.
To link temporal expression of genes to substrate availability
and growth phase, we began by determining the growth characteristics
and the substrate utilization (Fig.
1). The growth and pH development
during growth and sporulation were roughly similar to those
previously described (
18,
24,
26). However, we could clearly
distinguish five different growth phases, starting with a lag
phase (phase 1). In the exponential phase (phase 2) cells occurred
singly or in short chains and were highly motile. During this
phase, the pH in the culture dropped from 7.2 to 7.0 but started
to rise again as soon as the glucose was depleted (phase 3),
indicating that the decrease in pH resulted from fermentation
of glucose. Apparently, even with oxygen at a 50% saturation
level in the culture medium, the bacteria could not take up
oxygen sufficiently fast to support complete glucose respiration.
Homolactic acid fermentation of glucose was not likely to occur,
because the concentration of lactic acid did not increase. However,
B. cereus has been reported to ferment glucose to other acids
(
26). Furthermore, lactic acid is not metabolized by the bacteria
as long as glucose is present (phases 1 and 2), probably due
to catabolite repression. Upon glucose exhaustion the cells
entered stationary phase (phase 3), lost their motility, and
became arranged into aggregates (Fig.
2A), while lactic acid
was metabolized. Cell aggregation in
B. cereus has been reported
to be a specific event (
41) and may play a role in the transfer
of genetic material, which occurs frequently within the
B. cereus group (
15).
B. cereus metabolized both
D- and
L-isomers of lactic
acid with a slight preference for the
L isomer (Fig.
1B). Lactic
acid metabolism caused a dramatic increase of the pH.
At the end of the late stationary, early sporulation phase (phase
4) the first phase-gray spores could be seen in the aggregated
cells. The number of phase-bright spores increased suddenly
and dramatically in the final sporulation phase (phase 5). During
this final stage of spore formation, the absorbance increased
further, as in the end over 99% of the cells had a phase-bright
spore (Fig.
1 and
2B). Finally, the aggregates of cells fell
apart, after which the cells lysed and the spores were released
into the medium. Spore purification was facilitated by the high
degree of sporulation, because almost no vegetative cells were
left in the spore suspensions. Furthermore, the cells formed
spores at the same time, in phase 5, confirming synchronicity
in the culture. After release from the sporangia, most of the
spores aggregated in large amounts of foam formed in the top
of the fermentor and were airlifted out of the vessel. We used
this property to harvest the spores without the need to centrifuge
all the culture liquid. The foam was collected, and microscopic
observation confirmed that it consisted almost exclusively of
phase-bright spores (Fig.
2C).
We tested the mature spores for a number of parameters that are important in relation to food processing, such as wet heat resistance and hydrophobicity. The obtained spores were stable over time and showed a high resistance to wet heat, with a reproducible decimal reduction time of 1 min at 100°C, comparable to previous reports (1). Spore surface hydrophobicity is caused by the presence of an exosporium (20) and plays a key role in adherence of the spores to food and food processing equipment surfaces (5, 40). The obtained B. cereus spores were highly hydrophobic, since as much as 95% of the spores transferred from the water to the n-hexadecane phase (data not shown). In contrast, of B. cereus vegetative cells and B. subtilis spores more than 98% (data not shown) remained in the water phase, which is consistent with previous reports (20, 40). We measured the whole-spore density to investigate possible heterogeneity in the spore batches using self-establishing Percoll gradients (38). The spores were of uniform density, and dormant spores formed a single band at 1.13 g/ml, comparable to what was previously reported (38). Germinated spores settled between 1.062 and 1.075 g/ml and cell debris settled typically at 1.049 g/ml. The obtained B. cereus spores were stable over time and germinated readily upon addition of alanine and inosine. This method of spore production is excellent for production of large, pure, and homogeneous spore batches that are stable over time and suitable for detailed studies.

Gene expression.
