This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fujishiro, T.
Right arrow Articles by Hagiwara, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fujishiro, T.
Right arrow Articles by Hagiwara, H.
Agricola
Right arrow Articles by Fujishiro, T.
Right arrow Articles by Hagiwara, H.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, June 2004, p. 3338-3345, Vol. 70, No. 6
0099-2240/04/$08.00+0     DOI: 10.1128/AEM.70.6.3338-3345.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Establishment of a Pure Culture of the Hitherto Uncultured Unicellular Cyanobacterium Aphanothece sacrum, and Phylogenetic Position of the Organism

Tsuneo Fujishiro,1* Takahira Ogawa,2 Masayoshi Matsuoka,2 Kazuhiro Nagahama,2 Yasunobu Takeshima,1 and Hideaki Hagiwara1

Hagiwara Institute of Health, Kasai, Hyogo 679-0105,1 Department of Applied Microbial Technology, Faculty of Engineering, Sojo University, Kumamoto, Kumamoto 860-0082, Japan2

Received 2 December 2003/ Accepted 29 February 2004


arrow
ABSTRACT
 
Aphanothece sacrum, an edible freshwater unicellular cyanobacterium, was isolated by using novel synthetic media (designated AST and AST-5xNP). The media were designed on the basis of the ratio of inorganic elements contained in A. sacrum cells cultured in a natural pond. The isolated strain exhibits unicellular rod-shaped cells ~6 µm in length that are scattered in an exopolysaccharide matrix, a feature similar to that of natural A. sacrum. DNA analysis of the isolated strain revealed that it carried two ferredoxin genes whose deduced amino acid sequences were almost identical to previously published sequences of ferredoxins from natural A. sacrum. Analysis of the 16S rRNA gene and ferredoxin genes revealed that A. sacrum occupies a phylogenetically unique position among the cyanobacteria.


arrow
INTRODUCTION
 
The unicellular cyanobacterium Aphanothece sacrum (vernacular name, Suizenji-nori) is an edible freshwater cyanobacterium that is endemic to Japan (25). It is characterized by the formation of irregularly developed strata, which are typical for this species and can reach >10 cm in length. Y. Okada, who changed the classification of this cyanobacterium to the genus Aphanothece, reported that the cyanobacterium was first described by Suringar in 1872 (33a) as Phylloderma sacrum. Records on the consumption of A. sacrum as a food date back to the 18th century, thus confirming its safety for human health. Analysis of the mineral content of dry A. sacrum revealed that the Ca, Fe, Cu, and Mn contents are higher than those of other edible seaweeds, thus indicating the nutritional value of A. sacrum (40). At present, A. sacrum is cultivated for use as a food in a pure spring water pond in Amagi, Fukuoka Prefecture (south Japan). Although this rare freshwater cyanobacterium is legally protected at its native habitat in Kumamoto Prefecture, it is in danger of becoming extinct due to water pollution. So far, all attempts to isolate A. sacrum have been unsuccessful, and therefore research on its growth conditions could not be performed.

A series of research studies by Hase et al. on ferredoxins (Fds) that were extracted from Suizenji-nori revealed that A. sacrum contains two types of Fds (7, 9), namely, green-algal and higher-plant Fd (plant-type Fd; Thr-[gap]-Pro-Asp/Glu/Ser-Gly-[gap]-Glu is a typical sequence around positions 9 to 13) and red-algal and cyanobacterial Fd (cyanobacterial-type Fd; Asn/Ser-Asp/Glu-Ala/Glu-Glu-Gly-Ile/Leu/Thr-Asn/Asp is a typical sequence around the corresponding positions). Both of these Fds are constitutively expressed at the same ratio throughout the year (cyanobacterial-type Fd comprises ~20% of total Fd). While there have been various reports that describe unicellular cyanobacteria containing either plant-type or cyanobacterial-type Fd (17, 18), Synechococcus sp. strain PCC 6301 has been reported to contain different types of Fds (4, 35). Recent determination of the genomes of a variety of other unicellular cyanobacteria revealed the existence of several types of Fd and Fd-like genes. In Synechocystis sp. strain PCC 6803 and Thermosynechococcus elongatus BP-1, both plant-type Fd (Fd I)-like and cyanobacterial-type Fd (Fd II)-like genes were found. Some filamentous cyanobacteria express different types of Fds in response to their environments (20), although there have been no reports of plant-type Fds in these species. These findings indicate that the existence of different types of Fds is not a unique characteristic of A. sacrum. However, the constitutive expression of these two types of Fds and the fact that both plant-type and cyanobacterial-type Fds contain an extra residue within their amino acid sequences are features that so far have been observed only in A. sacrum (9). Furthermore, these features allow the identification of isolated A. sacrum strains by comparing the sequences deduced from the Fd I and II genes with those of the respective proteins.

Previously, we isolated a unicellular cyanobacterium from Suizenji-nori by using BG-11 medium, which is widely used for the cultivation of cyanobacteria, only to find later that the isolated cyanobacterium was not A. sacrum. Until now, the establishment of pure cultures of A. sacrum has been unsuccessful, probably due to the special nutritional requirements of the cyanobacterium, which does not grow in conventional media for cyanobacteria, such as BG-11, MDM (36), MA (10), and CT (37). Furthermore, its growth may have been hindered by bacterial or algal contaminants that grow faster than A. sacrum.

