Previous Article | Next Article ![]()
Applied and Environmental Microbiology, October 2005, p. 6039-6048, Vol. 71, No. 10
0099-2240/05/$08.00+0 doi:10.1128/AEM.71.10.6039-6048.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
P. Gracieux,1,
E. Milohanic,2,6
I. Albert,3
I. Virlogeux-Payant,1
S. Témoin,1
O. Grépinet,1
A. Kerouanton,4
C. Jacquet,5
P. Cossart,6 and
P. Velge1
Institut National de la Recherche Agronomique, Pathologie Infectieuse et Immunologie, 37380 Nouzilly, France,1 Institut Pasteur, Laboratoire de Génomique des Microorganismes Pathogènes, 28 rue du Docteur Roux, 75015 Paris, France,2 Institut National de la Recherche Agronomique, Institut National Agronomique de Paris-Grignon, Département Mathématiques et Informatique Appliquées, 16 rue Claude Bernard, 75365 Paris Cedex 5, France,3 AFSSA-LERQAP, Unité de Caractérisation et d'Epidémiologie Bactérienne, 23 avenue du Général de Gaulle, 94706 Maisons-Alfort Cedex 06, France,4 Institut Pasteur, Laboratoire des Listeria, Centre National de Référence des Listeria, WHO Collaborating Center for Foodborne Listeriosis, 28 rue du Docteur Roux, 75724 Paris Cedex 15, France,5 Institut Pasteur, Unité des Interactions Bactéries-Cellules, 28 rue du Docteur Roux, 75015 Paris, France6
Received 15 November 2004/ Accepted 25 May 2005
|
|
|---|
174-237. These genetic modifications could explain the low virulence of group I strains, since mutated PrfA proteins were inactive. Group II and III strains entered cells but did not form plaques. Group II strains had low phosphatidylcholine phospholipase C activity, whereas group III strains had low phosphatidylinositol phospholipase C activity. Several substitutions were observed for five out of six group III strains in the plcA gene and for one out of three group II strains in the plcB gene. Group IV strains poorly colonized spleens of mice and were practically indistinguishable from fully virulent strains on the basis of the above-mentioned in vitro criteria. These results demonstrate a relationship between the phenotypic classification and the genotypic modifications for at least group I and III strains and suggest a common evolution of these strains within a group. |
|
|---|
The first step in infection is adhesion to the eukaryotic cells via bacterial surface factors such as adhesins (14) and the Ami protein (29). In addition, several bacterial factors, including two proteins of the internalin family, InlA (or internalin) and InlB (12), facilitate entry of L. monocytogenes into the host cell, where it lies in a phagocytic vacuole. The vacuole is quickly lysed by the pore-forming toxin listeriolysin O (LLO), encoded by the hly gene, and the two phospholipases C phosphatidylinositol phospholipase C (PI-PLC) and phosphatidylcholine phospholipase C (PC-PLC), encoded by the plcA and plcB genes, respectively (5, 26, 44). The free L. monocytogenes in the cytosol replicates and induces polymerization of actin filaments that promote intracellular bacterial movement (39), allowing the formation of a bacterium-containing protrusion. The protrusion contacts a neighboring cell, enters it, and gives rise to a two-membrane vacuole lysed by PC-PLC and LLO (44). Thus, the bacterium is disseminated by direct cell-to-cell contact. This enables formation of plaques in cell monolayers (23), a property that has been correlated with virulence for mice (42). Most of these genes are found in a 10-kb cluster which also encodes the main virulence regulator PrfA.
We previously identified 26 low-virulence L. monocytogenes strains by using a method that combines a plaque-forming (PF) assay with the subcutaneous (s.c.) inoculation of mice (33). These strains exhibit a low lethality in mice, and their full virulence could not be restored after 10 successive inoculations (32). The present study was designed to identify virulence factors or cell invasion mechanisms that had been altered in these low-virulence strains.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Characteristics of Listeria strains used
|
All transformant strains were grown in the presence of erythromycin (Sigma, Saint-Quentin Fallavier, France) at a final concentration of 1 mg ml1 on tryptic soy agar (TSA) (Biomérieux, Marcy L'Etoile, France). The final concentrations of erythromycin in liquid media were 150 µg ml1 for Escherichia coli MC1061 (6) and 8 µg ml1 for L. monocytogenes strains.
