Previous Article | Next Article ![]()
Applied and Environmental Microbiology, October 2005, p. 5814-5822, Vol. 71, No. 10
0099-2240/05/$08.00+0 doi:10.1128/AEM.71.10.5814-5822.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Department of Civil and Environmental Engineering, University of Cincinnati, Cincinnati, Ohio 45221,1 Department of Civil and Environmental Engineering, University of South Florida, Tampa, Florida 33620,2 Department of Biological Sciences, University of Cincinnati, Cincinnati, Ohio 452213
Received 16 November 2004/ Accepted 14 May 2005
|
|
|---|
|
|
|---|
Activated-sludge sewage treatment systems are engineered bioreactors used to remove organic substances and nutrients (nitrogen and phosphorous) from municipal wastewater. A consortium of bacterial species is required to achieve the desired biological conversions, and the performance of these reactors largely depends on the bacterial diversity present. The vast majority of bacteria present in activated sludge cannot be isolated using traditional culture-dependent techniques (1). However, with the advent of small-subunit rRNA-based molecular fingerprinting techniques, including ribosomal DNA restriction analysis (36), denaturing gradient gel electrophoresis (28), thermal gradient gel electrophoresis (12), length heterogeneity PCR (31), automated ribosomal intergenic spacer analysis (13), and terminal restriction fragment length polymorphism (T-RFLP) (25), it became possible for environmental engineers and scientists to assess bacterial diversity in activated-sludge systems.
Most of these methods use PCR to amplify small-subunit rRNA genes, in particular the 16S rRNA gene, and then PCR amplicons are separated based on differences in DNA sequences of the 16S rRNA genes. Although sequence analysis of 16S rRNA gene clone libraries provides the most detailed information on the microbial community structure, this method is time-consuming and costly, especially when many samples are to be analyzed. T-RFLP is popular for its rapid production and analysis of data, and it has been shown to be an effective method for discriminating microbial communities in a wide range of environmental samples (11, 21). T-RFLP provides several advantages over other fingerprinting methods, as it is highly reproducible (30) and has greater resolution and sensitivity than denaturing gradient gel electrophoresis (25, 26).
In T-RFLP, one of the primers, usually the forward primer, used for PCR has a fluorescent molecule attached to it. The PCR amplicons, which are of equal size, are then subjected to enzymatic digestion with restriction endonucleases. The digested fragments are then separated by polyacrylamide gel or capillary gel electrophoresis and visualized by an automated DNA sequencer, which can only detect the fluorescently labeled fragments or terminal restriction fragments (T-RFs). The unique T-RFs or operational taxonomic units is used as the measured unit of diversity in a community. Given the widespread use of T-RFLP, it is anticipated that this method will be applied more frequently for community analysis of activated sludge.
Despite the importance of activated-sludge systems, knowledge of the correlation of operational parameters or plant configuration with the degree of bacterial diversity is scarce. Most of the experimental studies using molecular fingerprinting of bacterial community structure in activated-sludge system have focused on studying the spatial and temporal changes in microbial diversity (4, 7, 14, 20), assessing microbial diversity in activated sludge (3), studying the impact of certain toxins on microbial diversity (5), and studying the efficacy of bioaugmentation (12). Recently, Saikaly and Oerther (32) developed an ecology-based mechanistic model predicting the impact of bioreactor operating conditions on the diversity of bacterial species in activated-sludge system. The study reported a systematic examination of the usefulness of varying the solids retention time (SRT) to enhance the biodiversity of the bacterial community. The model results suggested that bioreactors operated at an intermediate SRT (2.28 to 5.66 days) contained a greater number of different bacteria than bioreactors operated at an SRT of >5.66 days.
The main objective of the current study was to use T-RFLP to investigate the reproducibility and stability of the bacterial community structure in a laboratory-scale activated-sludge system and to experimentally test model predictions that SRT impacts bacterial diversity.
|
|
|---|
![]() View larger version (18K): [in a new window] |
FIG. 1. Schematic of reactor setup.
|
Analytical methods.