Sporulation in
B. subtilis is orchestrated through the compartmentalized
action of four sigma factors,
F,
E,
G, and
K (
30). Sigma factor
A is the primary sigma factor in
B. subtilis, regulating macromolecular
synthesis and playing a key role in the housekeeping functions
of the cell. The alternative sigma factor
B plays a role in
the general stress response including entry into stationary
phase (
16). The
B. cereus genome is predicted to contain a single
homolog to
B. subtilis sigA,
sigB,
sigF, and
sigG (Table
1).
We used quantitative PCR to measure
sigF,
sigG,
sigA, and
sigB expression during the various growth phases in
B. cereus. With
quantitative PCR the amount of product after each amplification
cycle is measured. The obtained data were normalized with a
dilution series of genomic DNA. In this way, efficiencies of
the specific primer annealing and amplification reactions are
taken into account, which allows quantitative comparison of
the
sigA,
sigB,
sigF, and
sigG transcripts.
View this table:
[in this window]
[in a new window]
|
TABLE 1. Sigma factor genes from B. subtilis and B. cereus and their similarities based on amino acid sequence, with ERGO database open reading frame numbers
|
During phase 1 and the first half of phase 2 the cell density
was too low for efficient harvesting. Halfway through phase
2, when the absorbance reached 0.2, the first cell samples were
taken and transcripts of
sigA,
sigB, and
sigF were detected
(Fig.
1C). Phase 2 was characterized by a high expression of
sigA, low expression of
sigB and
sigF, and the absence of
sigG transcripts. The
sigA transcript was most abundant, while the
sigB and
sigF expression was 100- and 20-fold lower, respectively.
The high-level expression of
sigA, which continues through phases
3 and 4 (see below), confirms its anticipated pivotal role in
all cellular processes. The detection of small amounts of
sigB and
sigF transcript during exponential growth may be explained
by either some heterogeneity or low expression by the majority
of the cells. However, at the end of phase 2, upon entry into
early stationary phase (phase 3), transcription of
sigB and
sigF increased markedly (see below), to 8- and 30-fold over
initial values, respectively, while
sigA expression remained
essentially constant. This indicates that the vast majority
of the cells enter stationary phase at the same time, confirming
synchronicity of the culture.
Phase 3, the early stationary phase, was characterized by peaks of sigB and sigF expression, while sigA transcription remained high and the first sigG transcripts were detected at a low abundance. We detected the sigB expression early in phase 3, at the time of glucose exhaustion; subsequently lactate was metabolized (Fig. 1B). In B. subtilis,
B is expressed upon entry into stationary phase (16) and when the cell encounters stress, directly affecting cell and carbon metabolism (32). Our findings fit this idea, although of the three lactate dehydrogenase genes in the B. cereus genome none contains a
B consensus sequence, and none are upregulated when
B is activated (W. V. Schaik, personal communication). This suggests that, in B. cereus, if
B influences carbon metabolism, it does so indirectly. sigF transcription was upregulated parallel to sigB transcription but to a higher level (30-fold, Fig. 1C) and showing a broader peak that lasted through phases 3 and 4. This is before sporulation started, as with B. subtilis (8). Halfway through phase 3, sigG transcripts could be detected for the first time (Fig. 1C). Initial sigG transcription intensity was, like that of sigB and sigF transcription, much lower than that of sigA and remained low during phase 3. Sigma factor
G plays a role in the final stages of sporulation. It is expressed in the forespore and regulates synthesis of SASP and Ger proteins (16).
Phase 4, the late stationary and early sporulation phase, was characterized by a significant increase (140-fold) of sigG expression. In B. subtilis
G is, just like
F, held inactive until the appropriate moment, while sigG transcription is, in addition to stimulation by
F, stimulated by active
G (30). Indeed, upstream of the B. cereus sigG we found a clear
G consensus sequence (data not shown) that fits with those previously described (3). This, in combination with the sharp peak of sigG expression, shows that in B. cereus autostimulation of sigG probably takes place. Interestingly, sigF transcription remains high in phase 4 after its peak in phase 3. This suggests that, while
G is already active, sigF is still transcribed or, more likely, the sigF transcript is quite stable over time.