We speculated that the composition of the inorganic elements found in dry A. sacrum may reflect its specific nutritional requirements. Therefore, in this work, we designed novel synthetic media (AST and AST-5xNP) that are suitable for the growth of A. sacrum. Using these media, we isolated a cyanobacterium and identified it by its appearance and analysis of its Fd genes as A. sacrum. Furthermore, we describe the phylogenetic position of A. sacrum by analyzing the partial nucleotide sequence of its 16S rRNA gene (16S ribosomal DNA [rDNA]).


arrow
MATERIALS AND METHODS
 
Isolation of A. sacrum.
Fresh strata of Suizenji-nori were provided by Endo-Kanagawa-Do Co., Amagi, Fukuoka Prefecture, Japan. Approximately 1.5 g of strata was thoroughly washed with sterile water, homogenized in 100 ml of sterile water with an Ace AM-9 homogenizer (Nihonseiki Kaisha), and passed through a G1 glass filter (pore size, 100 to 120 µm). A number of test tubes each containing 5 ml of AST medium (Table 1) were inoculated with 10 µl of cell suspension diluted with AST medium to one cell per tube on average (24) and incubated at 25°C under continuous illumination by cool white fluorescent light (photon flux density, 60.5 µmol m–2 s–1) by static culture. Four to 5 g of aggregates obtained by the aforementioned procedure were homogenized in 30 ml of AST-5xNP medium. The homogenate was passed through a G2 glass filter (pore size, 40 to 50 µm), transferred into a plastic screw-cap tube (50 ml), and centrifuged at 1,000 x g for 10 min. The pellet was transferred into microtubes (2 ml), sonicated with a Sonicator W-220 (Heat Systems-Ultrasonics), and centrifuged at 14,000 x g for 10 min. The pellet, which contained only cells without an exopolysaccharide matrix, was collected, suspended in AST-5xNP medium, loaded onto an OptiPrep (Axis-Shield) density gradient solution (40 to 45% iodixanol) that contained AST-5xNP medium, and ultracentrifuged at 112,700 x g for 2 h (70P-72; SRP28SA rotor; Hitachi). The green layer close to the center of the tube was recovered and transferred into microtubes. To the recovered solution, AST-5xNP medium equal to a ninefold volume was added, followed by centrifugation. The cell pellet was suspended in an appropriate amount of AST-5xNP medium and spread onto AST-5xNP-agarose plates (0.6% [wt/vol] agarose) at 160, 1,600, and 16,000 cells per plate, followed by incubation at 25 to 27°C under continuous illumination by cool white fluorescent light (photon flux density, 24.2 to 36.3 µmol m–2 s–1). The colonies obtained were stained with the bacterium-staining fluorescent dye LIVE/DEAD BacLight Bacterial Viability kit (Molecular Probes) according to the manufacturer's instructions. Stained colonies were observed under a fluorescence microscope, and colonies with no sign of contaminants (observable as small green fluorescent spots) in their exopolysaccharide matrix were selected. Portions of the aggregates were cultivated for 1 week in organic compounds (0.1% polypeptone and 0.1% yeast extract) containing AST-5xNP medium and other bacterium-free check media using AST-5xNP medium as the stock medium, namely, B-III medium (stock medium containing 0.3% beef extract and 0.5% peptone), B-V medium (stock medium containing 0.05% sodium acetate, 0.05% glucose, 0.05% tryptone, and 0.03% yeast extract), or YT medium (stock medium containing 0.1% yeast extract and 0.2% tryptone) (11, 12). Cultivation was performed under continuous illumination by cool white fluorescent light (photon flux density, 24.2 to 36.3 µmol m–2 s–1) at 25 to 27°C with shaking (60 rpm).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Composition of AST medium

Sequencing of Fd genes of the isolated cyanobacterium.
The DNA of the isolated cyanobacterium was prepared according to the method of R. D. Porter (29). We designed four degenerate primers corresponding to the N- and C-terminal amino acid sequences of the two Fds of natural A. sacrum (Fd I [7] and Fd II [9]): FdI-mix 1 RTGGCNWSNTAYAARGTNACNYTNAA and FdI-mix 2 YYARTANARNGCYTCYTCYTTRTGNGT for Fd I and FdII-mix 1 RTGGCNACNTAYAARGTNACNYTNAT and FdII-mix 2 YYANARNACYTCNSWYTCYTGRTG for Fd II (polymorphic nucleotides of primers are indicated by the corresponding degenerate symbols: N = A, C, G, or T; R = A or G; S = C or G; W = A or T; and Y = C or T). A start codon was appended to N-terminal sequences (mix 1), and a stop codon was appended to C-terminal sequences (mix 2). The primers were synthesized by Funakoshi (Tokyo, Japan) and Japan Bio Service (Saitama, Japan). The reaction mixture (50 µl) for amplifying Fd I and Fd II DNA fragments of A. sacrum contained ~1 µg of template DNA, 1.25 U of TaKaRa Taq DNA polymerase, 1x PCR buffer (Invitrogen), 0.5 mM concentrations of each deoxynucleoside triphosphate (dNTP) mix (Invitrogen), and 0.04 mM concentrations of both mix 1 and mix 2 primers. The PCR protocol consisted of 30 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min. The PCR products were concentrated with SUPREC-02 (TaKaRa) and subjected to 2% agarose gel electrophoresis. The DNA fragments were stained with ethidium bromide, and ~0.3-kb fragments were excised and recovered from the gel with SUPREC-01 (TaKaRa). The recovered DNA fragments were cloned by using a TA cloning kit (Invitrogen). Blue-white selections were performed by using INV{alpha}F' One Shot Competent Cells (Invitrogen).