Grab samples of mixed liquor were collected after each SRT. Performance measures included determination of total and soluble chemical oxygen demand, nitrite-nitrogen, nitrate-nitrogen, and orthophosphate using Hach Test 'N Tube reagents (catalog numbers 2415815, 26083-45, 26053-45, and 21060-46, respectively). An ion-specific electrode was used to measure ammonia-nitrogen and pH. The levels of mixed liquor suspended solids and volatile suspended solids were determined according to Standard Methods for the Examination of Water and Wastewater (2). Sludge settling was measured using a modified 30-minute sludge volume index where the standard 1-liter graduated cylinder was replaced with a 100-ml graduated cylinder and quiescent settling was allowed to occur for 30 min.
DNA extraction and PCR conditions.
For bacterial community analysis, samples of mixed liquor from each bioreactor were collected after each SRT in 2-ml centrifuge tubes and centrifuged at 10,000 x g for 10 min, the supernatant was decanted, and the samples were stored in 80°C for later analysis by T-RFLP. Genomic DNA was extracted from each sample of mixed liquor using the Ultraclean soil DNA extraction kit (Mo Bio Laboratories, Inc.) according to the manufacturer's instructions. The genomic DNA isolated was used as template material for the PCR.
PCR was performed in 50-µl reaction volume using a reaction mixture of 1X PCR buffer, 200 µM each deoxynucleoside triphosphate, 2 mM MgCl2, 0.025U of Taq DNA polymerase/µl (QIAGEN), and 0.3 µM of each primer. The primers used were specific for conserved bacterial 16S rDNA sequences, 8-27f (AGAGTTTGATCCTGGCTCAG) and 906-926r (CCGTCAATTCCTTTRAGTTT) (24) (manufactured by the University of Cincinnati DNA Core laboratory). The forward primer was labeled at the 5' end with 6-carboxyfluorescein.
Optimization of PCR was done by adjusting the volume of DNA (0.8 to 2 µl) for each sample used in the PCR to obtain a single strong band of equal concentration of DNA on an agarose gel. This method was shown to be more efficient than quantification of DNA using a spectrophotometer. Amplification of DNA was performed in a GeneAmp PCR system 2700 (Perkin Elmer) by using the following program: an initial denaturing step at 94°C for 3 min, followed by 35 cycles of denaturation at 94°C for 45 s, annealing at 65°C for 1 min, extension at 72°C for 1.5 min, and final extension at 72°C for 10 min. PCR tubes were placed in the thermocycler when the block temperature reached 94°C. Three replicate PCRs were performed for each sample and the products were pooled and verified visually (5 µl) using 1% agarose gel electrophoresis in 1X Tris-borate-EDTA and SYBR Green I staining (Molecular Probes).
T-RFLP.
Amplicons (145 µl) were purified using Wizard PCR Preps DNA purification system (Promega, Madison, Wis.) as directed by the supplier, and eluted with 50 µl sterile water. Purified PCR products (approximately 200 ng) were digested separately with 5 U of tetrameric restriction endonucleases HhaI, MspI, and RsaI (Promega, Madison, Wis.) in a 20-µl reaction volume. Restriction digests were incubated at 37°C for 4 h. Aliquots (8 µl) of restriction digests were examined by 2.5% agarose gel electrophoresis using SYBR Green I staining. To analyze the terminal restriction fragments (T-RF), 1 µl of digested samples was mixed with 1 µl of formamide (contains loading buffer and DNA fragment length standard [Rox 2500, ABI]). The mixture was denatured at 94°C for 5 min and snap-cooled on ice before electrophoresis on 7% polyacrylamide gel for 10 h at 2,250 V on an ABI 377 automated DNA sequencer (Applied Biosystems Instruments). T-RFLP profiles were analyzed using Genescan software (version 3.7, Applied Biosystems).
Analysis of T-RFLP profiles from activated-sludge bioreactors.
T-RFLP profiles were analyzed as follows. First, only profiles with a cumulative peak height
5,000 fluorescence units were used in the analysis. Second, peaks with peak height <50 fluorescent units were excluded from the analysis. Third, profiles from different environmental samples were manually aligned by visual inspection of the size of peaks in bases. Fourth, T-RFLP profiles were standardized based on peak height to account for variations in DNA loading between samples using the procedure suggested by Dunbar et al. (11). Simply, total fluorescent units in each profile was calculated after excluding peaks with peak height <50 fluorescent units. T-RF profiles were then compared and standardized to the profile with the smallest total fluorescent units. The range of total fluorescent unit in the collection of samples was between 5,097 and 7,471 fluorescent units. This procedure was repeated until the cumulative peak height in all the samples was the same. After standardization, T-RFLP profiles were normalized so that the cumulative peak height in each profile was 10,000 fluorescent units. This allowed for comparison of profiles based on relative peak heights (peak height divided by the cumulative peak height for a profile). Normalized data were then subjected to statistical analysis.