Cell line and culture conditions.
Cells of the human adenocarcinoma line HT-29 (no. 85061109; ECACC, Salisbury, United Kingdom) (11), used between passages 24 and 66, were grown in 75-cm2 plastic tissue culture flasks (Nunc, Invitrogen, Cergy Pontoise, France) in Dulbecco's modified Eagle's medium with glucose (4.5 g/liter) (Invitrogen) supplemented with 10% (vol/vol) fetal calf serum (Invitrogen) and 2 mM L-glutamine (Invitrogen). Antibiotics (100 IU penicillin per ml and 100 µg streptomycin per ml) were routinely added to the culture medium except for the virulence assays. Cells were maintained in a humidified incubator at 37°C under 5% (vol/vol) CO2.
Cell assays.
The different steps of the cell infections were analyzed with HT-29 cells grown on 24-well tissue culture plates (Falcon) for 5 days to obtain almost confluent monolayers. Each experiment used two plates: one for the adhesion-invasion of bacteria and the second for the invasion. HT-29 cell monolayers were incubated in medium without antibiotics for 24 h and then infected for 2 h at 37°C with 107 CFU in 300 µl (multiplicity of infection = 5). For adhesion-invasion assays, the cell monolayers were gently washed six times with phosphate-buffered saline (pH 7.3) and then disrupted with 1 ml cold distilled water (4°C). Viable bacteria (intra- and extracellular) were counted after plating serial dilutions on TSA. The other plates were washed with Dulbecco's modified Eagle's medium and incubated in culture medium containing 100 µg of gentamicin per ml. After 1.5 h at 37°C, cells were washed with phosphate-buffered saline and lysed with 1 ml cold distilled water (4°C). Viable intracellular bacteria were assessed by serial dilutions plated on TSA. Monolayer integrity and cell viability were checked in parallel to infection by the trypan blue exclusion test (41). The results were expressed as the percentage of CFU recovered after 2 h (adhesion-invasion) and 3.5 h (invasion) relative to the number of bacteria deposited per well. Experiments were carried out in duplicate and repeated twice for each strain.
The virulence of the strains transformed with a plasmid carrying the prfA open reading frame (ORF) was assessed in a PF assay with HT-29 cells (33). All inocula of transformant L. monocytogenes strains were prepared in the presence of erythromycin.
Titration of phospholipase C activities.
The PI-PLC activity was assessed essentially as described by Goldfine and Knob (15). An overnight culture of bacteria at 37°C in BHI broth was diluted 10-fold in 9 ml of BHI broth supplemented with 0.2% activated charcoal (Prolabo, Merck, Strasbourg, France) (BHI-AC) and incubated at 37°C on a rotary shaker at 150 rpm for 7 h. A 1-ml aliquot of exponentially growing bacterial suspension was removed and filtered (0.2-µm filter; Sartorius, Palaiseau, France). One hundred microliters of filtrate was incubated for 10 min at 37°C with 100 µl L-
-phosphatidylinositol {L-
-[myo-inositol-2-3H(N)]; NEN Life Science Products, Le Blanc Mesnil, France} (0.9 µCi ml1; 18.5 Ci mmol1) and 13.5 µg of L-
-phosphatidylinositol (Sigma) that had been sonicated and diluted in 40 mM Tris-HCl (pH 7.2)-0.2% deoxycholate. The reaction was stopped by adding 200 µl chloroform-methanol (1:1 [vol/vol]) and 100 µl 0.1 N HCl. The mixture was centrifuged for 7 min at 225 x g, and the water-soluble [3H]inositol phosphate was measured in a liquid scintillation analyzer (Packard 1600 TR); 1 unit of activity represents the release of 1 µmol inositol phosphate per min. Quantification of the number of CFU was carried out on TSA plates to check that the strains could be compared. Experiments were performed in duplicate and repeated twice for each strain.