Several white colonies were picked up and suspended in 10 µl of lysis buffer (20 mM Tris-HCl, pH 8.0, 50 mM KCl, 0.1% Tween 20). After heat treatment at 95°C for 5 min, 5-µl aliquots of each solution were used as templates for PCR. The reaction mixture (50 µl) contained 5 µl of template DNA, 1.25 U of TaKaRa Taq, 1x PCR buffer (TaKaRa), 0.2 mM concentrations of each dNTP mix (TaKaRa), and 200 nM concentrations of both primers (GCTTCCGGCTCGTATGTTGTGTG and AAAGGGGGATGTGCTGCAAGGCG; the sequences are based on the vector). The PCR protocol consisted of 30 cycles of 96°C for 30 s, 60°C for 1 min, and 72°C for 2 min, and an extension step at 72°C for 7 min. Cycle-sequencing reactions were performed by using a Dye Primer Cycle Sequencing Core kit (Applied Biosystems) according to the manufacturer's instructions using PCR products as templates with the following modifications: the volumes of reaction mixtures G and T were half of the amounts described in the manufacturer's instructions. The PCR protocol consisted of an initial denaturation step at 95°C for 3 min; 20 cycles of 95°C for 30 s, 55°C for 1 min, and 72°C for 1 min; and 20 cycles of 95°C for 30 s and 72°C for 1 min. The sequencing was carried out on a DSQ-1 sequencer (Shimazu).

Sequencing of the 16S rDNA of A. sacrum.
The 16S rDNA fragments were amplified by using the DNA of the isolated strain as a template and universal primers for amplification of the 16S rDNA (16S-27f, AGAGTTTGATCMTGGCTCAG; 16S-530f, GTGCCAGCMGCCGCGG; 16S-1100r, GGGTTGCGCTCGTTG; and 16S-1525r, AAGGAGGTGWTCCARCC [polymorphic nucleotides of primers are indicated by the corresponding degenerated symbols: M = A or C; R = A or G; and W = A or T]) (16, 38). The reaction mixture (50 µl) contained either 5 µl or 1 µg of DNA as a template, 1.25 U of TaKaRa Taq, 1x PCR buffer (TaKaRa), 0.2 mM concentrations of each dNTP mix (TaKaRa), and 200 nM concentrations of forward and reverse primers (16S-27f and 16S-1100r, 16S-530f and 16S-1525r, and 16S-27f and 16S-1525r). The PCR protocol consisted of an initial denaturation step at 94°C for 1 min; 30 cycles of 94°C for 1 min, 63°C for 1 min, and 72°C for 1.5 min; and an extension step at 72°C for 2 min (33). Amplified DNA fragments (two ~1-kb fragments and a 1.5-kb fragment) were TA cloned and sequenced as described above. The sequence was repeatedly checked by electrophoresis using a gel containing 30% formamide or by amplifying the fragments by using the primer sets 16S-900f (TCGATGCAACGCGAAGAACC) plus 23S-1979r (CTCTGTGTGCCTAGGTATCC) (13) and 16S-1426f (GGGGTGAAGTCGTAACAAGG) plus 23S-1871r (CTGGACTACTAATAGGGCCC) and then sequenced as described above.

Analyses and alignments of amino acid sequences of Fds.
The alignment of the deduced amino acid sequences of the Fd genes with plant-type Fds (Fig. 1) and cyanobacterial-type Fds (Fig. 2) was performed by using GENETYX-MAC version 12.2.0 (GENETYX Co., Tokyo, Japan).



View larger version (45K):
[in this window]
[in a new window]
 
FIG. 1. Analysis of the Fd I gene of the isolated strain; amino acid sequence alignment of Fd I. (A) Alga isolated in this work (AB116656); (B) A. sacrum Fd I (P00250); (C) Synechococcus elongatus Fd I (P00256); (D) Synechococcus lividus (P00255); (E) Synechococcus sp. strain PCC 7002 Fd I (P31965); (F) Synechocystis sp. strain PCC 6714 (P00243); (G) Synechocystis sp. strain PCC 6803 (P27320); (H) Microcystis aeruginosa Fd I (partial) (3); (I) M. aeruginosa Fd II (partial) (3); (J) Chlorella fusca plastid (green alga) (P56408); (K) Marchantia polymorpha plastid (liverwort) (P09735); (L) Oryza sativa plastid (higher plant) (P11051); (M) Arabidopsis thaliana plastid (higher plant) (P16972) (the numbers in parentheses are amino acid sequence accession numbers). The underlined areas represent PCR primer regions, the dashes represent gaps, the dots represent amino acids identical to those in sequence A, and the asterisks represent conserved amino acids of all aligned sequences. The boxed region shows that A. sacrum Fd I and some other unicellular cyanobacterial Fds have the characteristic sequence motif of green-algal and higher-plant Fd.



View larger version (50K):
[in this window]
[in a new window]
 
FIG. 2. Analysis of the Fd II gene of the isolated strain; amino acid sequence alignment of Fd II. (A) Alga isolated in this work (AB116657); (B) A. sacrum Fd II (P00251); (C) A. halophytica (P15788); (D) Cyanothece sp. strain PCC 8801 (AAB66327); (E) Synechococcus sp. strain PCC 6301 Fd I (P06517); (F) Synechococcus sp. strain PCC 6307 (JA0098); (G) Anabaena sp. strain PCC 7120 Fd I (P06543); (H) Nostoc muscorum Fd (P00253); (I) Plectonema boryanum Fd I (Q51577); (J) Spirulina platensis Fd (P00246) (K) Mastigocladus laminosus strain PCC 7605 (P00248); (L) Cyanophora paradoxa plastid (colorless flagellate alga) (P17007); (M) Cyanidium caldarium plastid (red alga) (Q9TLW0) (the numbers in parentheses are amino acid sequence accession numbers). The underlined area, dashes, dots, and asterisks are as described in the legend to Fig. 1. The boxed region shows that A. sacrum Fd II and all aligned Fds have the characteristic sequence motif of colorless-flagellate-algal and red-algal Fd.

