Previous Article | Next Article 
Applied and Environmental Microbiology, May 2004, p. 3133-3137, Vol. 70, No. 5
0099-2240/04/$08.00+0 DOI: 10.1128/AEM.70.5.3133-3137.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Antimicrobial Resistance of Enterococcus Species Isolated from Produce
Lynette M. Johnston and Lee-Ann Jaykus*
Department of Food Science, College of Life Science and Agriculture, North Carolina State University, Raleigh, North Carolina 27695-7624
Received 5 September 2003/
Accepted 1 February 2004

ABSTRACT
The purpose of this study was to characterize the antibiotic
resistance profiles of
Enterococcus species isolated from fresh
produce harvested in the southwestern United States. Among the
185
Enterococcus isolates obtained, 97 (52%) were
Enterococcus faecium, 38 (21%) were
Enterococcus faecalis, and 50 (27%) were
other
Enterococcus species. Of human clinical importance,
E. faecium strains had a much higher prevalence of resistance to
ciprofloxacin, tetracycline, and nitrofurantoin than
E. faecalis. E. faecalis strains had a low prevalence of resistance to antibiotics
used to treat
E. faecalis infections of both clinical and of
agricultural relevance, excluding its intrinsic resistance patterns.
Thirty-four percent of the isolates had multiple-drug-resistance
patterns, excluding intrinsic resistance. Data on the prevalence
and types of antibiotic resistance in
Enterococcus species isolated
from fresh produce may be used to describe baseline antibiotic
susceptibility profiles associated with
Enterococcus spp. isolated
from the environment. The data collected may also help elucidate
the role of foods in the transmission of antibiotic-resistant
strains to human populations.

INTRODUCTION
Enterococcus species are ubiquitous, commensal inhabitants of
the gastrointestinal tract of humans and animals. They are frequently
isolated from environmental sources such as soil, surface waters,
and raw plant and animal products, where their intrinsic ruggedness
allows them to persist and spread in the environment. Once viewed
as a genus of minimal clinical impact, enterococci, particularly
Enterococcus faecium and
Enterococcus faecalis, have surfaced
as organisms of importance due to the emergence of multiple-drug-resistant
strains that are currently responsible for approximately 12%
of all nosocomial infections in the United States (
10,
11).
Furthermore, their ability to acquire antibiotic resistance
through transfer of plasmids and transposons, chromosomal exchange,
or mutation presents a significant challenge for therapeutic
measures (
14).
Antibiotic-resistant strains of Enterococcus have been isolated from raw foods (5), and some believe that water and food are possible vectors of strain transmission to human intestinal flora (28). Of recent concern is the potential development of environmental reservoirs of antibiotic resistance in farmland. Specifically, the application of untreated irrigation water or manure slurry to croplands could result in the spread of resistance to indigenous soil bacteria through horizontal transfer, which could in turn transfer resistance back to animals or humans via crops (17, 21).
While the prevalence and transmission of antibiotic resistance among bacteria associated with food animals has been well documented, research regarding resistance profiles of bacteria isolated from raw produce is lacking (1, 7, 26, 27). A few studies examining the prevalence of resistance among gram-negative microorganisms isolated from produce exist, although results are conflicting. Hamilton-Miller and Shah (6) characterized the antibiotic susceptibility of enterobacterial flora of salad vegetables, finding a high degree of resistance to ampicillin and the narrow- and expanded-spectrum cephalosporins. Alternatively, a Finnish study found that members of the Enterobacteriaceae family isolated from vegetables were highly susceptible to the antibiotics studied, and multidrug-resistant strains were generally not identified (18). Prazak et al. (19) studied the resistance patterns among Listeria monocytogenes isolates from cabbage farms, in which 98% of the isolates were resistant to at least two drugs and 85% were found to be resistant to penicillin. However, the prevalence and patterns of antibiotic resistance among Enterococcus strains isolated from fresh vegetables are not yet well understood.
This study was undertaken as a supplement to a larger project, the purpose of which was to determine the prevalence of selected microorganisms in fresh produce harvested from the southwestern United States. In this study, we report on the isolation, identification, and antibiotic susceptibility profiles for members of the Enterococcus genus isolated directly from these fresh produce samples.