The PC-PLC activity was assessed essentially as described by Geoffroy et al. (13). BHI-AC broth was seeded after preculture in BHI broth and incubated overnight at 37°C. The stationary-growth-phase bacterial suspension was filtered as for PI-PLC titration. The PC-PLC activity was assessed by incubating 100 µl filtrate for 24 h at 37°C in 900 µl lecithin suspension, made by adding 200 µl lecithin solution (3.6% lecithin [Sigma], 2.4% sodium cholate [Sigma], 1 mM ZnSO4 [Sigma], 0.1% sodium azide [Sigma], 100 ml distilled water) to 700 µl 0.15 M NaCl (Carlo Erba). The PC released was measured at 510 nm by comparison with a reference suspension (100 µl sterile BHI-AC filtrate in 900 µl lecithin suspension). PC-PLC units are defined as the amount of enzyme increasing the optical density at 510 nm by 0.1 unit in 1 h. Experiments were performed in duplicate and repeated twice for each strain. Quantification of the number of CFU was carried out on TSA plates to check that the strains could be compared.
Titration of hemolytic activity.
Hemolytic activity was assessed as described by Roche et al. (33). One hemolytic unit is defined as the reciprocal of the dilution at which 50% hemolysis is detected. Experiments were carried out in duplicate and repeated twice for each strain.
Statistical analysis.
A model-based agglomerative hierarchical clustering analysis was performed to look for groups (clusters) in the data, in such a way that objects belonging to the same cluster resembled each other, whereas objects in different clusters were dissimilar. A hierarchical algorithm was used, as it yielded a complete hierarchy of clustering for the given data set. We applied the most widely used ascendant clustering hierarchical technique. This model-based agglomerative hierarchical clustering is based on the assumption that the data are generated by a mixture of underlying probability distributions (1). It is assumed that the population of interest consists of different subpopulations, each with its own probability distribution. A wide range of probability distributions can be assumed. A maximum-likelihood classification is performed to determine the different subpopulations (clusters). Ward's method, based on a sum-of-squares criterion, is one example of this approach.
We used an S* criterion with the commercial software S-Plus for Windows (1, 18), which allows ellipsoidal distributions with different variances to ensure the flexibility of the classification, as we suspected the presence of a group with characteristics similar to those of the virulent strains with regard to the cell infection phenotype and phospholipase C activities. This group had a greater internal variance than the others.
Nucleotide sequencing of prfA, plcA, and plcB genes and sequence analyses.
The DNAs of the L. monocytogenes strains were amplified by PCR from total DNA (28), with DyNAzym DNA polymerase (Finnzymes, Ozyme, Saint-Quentin en Yvelines, France) for the prfA genes or with Pfu polymerase (Promega, Charbonnières, France) for the plcA and plcB genes, for 35 cycles in a thermal cycler (iCycler; Bio-Rad, Marnes La Coquette, France). Denaturation and elongation steps were performed for 30 s at 95°C and 90 s at 72°C, respectively, except for the plcA gene, for which elongation was performed for 3 min. The hybridization step was carried out for 45 s at 55°C for the prfA genes and for 30 s at 55°C for the plcA and plcB genes. External primers located in genes surrounding them are described in Table 2. Nucleotide sequencing of the prfA genes was carried out using Big Dye terminator sequencing chemistry (Applied Biosystems, Waters, Saint-Quentin en Yvelines, France) and an automated 3700 DNA sequencer (Perkin-Elmer, NEN Life Science Products, Le Blanc-Mesnil, France). Nucleotide sequences were aligned using Vector NTI (Informax, Invitrogen) and protein sequences using Clustal W. Nucleotide sequencing of the plcA and plcB genes was carried out by Genome Express (Genome Express, Meylan, France). Nucleotide and protein sequences were aligned using Vector NTI.
|
View this table: [in a new window] |
TABLE 2. Primers used in this study
|
prfA strain was transformed with the wild-type prfA gene from the EGDe strain or with mutated prfA genes from four low-virulence strains (BO18, AF95, CNL895806, and SO49). Second, these four low-virulence strains were transformed with the wild-type prfA gene of the EGDe strain.
The pP1 vector (10), carrying a strong constitutive promoter of the protease of Streptococcus cremoris, was used to clone and express the prfA ORF of each strain. All ORFs with the transcriptional terminator of the prfA gene were amplified by PCR with Pfu DNA polymerase (Promega) for 35 cycles of 30 s at 95°C, 45 s at 54°C, and 110 s at 72°C. We used primer A (5'GGTCTAGAC GATTGGGGGATGAGAC3' [XbaI site underlined]) and primer B (5'GGG TCGACCAGCTCTTCTTGGTGAAG3' [SalI site underlined]). PCR fragments were digested with the restriction enzymes SalI and XbaI, which were purchased from Promega and used as recommended by the manufacturer. The fragments were ligated with a DNA ligation kit (Takara, BioWhittaker, Emerainville, France) into SalI-XbaI-digested pP1 vector. CaCl2 treatment was used to introduce the recombinant plasmids into E. coli MC1061 (17). Transformant strains were selected by antibiotic resistance, and the integration of the prfA ORF into pP1 was confirmed by isolation of plasmid DNA and restriction analysis (see above) (3). The integrity of the insert for each construction was checked by sequencing both strands (Genome Express, Meylan, France). EGD
prfA or low-virulence strains were then transformed by electroporation as described by Sheehan et al. (36). Transformant strains were selected by their antibiotic resistance and by their specific restriction enzyme patterns.