Phylogenetic analysis of 16S rDNA.
The 16S rDNA of A. sacrum was analyzed by the FASTA (27) homology search service of the DNA Data Bank of Japan (DDBJ) (http://www.ddbj.nig.ac.jp/). A phylogenetic tree was reconstructed with the 16S rDNA sequence data (the fragments spanning from Escherichia coli nucleotide positions 360 to 1326) (19) for 41 cyanobacteria (the strain isolated in this work, 5 species whose 16S rDNAs showed the highest scores with that of the isolated strain when analyzed by the FASTA search, 6 Aphanothece species, and 29 cyanobacteria presented at http://evolution.uoregon.edu/mwood.htm [39] without Oscillatoria amphigranulata NZ-Concert) and three outgroup taxa (Bacillus subtilis, E. coli, and Aquifex pyrophilus). A neighbor-joining tree was inferred by using Expansion of CLUSTALW (version 1.81) by DDBJ (http://www.ddbj.nig.ac.jp/E-mail/homology.html). The phylogenetic tree was drawn by using TreeViewPPC version 1.6.6 (26) rooted with A. pyrophilus. Alignment of the 16S rDNA of the isolated strain with AB094350 was performed by using GENETYX-MAC version 12.2.0.

Nucleotide sequence accession numbers.
The Fd I, Fd II, and 16S rDNA sequence data obtained for the strain isolated in this work have been deposited in the DDBJ database under accession numbers AB116656 (Fd I), AB116657 (Fd II), and AB116658 (16S rDNA).


arrow
RESULTS
 
Composition of the medium used for A. sacrum cultivation.
The Ca content of the ashes of Suizenji-nori strata (1,680 mg/100 g of dry strata) (40) was determined and found to be higher than the content of other inorganic elements. Furthermore, the Ca concentration of the Kogane river in Amagi (20 mg/liter; H. Endo, personal communication), where Suizenji-nori is cultured in its natural environment, is also higher than that of other inorganic elements. Therefore, we presumed that the weight ratio of inorganic elements (Ca, Cu, Fe, Mg, Mn, and Zn) of A. sacrum may reflect its nutritional requirements. In accordance with the Ca concentration of the Kogane river, the Ca concentration of the medium was set at 20 mg/liter. The concentrations of Cu, Fe, Mg, Mn, and Zn were set based on the ratio of these inorganic elements (Ca-Cu-Fe-Mg-Mn-Zn = 1:0.00046:0.17:0.32:0.060:0.0013) in dry A. sacrum as reported by Yasui et al. (40). For concentrations of trace elements necessary for cyanobacterial cultivation, such as B, Co, Ni, Se, and Mo, we referred to other media for cyanobacteria (2, 30). Based on the nitrate and phosphate concentrations of Lake Ezu (nitrate, 76.68 µg/liter; phosphate, 35.48 µg/liter [T. Iwashita, personal communication]), the natural habitat of A. sacrum, the ratio of nitrate to phosphate was set at 2:1. Furthermore, the concentrations of Cu, Mg, Fe, nitrate, and phosphate were modified, depending on the growth of A. sacrum. As a result, we designed a novel synthetic medium (AST) (Table 1).

Isolation of A. sacrum.
Microscopic observation revealed that the strata of Suizenji-nori were contaminated with various kinds of algal cells (25). To eliminate these algal contaminants, the strata were homogenized, passed through a glass filter, and inoculated into test tubes (one cell per test tube on average). As a result we obtained aggregates without algal contaminants in ~70% of 2,100 test tubes.

These aggregates were cultivated in AST medium containing fivefold concentrations of nitrate and phosphate (AST-5xNP medium), as this medium was found to be suitable for their cultivation. However, fluorescence microscopy of these aggregates that were stained with fluorescent dye revealed the presence of bacterial contaminants in the exopolysaccharide matrix. Therefore, cells without the exopolysaccharide matrix were prepared (see Materials and Methods), and a less contaminated fraction was obtained and spread on agarose plates. After cultivation for 3 weeks, 42 colonies formed on a 16,000-cell plate, while no colonies were observed on the other plates.

In order to confirm that the exopolysaccharide matrix was free from bacterial contaminants, these colonies were stained with fluorescent dye and observed under a fluorescence microscope. Finally, three colonies with no bacteria in the exopolysaccharide matrix were obtained. These colonies were cultivated in bacterium-free check media, and only one clone was found to be free from heterotrophic bacteria.

Identification of A. sacrum.
The isolated cyanobacterium was identified on the basis of its morphological traits and by investigation of the presence of the Fd genes of natural A. sacrum, as at present there are no other known characteristics, genes, etc., which can be used to identify the cyanobacterium.

The cyanobacterium obtained had the same characteristics as fresh strata of Suizenji-nori, i.e., a unicellular rod-shaped cyanobacterium ~6 µm in length, and were scattered in an exopolysaccharide matrix (Fig. 3).



View larger version (55K):
[in this window]
[in a new window]
 
FIG. 3. Micrographs of natural A. sacrum (A) and the isolated strain (B). The exopolysaccharides of the isolated strain were visualized by staining them with methylene blue.

In order to investigate the presence of the Fd I and Fd II genes of A. sacrum in the isolated cyanobacterium, we designed primers specific for the amino acid sequences of the two Fds and performed PCR. PCR amplification yielded ~0.3-kb DNA fragments. These fragments were cloned, and the nucleotide sequences were determined. Each deduced amino acid sequence was aligned with plant-type or cyanobacterial-type Fd sequences of cyanobacteria and plastids (Fig. 1 and 2). One of the deduced amino acid sequences, except for three residues (Gln-31, Gln-59, and Ser-60), corresponded to the Fd I amino acid sequence of A. sacrum (Fig. 1). The other deduced sequence completely corresponded to Fd II (Fig. 2). These findings confirmed that the isolated cyanobacterium carried the Fd I and Fd II genes of A. sacrum. Accordingly, we concluded that the isolated cyanobacterium was A. sacrum.