In phase 5 the spores became phase bright and microscopically clearly visible (Fig. 1B and 2C). The bulk of the spores acquired a phase-bright appearance soon after the peak in sigG expression. This indicates forespore core dehydration in response to
G activity, as in B. subtilis (8). The oxygen consumption (data not shown) fell to nearly zero, confirming that all metabolic activity stopped, while as anticipated the amount of sigA, sigB, sigF, and sigG transcripts markedly decreased in this phase.
In conclusion, we have described an easy and efficient way of producing synchronized and homogeneous B. cereus spore batches. The chemically defined medium in combination with the fermentor system allows precise monitoring and manipulation of key growth and sporulation parameters and results in synchronous growth and sporulation, which facilitates gene expression studies. The kinetics of expression of sigA, sigB, sigF, and sigG follow the model developed for B. subtilis, underscoring the conservation of sporulation mechanisms among bacilli. Future studies will focus on gene expression differences during growth and sporulation with different sets of parameters, for example, pH and carbon source.

FOOTNOTES
* Corresponding author. Mailing address: Wageningen Centre for Food Sciences, P.O. Box 557, 6700 AN Wageningen, The Netherlands. Phone: 31-317-475109. Fax: 31-317-475347. E-mail:
Ynte.deVries{at}wur.nl.


REFERENCES
1 - Algie, J. E. 1983. The heat resistance of bacterial spores and its relationship to the contraction of the forespore protoplasm during sporulation. Curr. Microbiol. 9:173-176.
2 - Atrih, A., and S. J. Foster. 2001. Analysis of the role of bacterial endospore cortex structure in resistance properties and demonstration of its conservation amongst species. J. Appl. Microbiol. 91:364-372.[CrossRef][Medline]
3 - Barlass, P. J., C. W. Houston, M. O. Clements, and A. Moir. 2002. Germination of Bacillus cereus spores in response to L-alanine and to inosine: the roles of gerL and gerQ operons. Microbiology 148:2089-2095.[Abstract/Free Full Text]
4 - Carlin, F., H. Girardin, M. W. Peck, S. C. Stringer, G. C. Barker, A. Martinez, A. Fernandez, P. Fernandez, W. M. Waites, S. Movahedi, F. van Leusden, M. Nauta, R. Moezelaar, M. D. Torre, and S. Litman. 2000. Research on factors allowing a risk assessment of spore-forming pathogenic bacteria in cooked chilled foods containing vegetables: a FAIR collaborative project. Int. J. Food Microbiol. 60:117-135.[CrossRef][Medline]
5 - Charlton, S., A. J. Moir, L. Baillie, and A. Moir. 1999. Characterization of the exosporium of Bacillus cereus. J. Appl. Microbiol. 87:241-245.[CrossRef][Medline]
6 - Choma, C., M. H. Guinebretiere, F. Carlin, P. Schmitt, P. Velge, P. E. Granum, and C. Nguyen-The. 2000. Prevalence, characterization and growth of Bacillus cereus in commercial cooked chilled foods containing vegetables. J. Appl. Microbiol. 88:617-625.[CrossRef][Medline]
7 - Christiansson, A., J. Bertilsson, and B. Svensson. 1999. Bacillus cereus spores in raw milk: factors affecting the contamination of milk during the grazing period. J. Dairy Sci. 82:305-314.[Abstract]
8 - Driks, A. 1999. Bacillus subtilis spore coat. Microbiol. Mol. Biol. Rev. 63:1-20.[Abstract/Free Full Text]
9 - Driks, A. 2002. Maximum shields: the assembly and function of the bacterial spore coat. Trends Microbiol. 10:251-254.[CrossRef][Medline]
10 - Eichenberger, P., S. T. Jensen, E. M. Conlon, C. van Ooij, J. Silvaggi, J. E. Gonzalez-Pastor, M. Fujita, S. Ben-Yehuda, P. Stragier, J. S. Liu, and R. Losick. 2003. The
E regulon and the identification of additional sporulation genes in Bacillus subtilis. J. Mol. Biol. 327:945-972.[CrossRef][Medline]
11 - Evans, R. I., N. J. Russell, G. W. Gould, and P. J. McClure. 1997. The germinability of spores of a psychrotolerant, non-proteolytic strain of Clostridium botulinum is influenced by their formation and storage temperature. J. Appl. Microbiol. 83:273-280.[CrossRef][Medline]
12 - Gonzalez, I., M. Lopez, S. Martinez, A. Bernardo, and J. Gonzalez. 1999. Thermal inactivation of Bacillus cereus spores formed at different temperatures. Int. J. Food Microbiol. 51:81-84.[CrossRef][Medline]
13 - Granum, P. E. 1994. Bacillus cereus and its toxins. Soc. Appl. Bacteriol. Symp. Ser. 23:61S-66S.