Mouse virulence assays.
The virulence of the strains transformed with plasmid harboring the prfA ORF was assessed after subcutaneous injection into the left hind footpads of 7-week-old conventional Swiss female mice (Iffa-Credo, L'Arbresle, France) (33). All the inocula of transformant L. monocytogenes strains were prepared in the presence of erythromycin. In brief, 4 log CFU were injected subcutaneously into the left hind footpad. Five mice were injected per strain. They were maintained under a controlled atmosphere during the experiments and sacrificed by cervical dislocation 3 days after s.c. inoculation. Spleens were removed and soon after were homogenized. Dilutions were performed, and viable bacteria were assessed on both TSA plates (Bio-Merieux, Marcy L'Etoile, France) and TSA-erythromycin, with no significant differences being observed between these media. The average numbers of bacteria per organ were calculated from the results obtained from the infected mice.
Nucleotide sequence accession numbers.
The plcA nucleotide sequences were assigned the following GenBank accession numbers: strain BO43, AY367414; strain CNL895807, AY367410; strain CNL895795, AY367411; strain 416, AY367412; and strain 417, AY367413. The plcB sequence from strain 454 was assigned accession number AY787787.
|
|
|---|
The virulent and low-virulence strains had similar degrees of adhesion-invasion (i.e., including both adhered and intracellular bacteria) with HT-29 cells (Fig. 1a). On the other hand, the invasion assay, which assessed intracellular bacteria, displayed major differences (Fig. 1b). The penetration rates of 11 out of the 26 low-virulence strains were close to that of the noninvasive L. innocua strain (0.0007%). Therefore, impaired invasion rather than impaired adhesion seemed to account for the reduction of virulence.
![]() View larger version (62K): [in a new window] |
FIG. 1. Virulent and low-virulence strains compared after different cell invasion assays on HT-29 cell monolayers.
|
According to Geoffroy et al., the PC-PLC activity was considered positive when it was above 1 U/ml (13). All the virulent strains had PC-PLC activities of 3 U/ml or more (Fig. 2a). However, only 12 of the 26 low-virulence strains had a significant PC-PLC activity. The other low-virulence strains (14 out of 26) had no significant PC-PLC activity, like the noninvasive L. innocua species.
![]() View larger version (34K): [in a new window] |
FIG. 2. Virulence-associated enzyme activities of virulent and low-virulence strains.
|
Under our conditions, all the low-virulence strains had a hemolytic activity of at least 1 hemolytic unit (Fig. 2c). Variance analysis shows that the virulent strains used exhibited higher hemolytic activity than the low-virulence strains. Fourteen out of 26 low-virulence strains had low hemolytic activity (less than 8 hemolytic units), while only 4 out of 13 virulent strains had low hemolytic activity. The virulent strain SO93 had no hemolytic activity with sheep red blood cells but hemolysed horse red blood cells (data not shown). These differential hemolytic responses were also observed by Van der Kelen and Lindsay (41). In accordance with reports showing that, when significant, the hemolytic titer is not related to the level of virulence, we did not take this factor into account for the classification of the low-virulence strains (22).
Classification of the low-virulence L. monocytogenes strains into four groups.
Only four of the six criteria studied were used for the statistical analysis. Hemolytic activity was not taken into account because all the strains were hemolytic. Similarly, we did not use adhesion because all the L. monocytogenes strains analyzed adhered at similar levels, regardless of their virulence. We used an ascendant clustering hierarchical technique to classify the values of the four factors (cell invasion, plaque formation, and the activities of the two phospholipases C), thereby dividing the low-virulence strains into four groups (Fig. 3). Group I included strains that did not enter cells, formed no plaques, and had no phospholipase activity; group II included strains that entered cells but did not form plaques and expressed only PI-PLC; and group III included strains that entered cells but did not form plaques and expressed only PC-PLC. In contrast to groups I, II, and III, strains in group IV were indistinguishable from virulent strains on the basis of these in vitro characteristics: they entered cells, formed at least some plaques, and expressed all the phospholipase activities.