Isolation, identification, and antibiotic resistance profiles of E. faecalis and E. faecium.
The sampling site, located in the southwestern United States,
included 13 farms and 5 packing sheds. All samples were obtained
between January and May 2002. A total of 304 produce samples
were collected throughout production and processing and consisted
of a variety of leafy greens, herbs, and cantaloupe. Composite
samples of approximately 200 g were obtained by workers wearing
sterile, disposable gloves and placed in sterile Whirl-Pak bags
(Nasco, Fort Atkinson, Wis.). These were then immediately shipped
on ice to our location at North Carolina State University by
overnight courier. All microbial analyses were initiated within
24 h of sample collection.
The cultural methods used were recommended by the U.S. Food and Drug Administration, Center for Veterinary Medicine (7, 23; D. D. Wagner [Food and Drug Administration], personal communication). After 24 h at 37°C, a representative colony for each morphology, generally two or three per sample, showing esculin hydrolysis (darkened colony with black halo) was purified and screened for hemolysis by streaking on 5% sheep blood agar (Remel, Lenexa, Kans.). The colonies were then screened at the genus level by PCR-based assays and at the species level by the Vitek system (Vitek 32, GPI panel; bioMerieux, Hazelwood, Mo.). For PCR, DNA was extracted with the Ultra Clean microbial DNA isolation kit (Mo Bio Laboratories, Inc., Solana, Calif.) in accordance with manufacturer recommendations. Primers were directed to the tuf gene (forward primer, TACTGACAACCATTCATGATG; reverse primer, AACTTCGTCACCAACGCGAAC), yielding a 112-bp product (9). Two microliters of DNA was added to a 98-µl mixture containing 1x PCR buffer, a 200 µM concentration of each deoxynucleoside triphosphate, 2.5 U of AmpliTaq polymerase, 3.0 mM MgCl2, and a 1 µM concentration of each primer. The PCR mixtures were subjected to predenaturation at 95°C for 3 min, followed by 35 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min. A 7-min final elongation step at 72°C concluded the PCR assay. Two positive controls, E. faecalis ATCC 29212 and E. faecium ATCC 19434, were used. Isolates producing an amplicon band of the appropriate size by agarose gel (3%) electrophoresis were considered presumptively positive for the genus Enterococcus and were sent on for Vitek species-level identification to the Clinical Microbiology Laboratory of the College of Veterinary Medicine at North Carolina State University.
Strains identified as E. faecium or E. faecalis were screened for antibiotic susceptibility by the microdilution broth method with Mueller-Hinton media (TREK Diagnostics, Westlake, Ohio) as outlined by the National Committee on Clinical Laboratory Standards (NCCLS) (16). A customized panel of 17 antibiotics with various concentration ranges (TREK Diagnostics), identical to that used in the National Antimicrobial Resistance Monitoring System (NARMS 2001) program, for gram-positive organisms was used in this study. The antibiotics and their concentration ranges were as follows: bacitracin, 8 to 128 IU/ml; chloramphenicol, 2 to 32 µg/ml; erythromycin, 0.5 to 8 µg/ml; bambermycin (flavomycin), salinomycin, vancomycin, quinupristin-dalfopristin, and lincomycin, 1 to 32 µg/ml; penicillin, 0.5 to 16 µg/ml; tetracycline, 4 to 32 µg/ml; tylosin tartrate, 0.25 µg/ml; ciprofloxacin, 0.12 to 4 µg/ml; linezolid, 0.5 to 8 µg/ml; nitrofurantoin, 2 to 128 µg/ml; kanamycin and gentamicin, 128 to 1,028 µg/ml; and streptomycin, 512 to 2,048 µg/ml. MICs were determined manually by assessing each antibiotic and strain combination for growth. Isolates were categorized as susceptible, intermediate, or resistant, based on the NCCLS interpretive standards, where applicable (15). The MICs, based on NCCLS breakpoints, were as follows: chloramphenicol and vancomycin,
32 µg/ml; erythromycin and linezolid,
8 µg/ml; penicillin and tetracycline,
16 µg/ml; quinupristin-dalfopristin and ciprofloxacin,
4 µg/ml; nitrofurantoin,
128 µg/ml; gentamicin, >500 µg/ml; and streptomycin, >1,000 µg/ml (15). Differentiations between susceptibility and resistance are based on pharmacological, clinical, and microbiological criteria. Unfortunately, both pharmacological and clinical data are lacking for most antibiotics used as growth promoters (3). Therefore, in instances where NCCLS standards were not available, a quantitative evaluation of resistance was done through calculation of MICs at which 50% and 90% of isolates were inhibited (MIC50 and MIC90) (15, 16). Control strains included E. faecalis ATCC 29212 (vancomycin susceptible) and ATCC 51299 (vancomycin resistant) (7, 16). Profiles from different isolates collected from the same sample that differed by less than 2 dilutions for at least one antimicrobial MIC were considered duplicates. Consequently, only a single isolate was included for subsequent analysis.