14 - Guinebretiere, M. H., H. Girardin, C. Dargaignaratz, F. Carlin, and C. Nguyen-The. 2003. Contamination flows of Bacillus cereus and spore-forming aerobic bacteria in a cooked, pasteurized and chilled zucchini puree processing line. Int. J. Food Microbiol. 82:223-232.[CrossRef][Medline]
15 - Helgason, E., O. A. Okstad, D. A. Caugant, H. A. Johansen, A. Fouet, M. Mock, I. Hegna, and A.-B. Kolsto. 2000. Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensisone species on the basis of genetic evidence. Appl. Environ. Microbiol. 66:2627-2630.[Abstract/Free Full Text]
16 - Helmann, J. D., and C. P. Moran, Jr. 2002. RNA polymerase and sigma factors, p. 289-313. In A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and its closest relatives: from genes to cells. ASM Press, Washington, D.C.
17 - Ivanova, N., A. Sorokin, I. Anderson, N. Galleron, B. Candelon, V. Kapatral, A. Bhattacharyya, G. Reznik, N. Mikhailova, A. Lapidus, L. Chu, M. Mazur, E. Goltsman, N. Larsen, M. D'Souza, T. Walunas, Y. Grechkin, G. Pusch, R. Haselkorn, M. Fonstein, S. D. Ehrlich, R. Overbeek, and N. Kyrpides. 2003. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature 423:87-91.[CrossRef][Medline]
18 - Kennedy, R. S., F. J. Malveaux, and J. J. Cooney. 1971. Effects of glutamic acid on sporulation of Bacillus cereus and on spore properties. Can. J. Microbiol. 17:511-519.[Medline]
19 - Kooiman, W. J. 1974. The screw-cap tube technique: a new and accurate technique for the determination of the wet heat resistance of bacterial spores, p. 87-92. In A. N. Barker, G. W. Gould, and J. Wolf (ed.), Spore research 1973. Academic Press, London, United Kingdom.
20 - Koshikawa, T., M. Yamazaki, M. Yoshimi, S. Ogawa, A. Yamada, K. Watabe, and M. Torii. 1989. Surface hydrophobicity of spores of Bacillus spp. J. Gen. Microbiol. 135:2717-2722.[Abstract/Free Full Text]
21 - Kunst, F., N. Ogasawara, I. Moszer, A. M. Albertini, G. Alloni, V. Azevedo, M. G. Bertero, P. Bessieres, A. Bolotin, S. Borchert, R. Borriss, L. Boursier, A. Brans, M. Braun, S. C. Brignell, S. Bron, S. Brouillet, C. V. Bruschi, B. Caldwell, V. Capuano, N. M. Carter, S. K. Choi, J. J. Codani, I. F. Connerton, A. Danchin, et al. 1997. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390:249-256.[CrossRef][Medline]
22 - Lund, T., M. L. De Buyser, and P. E. Granum. 2000. A new cytotoxin from Bacillus cereus that may cause necrotic enteritis. Mol. Microbiol. 38:254-261.[CrossRef][Medline]
23 - Melly, E., P. C. Genest, M. E. Gilmore, S. Little, D. L. Popham, A. Driks, and P. Setlow. 2002. Analysis of the properties of spores of Bacillus subtilis prepared at different temperatures. J. Appl. Bacteriol. 92:1105-1115.