![]() View larger version (21K): [in a new window] |
FIG. 3. Classification of the low-virulence L. monocytogenes strains. For this analysis we used an ascendant model-based agglomerative hierarchical clustering technique based on the results of cellular entry, plaque formation, and the two phospholipase C activities.
|
For group II, strain 454 exhibited six mutations in the plcB gene, which led to four substitutions in the PC-PLC protein: Asp61Glu, Leu183Phe, Gln216Lys, and Ala223Val (Table 3). This strain exhibited a very low PC-PLC activity. While the SO205 and SO207 strains exhibited no PC-PLC activity, no difference could be detected in the plcB gene compared to that of the reference strain.
|
View this table: [in a new window] |
TABLE 3. Substitutions found in the PrfA, PC-PLC, and PI-PLC proteins
|
The prfA gene sequences of the 11 group I strains showed mutations. The DNA sequences of three low-virulence strains (AF95, BO18, and BO38) had 7 nucleotides inserted after codon 171. This insertion changed the reading frame from codon 174 and introduced an early termination codon at position 184 (Table 3). The potentially shorter PrfA protein (PrfA
174-237) was analyzed by Western blotting with specific anti-PrfA antibodies. The three strains (AF95, BO18, and BO38) harboring the PrfA
174-237 mutation gave a band migrating at 22 kDa, which was thus smaller than the band corresponding to the wild-type PrfA protein encoded by the EGDe strain (28 kDa) (data not shown). This was in accordance with the molecular weight of the putative truncated PrfA protein. We detected an A-to-C transition at the first position of codon 220 in the other eight group I low-virulence strains (AF10, CHU860776, CNL895793, CNL895803, CNL895804, CNL895806, CNL895809, and SO49). This nucleotide replacement led to a Lys220Thr substitution in PrfA (PrfAK220T) (Table 3). Therefore, only two mutations were found in the prfA genes of these 11 low-virulence field strains of L. monocytogenes, which were unrelated in origin and isolation date and belonged to three different rRNA gene restriction patterns (data not shown).
Effect of the mutations in the prfA genes of the L. monocytogenes group I strains.
The influence of the two mutations on PrfA activity was demonstrated by introducing the mutated prfA gene encoding the truncated PrfA protein (PrfA
174-237) of strains BO18 and AF95 or the mutated PrfA protein (PrfA220KT) of strains CNL895806 and SO49 in trans in an EGDe strain lacking the prfA gene (EGD
prfA). The EGD
prfA strain transformed with one of the mutated prfA genes had the same low hemolytic activity as the parent EGD
prfA strain and the EGD
prfA strain carrying the pP1 vector without an insert. On the other hand, the hemolytic titer of the EGD
prfA strain carrying the wild-type prfA gene in trans was eight times higher than that of the parent strain (data not shown). Similar results were obtained for PC-PLC activity: no activity was detected for EGD
prfA and the derivative strains carrying only the pP1 vector or the recombinant plasmid with the mutated prfA. PC-PLC activity was recorded only with the EGD
prfA strain carrying the wild-type prfA gene in trans (data not shown). Thus, our results demonstrate that trans-complementation of EGD
prfA by the genes encoding PrfA
174-237 or PrfAK220T did not restore the PC-PLC or hemolytic activities, unlike complementation with the wild-type prfA gene, demonstrating that these mutations inactivate PrfA.