Prevalence and antibiotic resistance patterns of E. faecalis and E. faecium isolates from produce.
The distribution of produce samples and
Enterococcus species
is shown in Table
1. Mustard greens, parsley, and cantaloupe
represented nearly 70% (208 of 304) of the total produce items
collected. At least one
Enterococcus strain was isolated from
over half of these samples. Among the 185
Enterococcus isolates
obtained from all of the samples, a total of 97 (52%) were
E. faecium, 38 (21%) were
E. faecalis, and 50 (27%) were other
Enterococcus species. Ninety-one percent of the
E. faecium isolates
and 32% of the
E. faecalis isolates were resistant to at least
one of the antibiotics tested, excluding intrinsic resistance.
A summary of resistance profiles is provided in Table
2.

Inherent resistance.
The treatment of
Enterococcus infections is limited by the intrinsic
resistance among enterococci. In general, enterococci show intrinsic
resistance to cephalosporins, lincosamides, and many synthetic
ß-lactams, such as the penicillinase-resistant penicillins
(
5,
20).
Enterococcus species are also resistant to low levels
of aminoglycosides, due to the decreased uptake of this antibiotic
class (
5). In this study, a majority of the
E. faecium and
E. faecalis isolates showed inherent resistance patterns which
were consistent with previous studies with farm animals and
pets (
2,
4). For instance, both
E. faecium and
E. faecalis had
intrinsic resistance to bacitracin, i.e., 90% of the isolates
were inhibited at concentrations greater than 128 IU/ml. Also,
for
E. faecium the MIC
90 of flavomycin was greater than 32 µg/ml.
Consistent with reported data (
8,
22), a majority (97%) of
E. faecalis isolates were resistant to quinupristin-dalfopristin
when species identification was based on PCR alone but less
so (87%) if identification was based on Vitek. Results also
showed that isolates were resistant to low levels of lincomycin.

Resistance relevant to animal agriculture.
It has been suggested that the overuse of antibiotics in livestock
production may provide an environmental reservoir of antibiotic
resistance (
21). Among the panel of 17 antibiotics screened
in this study, 7 are used in animal feed for growth promotion.
These include bacitracin, flavomycin, penicillin, salinomycin,
tetracycline, lincomycin, and tylosin (
12). Both
E. faecium and
E. faecalis demonstrated a high degree of susceptibility
to salinomycin, lincomycin, and tylosin. As mentioned above,
E. faecium is intrinsically resistant to flavomycin; however,
E. faecalis isolates were susceptible to flavomycin (MIC
90 =
4 µg/ml). Less than 10% of the
E. faecium isolates were
resistant to penicillin, and all
E. faecalis isolates were susceptible
to penicillin. Twenty-nine percent of the
E. faecium isolates
and no
E. faecalis isolates were resistant to tetracycline.
Erythromycin is also used in livestock production, specifically
for therapeutic purposes in chickens and turkeys (
12). In this
case, 10% of the
E. faecium isolates were resistant to erythromycin,
while only 3% of the
E. faecalis isolates were resistant. We
can generally conclude that there was not a high degree of resistance
to the antibiotics commonly used in animal agriculture among
the
Enterococcus isolates collected in this study, especially
for
E. faecalis. However,
E. faecium demonstrated a higher degree
of resistance to tetracycline (29%) than did
E. faecalis.