Two distance metrics were used to analyze T-RFLP profiles based on presence/absence of T-RFs and their relative abundance. These include the Jaccard distance (1 Jaccard coefficient) and the Hellinger distance. The Jaccard coefficient considers the presence/absence of T-RFs and is equal to the ratio of the number of T-RFs in common between two profiles to the total number of T-RFs present in both profiles. Hellinger distance is equal to the Euclidean distance after taking the square root of the relative peak heights (23). The agglomerative hierarchical clustering Ward (43) was applied to obtain a dendrograms for each distance metrics using the Community Analysis Package software 3.0 (Pisces Conservation Ltd.).
To evaluate structural diversity between samples, the Shannon-Weaver diversity index (H), richness (S), evenness (E), and the reciprocal of Simson's index (1/D) were used. The Shannon-Weaver diversity index (34) was calculated as follows: H =
(pi) (log2pi), where the summation is over all unique fragments i and pi is the relative abundance of fragment i. The abundance of a particular fragment can be determined by using the peak height intensity in fluorescent units. Evenness was measured as follows: E = H/(log2[S]). The reciprocal of Simpson's index of diversity (1/D) was calculated as follows: 1/D = 1/(
pi2) (35). Richness (S) was defined as the number of unique T-RFs or operational taxonomic units in a profile. Statistically significant difference in H and D among the two sets of reactors was tested by a randomization procedure as described by Solow (37) using the Species Diversity and Richness software 3.0 (Pisces Conservation Ltd.).
|
|
|---|
Reproducibility and stability of the bacterial community of activated sludge.
To investigate the reproducibility and stability in the bacterial community structure of replicate sequencing batch bioreactors operated under steady environmental conditions and seeded with the same inocula (replicate reactors in experiment 1 were seeded with sludge from a municipal activated-sludge wastewater treatment plant, while replicate reactors in experiment 2 were seeded with sludge from a laboratory-scale activated-sludge sequencing batch bioreactor that was acclimated to synthetic wastewater [see Fig. 1]), samples of activated sludge from experiments 1 and 2 were collected from each reactor at start-up and after each SRT and analyzed with T-RFLP. T-RFLP profiles from three separate restriction digests, HhaI, MspI, and RsaI, were processed using two distance metrics, the Jaccard distance and the Hellinger distance. A dendrogram was constructed from these distance metrics using Ward's method.
Figure 2 presents the dendrogram constructed for HhaI digestion. The dendrogram clearly shows that samples from replicate reactors were clustered together and evolved similarly from start-up in both experiments. This reproducibility in the bacterial community structure was also shown using the average similarity and dissimilarity (distance) between samples digested with HhaI from replicate sequencing batch bioreactors after each SRT. The average similarity between replicate reactors ranged between 72 and 90% for SRT of 8 days and between 75 and 87% for SRT of 2 days when using the Jaccard coefficient, but when comparison was done using the Hellinger distance, replicate reactors were less similar (data not shown).
![]() View larger version (24K): [in a new window] |
FIG. 2. (a to d) Dendrogram constructed with Ward's method for samples collected from replicate reactors operated at an SRT of 8 days using (a) Jaccard distance (experiment 1); (b) Jaccard distance (experiment 2); (c) Hellinger distance (experiment 1); and (d) Hellinger distance (experiment 2). (e to h) Dendrogram constructed for samples collected from replicate reactors operated at an SRT of 2 days using (e) Jaccard distance (experiment 1); (f) Jaccard distance (experiment 2); (g) Hellinger distance (experiment 1); and (h) Hellinger distance (experiment 2).
|
Another significant finding that can be concluded from the dendrogram in Fig. 2 is that at each sampling event the bacterial community structure was more closely related to the previous sampling event but more distinct from the seeding sludge. This suggests that the bacterial community structure was dynamic and constantly changing despite the fact that operating conditions and reactor performance as measured by chemical oxygen demand were constant. Several investigators (5, 12, 14, 20) have reported that the bacterial community structure of laboratory-scale activated-sludge reactors seeded with sludge from domestic wastewater treatment plants was not static but constantly changing. Interestingly, this dynamic behavior in the bacterial community structure that was observed in laboratory-scale bioreactors operated under constant conditions was not observed in full-scale biological treatment plants.
