High-Level Overproduction of His-Tagged Tth DNA Polymerase in Thermus thermophilus

A new plasmid for the overexpression of His-tagged thermozymesin Thermus thermophilus was developed. With this plasmid, solubleand active histidine-tagged DNA polymerase from T. thermophiluswas overproduced in larger amounts in the thermophile than inEscherichia coli. The protein purified from the thermophilewas active in PCR.

INTRODUCTION

Top

Introduction

The enzymes from thermophilic microorganisms, or thermozymes,are usually produced in surrogate mesophilic hosts (1). However,several thermozymes which require either cofactors, appropriateposttranslational processing, or specific components duringmultisubunit assembly cannot be overproduced in an active formin such mesophilic systems (1-3, 5, 10). On the other hand,contamination with material from the host, like the residualamounts of DNA present in most commercial thermostable DNA polymerases,leads to false-positive cases in specific analytical applications.Therefore, the use of homologous thermophilic host systems forthe expression of such thermozymes appears to be the most straightforwardsolution to these problems (9, 11, 14).

Thermus spp. form one of the most widely distributed generaof thermophilic bacteria, and many of its isolates carry genesencoding enzymes of great biotechnological potential (4, 10).Due to the existence of well-adapted laboratory strains thatare readily amenable to genetic manipulation, this genus hasbecome the model of choice for the development of expressionsystems for thermozymes (6-9, 11, 14). Cloning and expressionvectors have been described and essentially used in the T. thermophilusHB27 strain, which has been sequenced recently (4). However,moderate, 6- to 10-fold overexpression levels have been obtainedin most cases (11). As an exception, the pMKE1 vector allowedup to 200-fold overexpression of a thermostable ß-galactosidasereporter in the laboratory strain HB27::nar (9) and approximately100-fold overexpression of an Mn-dependent catalase (5). Despitethese two orders of magnitude of overexpression, the overproducedproteins were almost undetectable by Coomassie blue staining,thus prompting us to develop more effective expression systems.

We describe a new plasmid that uses a modified version of thepromoter from the respiratory nitrate reductase (narp) to overproduceactive DNA polymerase from T. thermophilus in larger amountsthan those obtained with T7-dependent expression systems ofE. coli.

Plasmid construction.

Top

Plasmid construction.

As illustrated in Fig. 1, the pMKE2 plasmid was constructedin three steps. The first step was designed to eliminate anNcoI restriction site located inside the narp promoter. Thisproduced a 4-bp insertion. In the second step, the promoterwas amplified (primers, 5'TCGCCATGGTCACCTCCGGC3' and 5'GAAACAGCTATGACCATG3')with the concomitant inclusion of an ATG start codon insidea new NcoI restriction site (underlined). The modified narppromoter was cloned into the XbaI-NcoI sites of plasmid pET28b(+)to yield pENar2. In the final step, the XbaI-HindIII DNA fragmentfrom pMKE1 (9) was replaced by a similar DNA fragment from plasmidpENar2, thereby giving rise to the plasmid pMKE2.

View larger version (14K):
[in this window]
[in a new window]
FIG. 1. Construction of plasmid pMKE2. The scheme for the construction of the expression plasmid pMKE2 is illustrated. Abbreviations for restriction enzymes sites are the following: B, BamHI; Bg, BglII; E, EcoRI; K, KpnI; H, HindIII; N, NdeI; Nc, NcoI; Nt, NotI; P, PstI; Sm, SmaI; Xb, XbaI; Xh, XhoI. Other symbols: Kl, Klenow fragment of DNA polymerase I of E. coli; kat, gene coding for thermostable resistance to kanamycin. Arrows indicate the transcription direction of the narp promoter (the sequence of which is shaded gray).

Expression of Tth polymerase.

Top

Expression of tth polymerase.

The coding region of the DNA polymerase I gene from T. thermophilus(Tth) (Biotools B & M) was cloned into pMKE2, and the resultingplasmid (pMKETth) was used to transform T. thermophilus HB27::nar.One transformant colony was grown at 70°C in Thermus brothmedium (12) under aerobic conditions (shaken at 150 rpm) priorto the addition of 40 mM potassium nitrate and the stoppingof the shaker (time zero). Due to the low solubility of oxygenat this temperature and also its consumption, the culture rapidlybecame anaerobic, so the cells immediately started to transcribethe narp promoter. As shown in Fig. 2A, after 2 h a proteinof the expected size for the His-Tth fusion (96 kDa) was detectedin the soluble fraction of the cells. Two hours later, thisprotein accumulated to the point where it became the major componentof the fraction.