Resistance relevant to human medicine.
All of the antibiotics used in the NARMS 2001 panel are of importance
for human therapeutic use except for tylosin tartrate, salinomycin,
and flavomycin (
29). Penicillin, vancomycin, aminoglycosides,
chloramphenicol, ciprofloxacin, and quinupristin-dalfopristin
all have been used in the treatment of enterococcal infections
either in combination therapy, for optimal killing, or monotherapeutically
(
4). Synergistic treatment includes the use of an aminoglycoside
with the addition of a cell wall-active agent, such as vancomycin
or penicillin (
4). In the present study, there was an extremely
low level of resistance to the aminoglycosides (
E. faecium,
3%;
E. faecalis, 0%), vancomycin (
E. faecium, 0%;
E. faecalis,
0%), and penicillin (
E. faecium, 7%;
E. faecalis, 0%). Chloramphenicol,
also used synergistically in documented cases, was shown to
inhibit a majority of all isolates; 5% of
E. faecium strains
and only 3% of
E. faecalis strains were resistant to chloramphenicol
(
4). According to Chow and Shlaes, enterococcal infections of
less severity have been treated with a single antibiotic (
4).
Among the drugs in the NARMS 2001 panel, an example of such
an antibiotic is ciprofloxacin, to which 27 (28%) of the
E. faecium strains and 2 (5%) of the
E. faecalis strains were found
to be resistant. Quinupristin-dalfopristin can also be used
for the treatment of
E. faecium infections in humans, and in
our study, 16 (16%) isolates were found to be resistant and
48 (49%) were intermediately resistant to these drugs. There
is evidence that during the therapeutic use of quinupristin-dalfopristin
for
E. faecium bacteremia, superinfection of
E. faecalis can
occur, posing concerns regarding such a high proportion of
E. faecium resistance to these drugs (
4,
13). Finally, and consistent
with the literature (
25), we found that all
E. faecalis strains
were susceptible to nitrofurantoin, a drug frequently used for
the treatment of
E. faecalis urinary tract infections. When
the data are taken together, there was a relatively low prevalence
of resistance to most of the drugs used in clinical treatment
of enterococcal infections in humans, especially for
E. faecalis.

Multiple-drug resistance.
Fifty-nine (61%) of the
E. faecium isolates and 4 (11%) of the
E. faecalis isolates showed multidrug resistance, i.e., resistance
to two or more drugs, although no specific patterns of multidrug
resistance were readily apparent. In general, the
E. faecium isolates had a greater degree of multidrug resistance than did
the
E. faecalis isolates. Twenty-five percent of the
E. faecium strains had simultaneous resistance to three or more drugs.
As previously mentioned, significant resistance was found among
the
E. faecium isolates to ciprofloxacin, tetracycline, and
nitrofurantoin. Interestingly, at least one of these clinically
important antibiotics was represented in over 75% of the multidrug-resistant
E. faecium strains, suggesting the possibility of gene linkage,
although this was not confirmed in our study. For all
E. faecium and
E. faecalis isolates, 24 (18%) multidrug resistant strains
were resistant to ciprofloxacin, 22 (16%) strains were resistant
to tetracycline, and 21 (16%) strains were resistant to nitrofurantoin.
Six (6%)
E. faecium strains were found to be simultaneously
resistant to all three antibiotics.