LaPara and colleagues (22) examined the bacterial community structure of seven full-scale biological treatment plants treating pharmaceutical wastewater and their results showed that the bacterial community structure was stable under normal operating conditions. As mentioned above, a stabler community structure in full-scale biological treatment plants compared to laboratory-scale activated-sludge reactors could be explained by the equilibrium model of island biogeography (8).
This dynamic behavior in the bacterial community structure in laboratory-scale activated-sludge reactors could be attributed to several biotic and abiotic factors such as resource competition (17, 18), predation, and new selective pressure imposed on domestic sludge (14). It is already recognized in ecology that competition for three or more growth-limiting resources may generate oscillations and chaotic fluctuations in species abundances (17-19).
Recently, Saikaly and Oerther (32) developed an ecology-based mathematical model describing the mechanism behind these chaotic dynamics in the bacterial community in activated-sludge system. The model describes the competition of six aerobic heterotrophic bacterial species on three essential resources using the continuous stirred tank reactor with biomass capture as the model activated-sludge system. Essential resources fulfill metabolically independent requirement for growth. For example, ammonia and orthophosphate are examples of essential resources because they meet the requirement for nitrogen and phosphorous.
In developing the model, the following assumptions were made: (i) readily biodegradable substrates (i.e., sources of carbon and energy) are not limiting; (ii) oxygen is present in excess; (iii) the limiting resources are consumed by all of the different heterotrophic bacteria; (iv) competition is exploitative; (v) the hydraulic retention time is kept constant at 0.6 days; and (vi) an ideal clarifier with assumed zero volume is present. It is to be noted that in the current study, the main sources of carbon and energy (acetate) and oxygen were not limiting. Also, nitrogen, phosphorus, and sulfur that were present in the synthetic wastewater could be considered three essential resources since they are required for growth by the bacteria and have different metabolic routes.
The model simulations showed that for a certain range of SRTs (2.28 to 5.66 days) the competition of six species on three essential resources produces oscillations within the structure of the bacterial community and these oscillations in species abundances allowed the coexistence of more species than there are limiting resources (17, 18, 32). This outcome is a direct contradiction of an existing activated-sludge steady-state competition theory, the principle of competitive exclusion, which states that the competition process proceeds to equilibrium. The model also predicts that at higher values of SRT (e.g., greater than 5.66 days), the bacterial community structure reached a steady state where competitive exclusion occurred, resulting in reduced diversity. For more details on the model, refer to Saikaly and Oerther (32).
For the sake of comparison only, a dendrogram was constructed using the biological data (relative abundance of each species) from the model predictions at 0, 1, 2, 3, 4, 5, and 6 times the SRT for SRTs of 8 and 2.5 days (Fig. 3). The data in Fig. 3 were not presented in the original paper. The conclusion from Fig. 3 is that the bacterial community is dynamic and constantly changing. It is to be noted that this dynamic in the bacterial community persists indefinitely for SRT of 2.5 days, whereas for the SRT of 8 days competitive exclusion dominated after a period of 600 days.
![]() View larger version (6K): [in a new window] |
FIG. 3. (A) Dendrogram constructed using the algorithm of Ward and Hellinger distance for model predictions at an SRT of 8 days. (B) Dendrogram constructed using the algorithm of Ward and Hellinger distance for model predictions at an SRT of 2.5 days.
|
The theoretical results of the model developed by Saikaly and Oerther (32) and the results from the current experiment using T-RFLP and the experimental studies discussed above collectively show that the bacterial community structure of activated-sludge system is dynamic. This suggests that the bacterial community in these systems could be innately dynamic and that the process of competition for essential resources could be responsible for generating these dynamics. Despite the similarity between the model and the experiment, the results should not be used to generalize or formulate a hypothesis on the dynamics and stability of bacterial communities in laboratory-scale activated-sludge reactors since several limitations exist in the model and the experiment that further hinder the generalization of the results. These observations, however, should be taken as a platform for further research. It is to be noted here that in the current study, analysis of T-RFLP profiles using MspI or RsaI gave similar results to analysis with HhaI (data not shown).