Analysis of 16S rDNA of A. sacrum.
We analyzed the partial nucleotide sequence of the 16S rDNA and inferred a phylogenetic tree in order to clarify the phylogenetic position of A. sacrum among cyanobacteria (Fig. 4). While A. sacrum and A. sacrum (Sakamoto) (AB119259) form a group with the unicellular cyanobacterial species Cyanothece, Gloeothece, and Aphanothece gelatinosa, a high bootstrap value (>700 of a count of 1,000) supporting the formation of a clade with the isolated strain was obtained only for Cyanothece sp. strain PCC 8801 (AF296873). The other Aphanothece species (Cyanothece sp. strain PCC 7418 is also called Aphanothece halophytica) form a different clade within a group comprising unicellular cyanobacteria (Chroococcidiopsis sp. strain PCC 7203, Prochloron sp., and Pleurocapsa sp. strain PCC 7516) and filamentous cyanobacteria (Microcoleus sp. strain PCC 7420 and Trichodesmium sp. strain NIBB 1067). A. sacrum (Horiguchi et al.) (AB094350) belongs to a group comprising unicellular cyanobacteria (mainly Synechococcus and Prochlorococcus) which is quite distinct from A. sacrum isolated in this work. AB094350 and AB119259 are 16S rDNA sequences derived from natural A. sacrum and were 89.3 (335 bp) (Fig. 5) and 100.0% (1,443 of 1,445 bp overlapped), respectively, identical to the 16S rDNA of the isolated strain.



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 4. Neighbor-joining phylogenetic tree of the cyanobacteria inferred from ca. 950 bp of the 16S rDNA. The GenBank accession numbers are in square brackets. A. sacrum (boldface) is the strain isolated in this work. The sequences of A. sacrum (Sakamoto) (AB119259) and A. sacrum (Horiguchi et al.) (AB094350) are derived from natural A. sacrum. A value at a node indicates the bootstrap value of 1,000 replicates.



View larger version (38K):
[in this window]
[in a new window]
 
FIG. 5. Nucleotide sequence alignment of the 16S rDNAs of the isolated strain (A) and AB094350 (B). The dots and asterisks are as described in the legend to Fig. 1.


arrow
DISCUSSION
 
We considered that one reason why the isolation and establishment of a pure culture of A. sacrum have not been successful may be that conventional media for cyanobacteria do not meet the nutritional requirements of the cyanobacterium. Therefore, we prepared new media (AST medium and AST-5xNP medium) for the isolation and establishment of pure cultures of A. sacrum. The ratio of Ca contained in the ashes of Suizenji-nori strata (40), as well as the Ca concentration of the pond in Amagi in which this cyanobacterium is cultivated, are higher than those of other inorganic elements. Therefore, we presumed that the weight ratio of inorganic elements (Ca, Cu, Fe, Mg, Mn, and Zn) in Suizenji-nori may reflect the nutritional requirements of A. sacrum. We designed a medium based on the weight ratio of inorganic elements of dry strata of Suizenji-nori (40); analysis of Kogane river water, in which A. sacrum is cultivated for use as a food; analysis of Lake Ezu water, the natural habitat of A. sacrum; and the compositions of other media for cyanobacteria (2, 30).

By using AST medium, we obtained a high percentage of aggregates which were considered to be A. sacrum and were free of algal contaminants. Cultivation of the isolated strain in AST-5xNP medium or conventional media, such as BG-11, CT, MA, or MDM, showed that A. sacrum grows in AST-5xNP and CT but not in other conventional media (data not shown). The media in which favorable growth of A. sacrum was observed commonly had relatively high Ca concentrations compared with other components and weight ratios of inorganic elements that corresponded to the weight ratio contained in A. sacrum.

These results confirmed our presumption and even suggested that cyanobacteria and algae, which due to their special nutritional requirements cannot be isolated by the use of conventional media, may be isolated by the use of media designed based on the weight ratio of inorganic elements of natural organisms.

The appearance of the isolated cyanobacterium was indistinguishable from that of Suizenji-nori (Fig. 3). Furthermore, the isolated cyanobacterium was found to have two Fd genes. The partial amino acid sequence deduced from one of these genes, except for three amino acid residues, corresponded to the Fd I sequence of natural A. sacrum (Fig. 1), and the sequence deduced from the other gene completely corresponded to that of Fd II (Fig. 2). Therefore, the isolated cyanobacterium was identified as A. sacrum and was deposited at the International Patent Organism Depository (Ibaraki, Japan) (http://unit.aist.go.jp/ipod/index_e.html) (accession number, FERM BP-7315; strain, KuX 3).

Three residues of the amino acid sequence deduced from the Fd I gene differed from the sequence of natural A. sacrum. Regarding Ser-60, it is likely that Hase et al. overlooked this residue, as it is highly conserved in algal, higher-plant, and other cyanobacterial Fds (Fig. 1). Furthermore, prior to the work of Hase et al., in which Fd I was found to contain five Ser residues (7), Wada et al. reported that Fd I contained six Ser residues (34). The deduced amino acid residues Gln-31 and Gln-59 were determined to be Glu by Hase et al. (7). The reasons for the differences regarding these two residues are unknown, but it may be due to deamination. These differences in the Fd I amino acid sequence may be clarified by analysis of the mRNA and repeated analysis of Fd I.