Conclusions.
Multiple-drug-resistant strains of
E. faecalis and
E. faecium have been increasingly associated with nosocomial infections.
Of particular interest has been the potential for foods as a
vehicle for transmission of these strains to humans or, alternatively,
as a reservoir for horizontal transfer between strains. This
might be considered credible since once ingested, enterococci
can survive gastric passage, multiply, and colonize the gastrointestinal
tract for a significant amount of time (
24). Indeed, there is
strong epidemiological evidence to link the use of antibiotics
in human medicine and animal agriculture with the presence of
resistant strains in animal products. In many cases where high
rates of resistance have been shown to occur in food and humans,
there is also a link to drug use in animals, conferring cross-resistance
from avoparcin to vancomycin (
27,
28). In general, the prevalence
of antibiotic-resistant enterococci in farm animals and their
meat is high (>60%) (
5). Moreover, Hayes et al. (
7), applying
the panel of antibiotics used in our study, reported that resistant
Enterococcus spp. commonly contaminate retail meat and their
resistance patterns reflect the use of antimicrobial agents
in the production of such products. The patterns of resistance
to antibiotics are similar between the work of Hayes et al.
(
7) and this study; however, the prevalence (or degree) of antibiotic
resistance in produce is lower than that found in retail meats.
In our study, resistance patterns differed among species of the genus Enterococcus. Overall, E. faecium was found to have a higher prevalence of resistance among the panel antibiotics, particularly tetracycline, ciprofloxacin, and nitrofurantoin, while E. faecalis isolates had a relatively lower prevalence of resistance to antibiotics of both clinical and agricultural relevance, excluding their inherent resistance to quinupristin-dalfopristin. A high percentage of the E. faecium isolates were found to be resistant to multiple drugs, a factor that contributes to the challenge of selecting therapeutic measures. While Enterococcus resistance to glycopeptides is among current clinical concerns, the absence of vancomycin-resistant enterococci in the present study suggests that raw produce does not contribute to the dissemination of vancomycin resistance.
The present study provides evidence that can be used in subsequent risk assessment exercises to elucidate the role of raw produce in the dissemination of antibiotic resistance to human populations. The findings indicate that while fresh produce items do harbor strains of enterococci that are resistant to many commonly used antibiotics, the resistance patterns are not significantly different from those reported for Enterococcus strains isolated from animal products such as poultry and pork. However, animal products are usually cooked prior to consumption, which should theoretically inactivate most of the native microflora, including enterococci, in those products. Fresh produce, in many instances, is consumed without a terminal heating step. Clearly, the role of food in the transmission of these strains is a question for which there is no definitive answer. However, data such as those presented here offer evidence that should be helpful in the identification of future study topics and initiatives aimed at reducing the public health burden of antibiotic-resistant pathogens.

ACKNOWLEDGMENTS
This study was funded by the U.S. Food and Drug Administration,
Center for Veterinary Medicine (FDA-CVM), through an agreement
with the USDA CSREES Special Grants Program, project 2001-39498-11444.
L. M. Johnston was supported by USDA CSREES Food Science National
Needs Fellowship 00-38420-8802.
We thank collaborators Juan Ansico and Marcy Martinez (Texas A&M University) for produce sample collection and Christine Moe (Emory University) and Deborah Moll (U.S. Centers for Disease Control and Prevention) for project coordination and review of the manuscript. We also gratefully acknowledge David Wagner of FDA-CVM for methodological guidance, as well as Barry Hooberman (FDA-CVM) and Craig Altier (NCSU College of Veterinary Medicine) for manuscript review.
The use of trade names in this paper does not imply endorsement by the North Carolina Agricultural Research Service nor criticism of similar ones not mentioned.

FOOTNOTES
* Corresponding author. Mailing address: Department of Food Science, North Carolina State University, Raleigh, NC 27695-7624 Phone: (919) 513-2074. Fax: (919) 515-7124. E-mail:
leeann_jaykus{at}ncsu.edu.

This is paper FSR 03-26 of the Journal Series of the Department of Food Science, North Carolina State University, Raleigh. 