Impact of solid retention time on diversity indices.
Microbial diversity is an important concept in ecology (27). Its calculation reflects key phenomena such as competition, succession, predation, ecosystem stability, response to perturbations, and, in the current study, to assess the impact of operational parameters of activated-sludge systems, in particular the impact of SRT on microbial diversity. While it is simple to determine diversity (richness and evenness) in macroecology, the situation is complicated in microecology because of limitations in the methods available to assess diversity. Microbial diversity in environmental samples is normally determined using PCR-based molecular fingerprinting of small-subunit rRNA, e.g., ribosomal DNA restriction analysis, denaturing gradient gel electrophoresis/thermal gradient gel electrophoresis, length heterogeneity PCR, automated ribosomal intergenic spacer analysis, and T-RFLP. Thus, T-RFLP, like other molecular fingerprinting techniques, is subject to the caveats of PCR-based techniques (e.g., differential cell lyses, PCR amplification biases, and formation of PCR artifacts such as chimeric sequences and heteroduplex fragments) (42).
In addition, some organisms may produce more than one T-RF because of rrn operon copy number heterogeneity (6). On the other hand, multiple phylogenetically related organisms could be represented by a single T-RF and therefore may not represent a true operational taxonomic unit (24). Additionally, current molecular fingerprinting techniques are unable to detect populations that are present in low abundance and hence T-RFLP profiles reflect the most abundant species (40). Because of these shortcomings, diversity measures using T-RFLP should be interpreted as a reflection of the PCR product pool rather than the absolute bacterial community diversity. Nonetheless, T-RFLP profiles do provide some means of assessing apparent diversity and in the current study the number and peak heights of T-RFs were used to determine diversity indices.
Diversity indices have been used in microbial ecology for various purposes that are of theoretical and practical nature. In a theoretical context, diversity indices have been used to compare different communities (10), to compare the same community at different times (38), and to determine if there is a correlation between operational parameters of wastewater treatment plants and diversity (4). In a more practical sense, diversity indices have been used to test the efficiency of bioaugmentation for bioprotection from pollutant shocks (12). In the current study, diversity indices were used to assess the effect of SRT on the bacterial diversity of laboratory-scale activated-sludge reactors.
Bacterial community diversity of samples taken from the two sets of reactors in experiments 1 and 2 was assessed using the Shannon-Weaver index of diversity (H), evenness (E), richness (S), and the reciprocal of Simpson's index of diversity (1/D). Diversity indices summarize both species richness and relative abundance using a single number and thus they are useful as a first approach to estimate the diversity of bacterial species. For example, communities with more species and even distribution of abundance will have higher values of H than communities with fewer species or uneven distribution of abundance. Standardized T-RFLP data from replicate reactors were combined at one, two, and three times the SRT and the combined data were used to determine richness and diversity indices values.
Diversity indices values for the three restriction enzymes HhaI, MspI, and RsaI are presented in Table 1. The choice of the restriction enzymes used in this study was based on recommendations found in the literature using primers 8-27f and 906-926r (16, 24). No trend was observed in richness values for the three restriction enzymes used in this study. For example, the richness value at two times the SRT (experiment 1) was higher for an SRT of 2 days (S = 14) than an SRT of 8 days (S = 11) using MspI but lower when HhaI was used (S = 16 versus S = 19). Similarly, the richness value at two times the SRT (experiment 2) was higher for an SRT of 2 days (S = 22) than an SRT of 8 days (S = 18) using HhaI but lower when RsaI was used (S = 16 versus S = 17).