Research on the Fds of natural A. sacrum revealed that A. sacrum expresses two types of Fds: Fd I is plant-type Fd, as indicated in Fig. 1, and Fd II is cyanobacterial-type Fd, as indicated in Fig. 2 (9). Both Fds are expressed at the same ratio throughout the year (8). The sequence differences between these two Fds were large enough for them to judged to be independent isozymes rather than allelic variants or polymorphic proteins (9). As a lateral transfer of genes that are related to photosynthesis has been found in cyanobacteria (31) and findings in protists support the lateral-transfer hypothesis of Fd-encoding genes (23), it is also possible that a lateral transfer of either Fd gene took place in A. sacrum. It was reported that some unicellular cyanobacteria contain plant-type Fd (1, 3, 6). Moreover, filamentous cyanobacterial contaminants were observed in natural A. sacrum (25). Therefore, it is possible that the cyanobacterial-type Fd (Fd II) gene was transferred into A. sacrum from filamentous cyanobacteria. However, the two Fd genes of A. sacrum showed similar codon usage frequencies and GC contents within the analyzed regions (data not shown). Furthermore, while there are three residues (Pro-Ala-Pro in Fd I and Ala-Ala-Pro in Fd II) between Gly-54 and Asp-58 of Fd I (these positions correspond to Gly-56 and Asn-60 of Fd II), there are only two residues in plant, algal, and cyanobacterial Fds (many of them Glu/Ser/Thr-Val). Therefore, these two Fd genes are considered to have coexisted for a long time during the evolution of the cyanobacterium.

The only unicellular cyanobacterium other than A. sacrum for which two types of Fds have been reported is Synechococcus sp. strain PCC 6301, which comprises a cyanobacterial-type Fd sequence (35) and an Fd sequence that is neither plant nor cyanobacterial type (4). Recent determinations of the genomes of a number of other unicellular cyanobacteria have revealed the existence of several types of Fd and Fd-like genes (15, 21, 22). In Synechocystis sp. strain PCC 6803 and T. elongatus BP-1, both plant-type and cyanobacterial-type Fd-like genes were found. Furthermore, various filamentous cyanobacteria have been found to express different types of Fds (20), although none of these cyanobacteria contained plant-type Fd, including Anabaena sp. strain PCC 7120, whose genome sequence was determined recently) (14). Thus, the existence of different types of Fd genes is not necessarily a unique characteristic. However, the expression of the Fd II gene of Synechococcus sp. strain PCC 6301 and the cyanobacterial-type Fd-like gene of Synechocystis sp. PCC 6803, which is expressed only under low-light conditions, was only confirmed based on the presence of the corresponding mRNA (4, 28). Filamentous cyanobacteria express different types of Fds in response to the environment (20). Thus, the constitutive expression of both Fds at the same ratio throughout the year under natural conditions (confirmed by protein analysis) is a unique characteristic of A. sacrum.

In this work, we determined the partial nucleotide sequence of the 16S rDNA of A. sacrum in order to investigate its phylogenetic position (Fig. 4). While the phylogenetic tree revealed that A. sacrum isolated in this work belongs to a group of various Cyanothece and Gloeothece species which also includes A. gelatinosa, within this group, a high bootstrap value (>700 of a count of 1,000) supporting the formation of a clade was obtained only with Cyanothece sp. strain PCC 8801 (Fig. 4). Most other Aphanothece species form a clade within a group comprising unicellular and filamentous cyanobacteria which differs from that of A. sacrum isolated in this work. These findings and analyses of Fd sequences indicate that A. sacrum is a phylogenetically unique species among cyanobacteria.

The two sequences were already deposited and described by Horiguchi et al. (AB094350) and Sakamoto (AB119259) as partial sequences of 16S rDNA of A. sacrum which were derived from sequences of DNA fragments amplified from natural A. sacrum (T. Sakamoto, personal communication). However, the sequence described for AB094350 is not identical to the sequence determined for A. sacrum in this work (Fig. 5), and therefore, this sequence might be the 16S rDNA of a contaminant. AB119259 is completely identical to the sequence of A. sacrum isolated in this work, thus providing further evidence that the cyanobacterium that we isolated derived from natural A. sacrum.

The successful isolation and establishment of pure cultures of A. sacrum may contribute to preventing its extinction due to the deterioration of its natural environment. Moreover, further studies of its culture conditions may allow the establishment of effective culture methods for the cyanobacterium. A. sacrum produces exopolysaccharides in abundance, and some exopolysaccharides have useful physiological activities and are expected to be industrially exploitable (5, 32). Depending on the results of the analysis of its exopolysaccharides, A. sacrum may be suitable for producing useful materials for food, food additives, or industrial use. Furthermore, as A. sacrum has been consumed as a food since ancient times, and as various kinds of cyanobacteria can easily be transformed, it is expected that A. sacrum may be used as a host for genetic engineering and producing foods that contain useful physiologically active materials in the future.


arrow
ACKNOWLEDGMENTS
 
We thank Yoshihide Hagiwara for supporting our research fund and for his encouragement and Hideo Endo for his gift of Suizenji-nori. We also thank Junichi Miyahara for his advice regarding the isolation of A. sacrum and Yuki Takeshima, Chika Yoshinaga, and Tomoko Kawasaki for establishing aggregates of A. sacrum without algal contaminants.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Hagiwara Institute of Health, 1173 Asazuma-cho, Kasai, Hyogo 679-0105, Japan. Phone: 81-790-47-1581. Fax: 81-790-47-1585. E-mail: fujishiro{at}hih.gr.jp. Back