REFERENCES
1 - Aarestrup, F. M., H. Hasman, L. B. Jensen, M. Moreno, I. A. Herrero, L. Domínguez, M. Finn, and A. Franklin. 2002. Antimicrobial resistance among enterococci from pigs in three European countries. Appl. Environ. Microbiol. 68:4127-4129.[Abstract/Free Full Text]
2 - Butaye, P., L. A. Devriese, and F. Haesebrouck. 2001. Differences in antibiotic resistance patterns of Enterococcus faecalis and Enterococcus faecium strains isolated from farm and pet animals. Antimicrob. Agents Chemother. 45:1374-1378.[Abstract/Free Full Text]
3 - Butaye, P., L. A. Devriese, and F. Haesebrouck. 2003. Antimicrobial growth promoters used in animal feed: effects of less well known antibiotics on gram-positive bacteria. Clin. Microbiol. Rev. 15:175-188.
4 - Chow, J. W. and D. M. Shlaes. 1999. Standard bacteria: Enterococcus species, p. 177-185. In V. L. Yu, T. C. Merigan, and S. L. Barriere (ed.), Antimicrobial therapy and vaccines. Williams & Wilkins, Baltimore, Md.
5 - Giraffa, G. 2002. Enterococci from foods. FEMS Microbiol. Rev. 744:1-9.[CrossRef]
6 - Hamilton-Miller, J. M. T., and S. Shah. 2001. Identity and antibiotic susceptibility of enterobacterial flora of salad vegetables. Int. J. Antimicrob. Agents 18:81-83.[CrossRef][Medline]
7 - Hayes, J. R., L. L. English, P. J. Carter, T. Proescholdt, K. Y. Lee, D. D. Wagner, and D. G. White. 2003. Prevalence and antimicrobial resistance of Enterococcus species isolated from retail meats. Appl. Environ. Microbiol. 69:7153-7160.[Abstract/Free Full Text]
8 - Jones, R. N., C. H. Ballow, D. J. Biedenbach, J. A. Deinhart, and J. J. Schentag. 1998. Antimicrobial activity of quinupristin-dalfopristin (RP 59500, Synercid) tested against over 28,000 recent clinical isolates from 200 medical centers in the United States and Canada. Diagn. Microbiol. Infect. Dis. 31:437-451.[CrossRef][Medline]
9 - Ke, D., F. J. Picard, F. Martineau, C. Ménard, P. H. Roy, M. Ouellette, and M. G. Bergeron. 1999. Development of a PCR assay for rapid detection of enterococci. J. Clin. Microbiol. 37:3497-3503.[Abstract/Free Full Text]
10 - Kühn, I., A. Iversen, L. G. Burman, B. Olsson-Liljequist, A. Franklin, M. Finn, F. Aarestrup, A. M. Seyfarth, A. R. Blanch, H. Taylor, J. Caplin, M. A. Moreno, L. Dominguez, and R. Möllby 2000. Epidemiology and ecology of enterococci, with special reference to antibiotic resistance strains in animals, humans, and the environment. Example of an ongoing project within the European research programme. Int. J. Antimicrob. Agents 14:337-342.[CrossRef][Medline]
11 - Linden, P. K., and C. B. Miller. 1999. Vancomycin-resistant enterococci: the clinical effect of a common nosocomial pathogen. Diagn. Microbiol. Infect. Dis. 33:113-120.[CrossRef][Medline]
12 - Miller Publishing Co. 2000. Feed additive compendium. Miller Publishing Co., Minnetonka, Minn.
13 - Millichap, J., R. A. Ristow, G. A. Noskin, and L. R. Peterson. 1996. Selection of Enterococcus faecium strains with stable and unstable resistance to the streptogramin RP 59500 using stepwise in vitro exposure. Diagn. Microbiol. Infect. Dis. 25:15-20.[CrossRef][Medline]
14 - Mundy, L. M., D. F. Sahm, and M. Gilmore. 2000. Relationships between enterococcal virulence and antimicrobial resistance. Clin. Microbiol. Rev. 13:513-522.[Abstract/Free Full Text]
15 - National Committee on Clinical Laboratory Standards. 2001. Performance standards for antimicrobial susceptibility testing; 12th informational supplement. NCCLS document M100-S12. National Committee on Clinical Laboratory Standards, Wayne Pa.
16 - National Committee on Clinical Laboratory Standards. 2000. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, 5th ed. NCCLS document M7-A5. National Committee on Clinical Laboratory Standards, Wayne, Pa.