24 - Nakata, H. M. 1963. Effect of pH on intermediates produced during growth and sporulation of Bacillus cereus. J. Bacteriol. 86:577-581.[Abstract/Free Full Text]
25 - Nakata, H. M. 1964. Organic nutrients required for growth and sporulation of Bacillus cereus. J. Bacteriol. 88:1522-1524.[Free Full Text]
26 - Nakata, H. M., and H. O. Halvorson. 1960. Biochemical changes occurring during growth and sporulation of Bacillus cereus. J. Bacteriol. 80:801-810.[Free Full Text]
27 - Overbeek, R., N. Larsen, T. Walunas, M. D'Souza, G. Pusch, E. Selkov, Jr., K. Liolios, V. Joukov, D. Kaznadzey, I. Anderson, A. Bhattacharyya, H. Burd, W. Gardner, P. Hanke, V. Kapatral, N. Mikhailova, O. Vasieva, A. Osterman, V. Vonstein, M. Fonstein, N. Ivanova, and N. Kyrpides. 2003. The ERGO genome analysis and discovery system. Nucleic Acids Res. 31:164-171.[Abstract/Free Full Text]
28 - Paidhungat, M., and P. Setlow. 2000. Role of Ger proteins in nutrient and nonnutrient triggering of spore germination in Bacillus subtilis. J. Bacteriol. 182:2513-2519.[Abstract/Free Full Text]
29 - Parkhill, J., and C. Berry. 2003. Genomics: relative pathogenic values. Nature 423:23-25.[Medline]
30 - Piggot, P. J., and R. Losick. 2002. Sporulation genes and intercompartmental regulation, p. 483-519. In A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and its closest relatives: from genes to cells. ASM Press, Washington, D.C.
31 - Pospiech, A., and B. Neumann. 1995. A versatile quick-prep of genomic DNA from gram-positive bacteria. Trends Genet. 11:217-218.[CrossRef][Medline]
32 - Price, C. W. 2002. General stress response, p. 369-385. In A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and its closest relatives: from genes to cells. ASM Press, Washington, D.C.
33 - Raso, J., M. M. Gongora-Nieto, G. V. Barbosa-Canovas, and B. G. Swanson. 1998. Influence of several environmental factors on the initiation of germination and inactivation of Bacillus cereus by high hydrostatic pressure. Int. J. Food Microbiol. 44:125-132.[CrossRef][Medline]
34 - Roberts, T. A., and J. A. Thomas. 1982. Germination and outgrowth of single spores of Clostridium botulinum and putrefactive anaerobes. J. Appl. Bacteriol. 53:317-321.[Medline]
35 - Rosenberg, M., D. Gutnick, and E. Rosenberg. 1980. Adherence of bacteria to hydrocarbons: a simple method for measuring cell-surface hydrophobicity. FEMS Microbiol. Lett. 9:29-33.[CrossRef]
36 - Sarrías, J. A., M. Valero, and M. C. Salmerón. 2002. Enumeration, isolation and characterization of Bacillus cereus strains from Spanish raw rice. Food Microbiol. 19:589-595.[CrossRef]
37 - Stragier, P. 2002. A gene odyssey: exploring the genomes of endospore-forming bacteria, p. 519-527. In A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and its closest relatives: from genes to cells. ASM Press, Washington, D.C.