arrow
REFERENCES
 
    1
  1. Bottin, H., and B. Lagoutte. 1992. Ferredoxin and flavodoxin from the cyanobacterium Synechocystis sp PCC 6803. Biochim. Biophys. Acta 1101:48-56.[CrossRef][Medline]
  2. 2
  3. Castenholz, R. W. 1988. Culturing methods for cyanobacteria. Methods Enzymol. 167:68-93.
  4. 3
  5. Cohn, C. L., J. Alam, and D. W. Krogmann. 1985. Multiple ferredoxins from cyanobacteria. Physiol. Veg. 23:659-667.
  6. 4
  7. Cozens, A. L., and J. E. Walker. 1988. Expression of a gene encoding a novel ferredoxin in the cyanobacterium Synechococcus 6301. Biochem. J. 252:563-569.[Medline]
  8. 5
  9. De Philippis, R., M. C. Margheri, R. Materassi, and M. Vincenzini. 1998. Potential of unicellular cyanobacteria from saline environments as exopolysaccharide producers. Appl. Environ. Microbiol. 64:1130-1132.[Abstract/Free Full Text]
  10. 6
  11. Floss, B., G. L. Igloi, C. Cassier-Chauvat, and U. Muehlenhoff. 1997. Molecular characterization and overexpression of the petF gene from Synechococcus elongatus: evidence for a second site of electrostatic interaction between ferredoxin and the PS I-D subunit. Photosynth. Res. 54:63-71.[CrossRef]
  12. 7
  13. Hase, T., K. Wada, and H. Matsubara. 1976. Amino acid sequence of the major component of Aphanothece sacrum ferredoxin. J. Biochem. 79:329-343.[Abstract/Free Full Text]
  14. 8
  15. Hase, T., K. Wada, and H. Matsubara. 1975. A minor component of ferredoxin from Aphanothece sacrum cells. J. Biochem. 78:605-610.[Abstract/Free Full Text]
  16. 9
  17. Hase, T., S. Wakabayashi, K. Wada, and H. Matsubara. 1978. Amino acid sequence of Aphanothece sacrum ferredoxin II (minor component) structural characteristics and evolutionary implications. J. Biochem. 83:761-770.[Abstract/Free Full Text]
  18. 10
  19. Ichimura, T. 1979. Isolation and culture methods of freshwater algae, p. 294-305. In K. Nishizawa, and M. Chihara (ed.), Methods in phycological research. Kyoritsu-Shuppan, Tokyo, Japan. (In Japanese.)
  20. 11
  21. Ichimura, T., and T. Itoh. 1977. Preservation methods of microalgae, p. 355-373. In T. Nei (ed.), Preservation methods of microorganisms. University of Tokyo Press, Tokyo, Japan. (In Japanese.)
  22. 12
  23. Ichimura, T., and M. M. Watanabe. 1977. An axenic clone of Microcystis aeruginosa Kutz. emend. Elenkin from Lake Kasumigaura. Bull. Jpn. Soc. Phycol. 25:177-181.
  24. 13
  25. Iteman, I., R. Rippka, N. Tandeau de Marsac, and M. Herdman. 2000. Comparison of conserved structural and regulatory domains within divergent 16S rRNA-23S rRNA spacer sequences of cyanobacteria. Microbiology 146:1275-1286.[Abstract/Free Full Text]
  26. 14
  27. Kaneko, T., Y. Nakamura, C. P. Wolk, T. Kuritz, S. Sasamoto, A. Watanabe, M. Iriguchi, A. Ishikawa, K. Kawashima, T. Kimura, Y. Kishida, M. Kohara, M. Matsumoto, A. Matsuno, A. Muraki, N. Nakazaki, S. Shimpo, M. Sugimoto, M. Takazawa, M. Yamada, M. Yasuda, and S. Tabata. 2001. Complete genomic sequence of the filamentous nitrogen-fixing cyanobacterium Anabaena sp. strain PCC 7120. DNA Res. 8:205-213.[Abstract]
  28. 15
  29. Kaneko, T., S. Sato, H. Kotani, A. Tanaka, E. Asamizu, Y. Nakamura, N. Miyajima, M. Hirosawa, M. Sugiura, S. Sasamoto, T. Kimura, T. Hosouchi, A. Matsuno, A. Muraki, N. Nakazaki, K. Naruo, S. Okumura, S. Shimpo, C. Takeuchi, T. Wada, A. Watanabe, M. Yamada, M. Yasuda, and S. Tabata. 1996. Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions. DNA Res. 3:109-136.[Abstract]
  30. 16
  31. Lane, D. J. 1991. 16S/23S rRNA sequencing, p. 115-175. In E. Stackebrandt and M. Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. John Wiley & Sons, New York, N.Y.
  32. 17
  33. Matsubara, H., and T. Hase. 1983. Phylogenetic consideration of ferredoxin sequences in plants, particularly algae. Springer-Verlag, Berlin, Germany.
  34. 18
  35. Matsubara, H., and K. Wada. 1988. Soluble cytochromes and ferredoxins. Methods Enzymol. 167:387-410.[Medline]
  36. 19
  37. Miller, S. R., and R. W. Castenholz. 2000. Evolution of thermotolerance in hot spring cyanobacteria of the genus Synechococcus. Appl. Environ. Microbiol. 66:4222-4229.[Abstract/Free Full Text]
  38. 20
  39. Morand, L. Z., R. H. Cheng, D. W. Krogmann, and K. K. Ho. 1994. Soluble electron transfer catalysts of cyanobacteria, p. 381-407. In D. A. Bryant (ed.), The molecular biology of cyanobacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands.
  40. 21
  41. Nakamura, Y., T. Kaneko, S. Sato, M. Ikeuchi, H. Katoh, S. Sasamoto, A. Watanabe, M. Iriguchi, K. Kawashima, T. Kimura, Y. Kishida, C. Kiyokawa, M. Kohara, M. Matsumoto, A. Matsuno, N. Nakazaki, S. Shimpo, M. Sugimoto, C. Takeuchi, M. Yamada, and S. Tabata. 2002. Complete genome structure of the thermophilic cyanobacterium Thermosynechococcus elongatus bp-1. DNA Res. 9:123-130.[Abstract]