17 - Nwosu, V. C. 2001. Antibiotic resistance with particular reference to soil microorganisms. Res. Microbiol. 152:421-430.[Medline]
18 - Österblad, M., O. Pensala, M. Peterzéns, H. Heleniusc, and P. Huovinen. 1999. Antimicrobial susceptibility of Enterobacteriaceae isolated from vegetables. J. Antimicrob. Chemother. 43:503-509.[Abstract/Free Full Text]
19 - Prazak, A. M., E. A. Murano, I. Mercado, and G. R. Acuff. 2002. Antimicrobial resistance of Listeria monocytogenes isolated from various cabbage farms and packing sheds in Texas. J. Food Prot. 65:1796-1799.[Medline]
20 - Preston, S. L., and G. L. Drusano. 1999. Antibacterial agents: penicillins, p. 850-875. In V. L. Yu, T. C. Merigan, and S. L. Barriere (ed.), Antimicrobial therapy and vaccines. Williams & Wilkins, Baltimore, Md.
21 - Sengeløv, G., A. Yvonne, A., B. Halling-Sørenson, S. Baloda, J. S. Andersen, and L. B. Jensen. 2002. Bacterial antibiotic resistance levels in Danish farmland as a result of treatment with pig manure slurry. Environ. Int. 953:1-9.[CrossRef]
22 - Schouten, M. A., A. Voss, and J. A. Hoogkamp-Korstanje. Antimicrobial susceptibility patterns of enterococci causing infections in Europe. Antimicrob. Agents Chemother. 43:2542-2546.
23 - Simjee, S., D. G. White, J. Meng, D. D. Wagner, S. Qaiyumi, S. Zhao, J. R. Hayes, and P. F. McDermott. 2002. Prevalence of streptogramin resistance among Enterococcus isolates recovered from retail meats in the Greater Washington DC area. J. Antimicrob. Chemother. 50:877-882.[Abstract/Free Full Text]
24 - Sørensen, T. L., M. Blom, D. L. Monnet, N. Frimodt-Møller, R. L. Poulsen, and F. Espersen. 2001. Transient intestinal carriage after ingestion of antibiotic-resistant Enterococcus faecium from chicken and pork. N. Engl. J. Med. 345:1161-1166.[Abstract/Free Full Text]
25 - Stein, G. E., and H. Havlichek, Jr. 1999. Antibacterial agents: nitrofurantoin, p. 875-900. In V. L. Yu, T. C. Merigan, and S. L. Barriere (ed.), Antimicrobial therapy and vaccines. Williams & Wilkins, Baltimore, Md.
26 - Thal, L. A., J. W. Chow, R. Mahayni, H. Bonilla, M. B. Perri, S. A. Donabedian, J. Silverman, S. Taber, and M. J. Zervos. 1995. Characterization of antimicrobial resistance in enterococci of animal origin. Antimicrob. Agents Chemother. 39:2112-2115.[Abstract/Free Full Text]
27 - van den Bogaard, A. E., and E. E. Stobberingh 2000. Epidemiology of resistance to antibiotics Links between animals and humans. Int. J. Antimicrob. Agents. 14:327-335.[CrossRef][Medline]
28 - Witte, W. 2000. Ecological impact of antibiotic use in animals on different complex microflora: environment. Int. J. Antimicrob. Agents 14:321-325.[CrossRef][Medline]
29 - Yu, V. L, T. C. Merigan, and S. L. Barriere (ed.). 1999. Antimicrobial therapy and vaccines. Williams & Wilkins, Baltimore, Md.
Applied and Environmental Microbiology, May 2004, p. 3133-3137, Vol. 70, No. 5
0099-2240/04/$08.00+0 DOI: 10.1128/AEM.70.5.3133-3137.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Macovei, L., Zurek, L.
(2007). Influx of Enterococci and Associated Antibiotic Resistance and Virulence Genes from Ready-To-Eat Food to the Human Digestive Tract. Appl. Environ. Microbiol.
73: 6740-6747
[Abstract]
[Full Text]
-
Macovei, L., Zurek, L.
(2006). Ecology of antibiotic resistance genes: characterization of enterococci from houseflies collected in food settings.. Appl. Environ. Microbiol.
72: 4028-4035
[Abstract]
[Full Text]
-
Yu, Z., Michel, F. C. Jr, Hansen, G., Wittum, T., Morrison, M.
(2005). Development and Application of Real-Time PCR Assays for Quantification of Genes Encoding Tetracycline Resistance. Appl. Environ. Microbiol.
71: 6926-6933
[Abstract]
[Full Text]