38 - Tisa, L. S., T. Koshikawa, and P. Gerhardt. 1982. Wet and dry bacterial spore densities determined by buoyant sedimentation. Appl. Environ. Microbiol. 43:1307-1310.[Abstract/Free Full Text]
39 - Todd, S. J., A. J. Moir, M. J. Johnson, and A. Moir. 2003. Genes of Bacillus cereus and Bacillus anthracis encoding proteins of the exosporium. J. Bacteriol. 185:3373-3378.[Abstract/Free Full Text]
40 - Wiencek, K. M., N. A. Klapes, and P. M. Foegeding. 1990. Hydrophobicity of Bacillus and Clostridium spores. Appl. Environ. Microbiol. 56:2600-2605.[Abstract/Free Full Text]
41 - Wise, J. A., and D. K. Fraser. 1972. Developmental stages during growth and sporulation of Bacillus cereus, p. 203-212. In H. O. Halvorson, R. Hanson, and L. L. Campbell (ed.), Spores V. American Society for Microbiology, Washington, D.C.
42 - Wuytack, E. Y., J. Soons, F. Poschet, and C. W. Michiels. 2000. Comparative study of pressure- and nutrient-induced germination of Bacillus subtilis spores. Appl. Environ. Microbiol. 66:257-261.[Abstract/Free Full Text]
Applied and Environmental Microbiology, April 2004, p. 2514-2519, Vol. 70, No. 4
0099-2240/04/$08.00+0 DOI: 10.1128/AEM.70.4.2514-2519.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Wang, S.-W., Chen, C.-Y., Tseng, J. T., Liang, S.-H., Chen, S.-C., Hsieh, C., Chen, Y.-h., Chen, C.-C.
(2009). orf4 of the Bacillus cereus sigB Gene Cluster Encodes a General Stress-Inducible Dps-Like Bacterioferritin. J. Bacteriol.
191: 4522-4533
[Abstract]
[Full Text]
-
Hornstra, L. M., van der Voort, M., Wijnands, L. M., Roubos-van den Hil, P. J., Abee, T.
(2009). Role of Germinant Receptors in Caco-2 Cell-Initiated Germination of Bacillus cereus ATCC 14579 Endospores. Appl. Environ. Microbiol.
75: 1201-1203
[Abstract]
[Full Text]
-
Wijman, J. G. E., de Leeuw, P. P. L. A., Moezelaar, R., Zwietering, M. H., Abee, T.
(2007). Air-Liquid Interface Biofilms of Bacillus cereus: Formation, Sporulation, and Dispersion. Appl. Environ. Microbiol.
73: 1481-1488
[Abstract]
[Full Text]
-
Hornstra, L. M., de Vries, Y. P., de Vos, W. M., Abee, T.
(2006). Influence of Sporulation Medium Composition on Transcription of ger Operons and the Germination Response of Spores of Bacillus cereus ATCC 14579.. Appl. Environ. Microbiol.
72: 3746-3749
[Abstract]
[Full Text]
-
van Schaik, W., Zwietering, M. H., de Vos, W. M., Abee, T.
(2005). Deletion of the sigB Gene in Bacillus cereus ATCC 14579 Leads to Hydrogen Peroxide Hyperresistance. Appl. Environ. Microbiol.
71: 6427-6430
[Abstract]
[Full Text]
-
van Schaik, W., Tempelaars, M. H., Zwietering, M. H., de Vos, W. M., Abee, T.
(2005). Analysis of the Role of RsbV, RsbW, and RsbY in Regulating {sigma}B Activity in Bacillus cereus. J. Bacteriol.
187: 5846-5851
[Abstract]
[Full Text]
-
de Vries, Y. P., Atmadja, R. D., Hornstra, L. M., de Vos, W. M., Abee, T.
(2005). Influence of Glutamate on Growth, Sporulation, and Spore Properties of Bacillus cereus ATCC 14579 in Defined Medium. Appl. Environ. Microbiol.
71: 3248-3254
[Abstract]
[Full Text]
-
Hornstra, L. M., de Vries, Y. P., de Vos, W. M., Abee, T., Wells-Bennik, M. H. J.
(2005). gerR, a Novel ger Operon Involved in L-Alanine- and Inosine-Initiated Germination of Bacillus cereus ATCC 14579. Appl. Environ. Microbiol.
71: 774-781
[Abstract]
[Full Text]