  42. 22
  43. Nakamura, Y., T. Kaneko, S. Sato, M. Mimuro, H. Miyashita, T. Tsuchiya, S. Sasamoto, A. Watanabe, K. Kawashima, Y. Kishida, C. Kiyokawa, M. Kohara, M. Matsumoto, A. Matsuno, N. Nakazaki, S. Shimpo, C. Takeuchi, M. Yamada, and S. Tabata. 2003. Complete genome structure of Gloeobacter violaceus PCC 7421, a cyanobacterium that lacks thylakoids. DNA Res. 10:137-145.[Abstract]
  44. 23
  45. Nixon, J. E. J., A. Wang, J. Field, H. G. Morrison, A. G. McArthur, M. L. Sogin, B. J. Loftus, and J. Samuelson. 2002. Evidence for lateral transfer of genes encoding ferredoxins, nitroreductases, NADH oxidase, and alcohol dehydrogenase 3 from anaerobic prokaryotes to Giardia lamblia and Entamoeba histolytica. Eukaryotic Cell 1:181-190.[Abstract/Free Full Text]
  46. 24
  47. Ogawa, T., and G. Terui. 1970. Studies on the growth of Spirulina platensis. I. On the pure culture of Spirulina platensis. J. Ferment. Technol. 48:361-367.
  48. 25
  49. Okada, Y. 1953. On the reversion of Phylloderma sacrum. J. Jpn. Bot. 28:17-20. (In Japanese.)
  50. 26
  51. Page, R. D. M. 1996. Treeview: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12:357-358.[Free Full Text]
  52. 27
  53. Pearson, W. R., and D. J. Lipman. 1988. Improved tools for biological sequence analysis. Proc. Natl. Acad. Sci. USA 85:2444-2448.[Abstract/Free Full Text]
  54. 28
  55. Poncelet, M., C. Cassier-Chauvat, X. Leschelle, H. Bottin, and F. Chauvat. 1998. Targeted deletion and mutational analysis of the essential (2Fe-2S) plant-like ferredoxin in Synechocystis PCC6803 by plasmid shuffling. Mol. Microbiol. 28:813-821.[CrossRef][Medline]
  56. 29
  57. Porter, R. D. 1988. DNA transformation. Methods Enzymol. 167:703-712.[Medline]
  58. 30
  59. Rippka, R. 1988. Isolation and purification of cyanobacteria. Methods Enzymol. 167:3-27.[Medline]
  60. 31
  61. Rudi, K., O. M. Skulberg, and K. S. Jakobsen. 1998. Evolution of cyanobacteria by exchange of genetic material among phyletically related strains. J. Bacteriol. 180:3453-3461.[Abstract/Free Full Text]
  62. 32
  63. Schaeffer, D. J., and S. Victor. 2000. Anti-HIV activity of extracts and compounds from algae and cyanobacteria. Ecotoxicol. Environ. Saf. 45:208-227.[CrossRef][Medline]
  64. 33
  65. Shinoda, Y., N. Kato, and N. Morita. 2000. Phylogenetic analysis of a bacterium by sequencing its 16S ribosomal RNA gene. Shimazu Hyouron 57:121-132. (In Japanese with English abstract.)
  66. 33
  67. Suringar, W. F. R. 1872. Illustration des algues du Japon, p. 63-97. In W. F. R. Suringar (ed.), Musée botanique de Leide, vol. 1(b). E. J. Brill, Leiden, The Netherlands.
  68. 34
  69. Wada, K., H. Kagamiyama, M. Shin, and H. Matsubara. 1974. Ferredoxin from a blue-green alga, Aphanothece sacrum (Suringar) Okada. J. Biochem. 76:1217-1225.[Abstract/Free Full Text]
  70. 35
  71. Wada, K., R. Masui, H. Matsubara, and L. J. Rogers. 1988. Properties and structure of the soluble ferredoxin from Synechococcus 6301 (Anacystis nidulans). Relationship to gene sequences. Biochem. J. 252:571-575.[Medline]
  72. 36
  73. Watanabe, A. 1960. List of algal strains in collection at the Institute of Applied Microbiology, University of Tokyo. J. Gen. Appl. Microbiol. 6:283-292.
  74. 37
  75. Watanabe, M. M., and T. Ichimura. 1977. Fresh- and salt-water forms of Spirulina platensis in axenic cultures. Bull. Jpn. Soc. Phycol. 25:371-377.
  76. 38
  77. Weisburg, W. G., S. M. Bams, D. A. Pelletier, and D. J. Lane. 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173:697-703.[Abstract/Free Full Text]
  78. 39
  79. Wingard, L. L., S. R. Miller, J. M. L. Sellker, E. Stenn, M. M. Allen, and A. M. Wood. 2002. Cyanophycin production in a phycoerythrin-containing marine Synechococcus strain of unusual phylogenetic affinity. Appl. Environ. Microbiol. 68:1772-1777.[Abstract/Free Full Text]
  80. 40
  81. Yasui, A., H. Koizumi, and C. Tsutsumi. 1980. Composition of inorganic elements in the edible algae. Rep. Natl. Food Res. Inst. 37:163-173. (In Japanese with English abstract.)


Applied and Environmental Microbiology, June 2004, p. 3338-3345, Vol. 70, No. 6
0099-2240/04/$08.00+0     DOI: 10.1128/AEM.70.6.3338-3345.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fujishiro, T.
Right arrow Articles by Hagiwara, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fujishiro, T.
Right arrow Articles by Hagiwara, H.
Agricola
Right arrow Articles by Fujishiro, T.
Right arrow Articles by Hagiwara, H.