|
View this table: [in a new window] |
TABLE 1. Comparison of richness, evenness, and diversity values for reactors operated at SRTs of 2 days and 8 days
|
Contrary to what was found for richness, there was a trend in the results obtained using the Shannon-Weaver index, evenness, and the reciprocal of Simpson's index. For the three enzymes, community evenness were higher for reactors operated at an SRT of 2 days than reactors operated at an SRT of 8 days for samples collected from experiment 1 at one, two, and three times the SRT and from experiment 2 at two and three times the SRT (Table 1). These results suggest that bacterial communities in the reactors operated at an SRT of 2 days have a more even distribution of abundance than the bacterial community in reactors operated at an SRT of 8 days. Similar results were observed with the Shannon-Weaver index and the reciprocal of Simpson's index, where diversity index values were higher for reactors operated at an SRT of 2 days than reactors operated at an SRT of 8 days for samples collected from experiment 1 at one, two, and three times the SRT and from experiment 2 at two and three times the SRT. The only time where we observed a higher diversity for reactors operated at an SRT of 8 days was at one times the SRT (experiment 2).
A somewhat greater difference in diversity between the two sets of reactors was observed when the reciprocal of Simpson's index was used. This may be due to the fact that Simpson's index is more sensitive to abundant species than rare species and hence is more reflective of predominant species (37). In the current study, plotting rank-abundance curves for the two sets of reactors revealed that dominance was higher in reactors operated at an SRT of 2 days than SRT of 8 days (data not shown).
To assess if the differences in the observed diversity indices between the two sets of reactors were significant we applied a randomization test as described by Solow (37) using the Species Diversity and Richness software 3.0 (Pisces Conservation Ltd.). This test resamples 10,000 times from a distribution of species abundances produced by a summation of the two samples. The estimated P values for a one-sided test (against the alternative that sample [SRT = 2 days] is more diverse than sample [SRT = 8 days]) were calculated for the Shannon-Weaver index and the reciprocal of Simpson's index. The test results showed that reactors from experiments 1 and 2 that were operated at an SRT of 2 days were more diverse than reactors operated at an SRT of 8 days at the 5% level (Table 1). The above results were further independently supported using the biological data obtained from the ecology-based mechanistic model developed by Saikaly and Oerther (32). Diversity indices from model predictions are presented in Table 1. The model results showed higher diversity values at an SRT of 2.5 days than an SRT of 8 days at one, two, three, four, five, and six times the SRT (data not shown in the original paper).
Collectively, the results from T-RFLP analysis and model predictions show that SRT impacts species diversity. However, it is still unclear what causes reactors operated at an SRT of 2 days to have higher diversity than reactors operated at an SRT of 8 days. Several biotic (predation) or abiotic (competition) factors (17, 18, 32) could be responsible for the differences in diversity. It is already recognized in ecology that nonequilibrium dynamics and oscillations in species abundances favor species coexistence (17, 18). Saikaly and Oerther (32) showed theoretically that in activated-sludge systems, resource competition at intermediate SRT (2.28 to 5.66 days) resulted in oscillations in species abundances and that these oscillations enhanced species diversity. However, at an SRT of >5.66 days competitive exclusion dominated and diversity was reduced. The above model results could be a potential mechanism to explain the observed difference in diversity between the two sets of reactors.
In the current study, T-RFLP analysis with diversity indices proved to be a sensitive tool to analyze changes in the bacterial community diversity in response to changes in operational parameters of activated-sludge systems. A significant practical application of the above results is that environmental engineers could use SRT as a design tool to enhance bacterial diversity in activated-sludge systems. This is important because both laboratory and field studies showed that diversity is positively related to ecosystem stability (29, 39). Stability can refer to resistance to disturbance and resilience (rate of recovery after disturbance) (39).
If the diversity-stability hypothesis developed in these studies of macroecological systems applies to activated-sludge systems, then we expect systems with higher diversity to better maintain performance when exposed to environmental perturbations (e.g., toxic shock loads). The importance of species diversity was shown in a recent study examining toxic loads of mercury in bioreactors (41). The results of the study showed that diverse biofilm communities demonstrated enhanced resistance to mercury toxicity compared to monoculture biofilms. Thus, an increase in species diversity may increase the chance of obtaining species with different complementary physiological traits that are better adapted to handle specific environmental perturbations. Therefore, future work will focus on investigating the relationship between diversity and ecosystem stability of activated-sludge systems.
Financial support was provided in part by the National Science Foundation (BES-0238858 to D.B.O.). Additional financial support in the form of a Rindsberg Fellowship from the College of Engineering, University of Cincinnati, to P.E.S. is acknowledged.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»