View larger version (25K):
[in this window]
[in a new window]
FIG. 2. Expression of the His-tagged DNA polymerase of T. thermophilus and E. coli. (A) A culture of T. thermophilus HB27::nar carrying plasmid pMKE2Tth was subjected to inducing conditions by adding nitrate and simultaneously stopping shaking. Samples corresponding to identical amounts of soluble fractions were subsequently analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and stained with Coomassie blue. (B and C) A growing culture of E. coli BL21DE3 transformed with plasmid pET28Tth was treated with IPTG (1 mM), and the protein patterns of the particulate (B) and the soluble (C) fractions were analyzed by SDS-PAGE. Lanes: –I, before induction; 2 h and 4 h, 2 and 4 h after induction, respectively. The size markers (M) correspond to 97.4, 66.2, 45, 31, and 21.5 kDa. Arrowheads indicate the His-Tth polymerase.

To compare these results with those of expression systems ofE. coli, the Tth gene was cloned into the pET28b+ plasmid (Novagen)to render pET28Tth. Interestingly, this plasmid was toxic at37°C, but not at 30°C, for all strains of E. coli assayed.A colony of the strain BL21DE3 (13) transformed with pET28Tthwas used to check the expression of the His-Tth polymerase 2and 4 h after the addition of 1 mM IPTG (isopropyl-ß-D-thiogalactopyranoside).As shown in Fig. 2B, most of the His-Tth polymerase accumulatedin the particulate fraction of E. coli, whereas a minor fractiondid so in the soluble fraction (Fig. 2C).

The enzyme overproduced in T. thermophilus was purified by affinitychromatography. As illustrated in Fig. 3A, most of the proteinwas bound to a nickel-nitrilotriacetic acid support, being furthereluted with imidazole. A highly purified fraction was obtainedand kept at –20°C in storage buffer (Tris, 20 mM;KCl, 50 mM; Nonidet P-40, 0.25%; glycerol, 40%; pH 8.0) untiluse. Figure 3B shows that this enzyme was as active in PCR asthe commercial enzyme produced in E. coli.

View larger version (52K):
[in this window]
[in a new window]
FIG. 3. Purification and activity of the His-Tth polymerase overexpressed in T. thermophilus. (A) A sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel is shown with fractions corresponding to an affinity Ni-agarose column in which the soluble fraction corresponding to the 4-h lane of Fig. 2A was assayed. The unbound material (E) and fractions corresponding to washing steps with the indicated concentrations of imidazole are shown. Lane M, protein markers of the labeled sizes (in kilodaltons). (B) Amplification of the kat gene with okat3 and okat4 primers. Lane 1, negative control without enzyme; lane 2, commercial Tth DNA polymerase; lane 3, His-tagged Tth DNA polymerase purified from T. thermophilus.

Concluding remarks.

Top

Concluding remarks.

The modification of the narp promoter resulted in unprecedentedlyhigh levels of overexpression in T. thermophilus. There is presentlyno clear explanation for such an increase in pMKE2 comparedto levels of pMKE1 (9), but it could be related to the bindingof transcriptional activators close to the eliminated NcoI site.The involvement of this region in narp expression has been demonstratedby progressive deletions, which showed that regions upstreamof this NcoI site are required for transcription (data not shown).This requirement for far-upstream regions is analogous to therequirement for specific heptameric sequences located upstreamof the promoter for nitrate reductase A of E. coli, to whichthe phosphorylated transcription activator NarL binds (15).Thus, it is reasonable to speculate that either the fortuitousgeneration of a new site for an equivalent transcription factorin the thermophile or, more likely, a better architecture ofthe nucleoprotein formed around this NcoI site could be thebasis for such an increase of expression. Of course, alternativeexplanations, such as higher mRNA stability or differences inplasmid copy number, also could contribute to this expressionincrease. However, as the leader RNA (91 bases long) of nativenar-mRNA present in the construction is quite stabilizing (witha 15-min half-life) (16), and as the copy number per cell ofpMKE2 was similar to that of pMKE1 (results not shown), thesealternative explanations seem unlikely.

Whatever the reason underlying the increase in transcriptionfrom the modified narp promoter, it may be concluded that thisnew expression system represents a competitive route for thedirect overexpression of soluble enzymes in T. thermophilus,even compared to the high-level overexpression systems of E.coli.

ACKNOWLEDGMENTS

This work was supported by project BIO2001-1627 of the Ministeriode Ciencia y Tecnología, Spain. An institutional grantfrom the Fundación Ramón Areces to the Centrode Biologia Molecular "Severo Ochoa" is acknowledged. R. Morenowas in receipt of a fellowship from Biotools, B & M.

FOOTNOTES

* Corresponding author. Mailing address: Centro de Biología Molecular "Severo Ochoa" CSIC-UAM, Campus de Cantoblanco, 28049 Madrid, Spain. Phone: 34914978099. Fax: 34914978087. E-mail: jberenguer{at}cbm.uam.es.

REFERENCES

Top