In order to demonstrate that these mutations were sufficient to explain the low virulence, the BO18 and AF95 strains, producing truncated PrfA protein (PrfA
174-237), and the CNL895806 and SO49 strains, producing mutated PrfA protein (PrfAK220T), were complemented with the wild-type prfA gene from the EGDe strain inserted in trans. The transformed strains were tested in the PF assay and after subcutaneous inoculation of mice. In contrast to the four low-virulence parent strains, which did not enter HT-29 cells and thus formed no plaques, the trans-complemented strains formed the same number of plaques as the virulent EGDe strain (Table 4). Surprisingly, the EGD
prfA strain transformed with the wild-type prfA gene did not form plaques but destroyed the HT-29 cell monolayers. Likewise, this strain did not recover its virulence in vivo. All the low-virulence strains trans-complemented with the wild-type prfA gene were able to infect all the mice inoculated, whereas the parental low-virulence strains were avirulent in this model. Our data therefore suggest that the addition of wild-type prfA in trans was sufficient to restore the virulence of low-virulence strains carrying a mutated prfA gene and therefore that any other mutation would not significantly alter their virulence.
|
View this table: [in a new window] |
TABLE 4. Virulence assays performed with wild-type and trans-complemented L. monocytogenes strains
|
|
|
|---|
Interestingly, a link was found between the groups and the virulence of the strains previously described by Roche et al. (32, 33). Ten of the 11 group I strains were avirulent and not lethal in mice, even after the s.c. injection of 109 CFU. Only 1 of the 11 strains was hypovirulent and not lethal in mice. Similarly, four of the six group IV strains were hypovirulent, and three had 50% lethal doses of close to 108 to 109 CFU. The two other strains were avirulent.
The characteristics of group IV strains, all belonging to serogroup 4 and serovar 7, were similar to those of the virulent strains in terms of their cell infection phenotype and phospholipases C activities. The main differences between these strains and virulent strains were the frequency of spleen infection after s.c. inoculation and the course of infection in vivo (32). This is supported by the fact that two strains belonging to this group (strains 464 and CR282) originated from human cases.
The group II (three strains) and III (six strains) strains were phenotypically very similar. They all had poor in vivo colonization capacities and entered cells but did not form plaques. Group II strains had very low PC-PLC activities, while group III strains had very low PI-PLC activities. This low activity could be related to the substitutions found in the plcA gene for five out of six group III strains. For the group II strains, it is premature to make any assumptions because only one out of three group II strains showed mutations in the plcB gene. However, Smith and Portnoy have demonstrated that the lack of one phospholipase only slightly decreases virulence (37). Thus, it is more than likely that the low virulence of these strains is related to other mutations. We are currently analyzing the role of substitutions in the activity of these virulence-related enzymes.
The 11 group I strains did not enter host cells and thus formed no plaques. They had little or no phospholipase C activity and were weakly hemolytic. As these bacterial functions are controlled by PrfA, we analyzed the sequence of the prfA gene, encoding the transcriptional regulator of L. monocytogenes virulence genes. Only two naturally occurring mutations were found among the 11 low-virulence L. monocytogenes strains, even though they were unrelated epidemiologically and belonged to three different rRNA gene restriction patterns. Three strains had seven nucleotides inserted into their prfA gene, introducing an early termination codon that resulted in a truncated protein (PrfA
174-237) as demonstrated by Western blotting. Eight strains had the same nucleotide substitution, leading to a Lys220Thr substitution (PrfAK220T). The two mutation types prevented the activation of virulence genes, since insertion of a plasmid carrying the mutated prfA into the EGD
prfA strain did not restore hemolytic or PC-PLC activity, unlike insertion of wild-type prfA gene. These naturally occurring mutations explain the low virulence of the 11 field L.monocytogenes strains, because these strains recovered their ability to form plaques in HT-29 cell monolayers when they were trans-complemented with the wild-type prfA gene from the EGDe strain. The trans-complemented strains also recovered their virulence in mice after s.c. inoculation. They all infected 100% of inoculated mice, in contrast to the case when the wild-type prfA gene was inserted in trans into the EGD
prfA strain, which led to cytotoxic effects without plaque formation. This cytotoxicity could be due to the strong constitutive promoter that controls the transcription of prfA on the plasmid. Indeed, overexpression of the prfA gene could lead to synthesis of large amounts of all the virulence factors in the EGDe strain, fast destruction of infected cells, and thus damage to cell monolayers. Moreover, no mice were infected by this strain. In low-virulence strains, on the other hand, the presence of inactive PrfA may lead to the formation of less efficient heterodimers.
To our knowledge, this is the first time that the truncated PrfA protein has been described for field strains of L. monocytogenes, although spontaneous deletions in the prfA gene have been described for reference culture collection strains (27). The truncated PrfA protein in our strains led to the loss of both the helix-turn-helix DNA-binding motif (amino acids 171 to 191) mediating the interaction of PrfA with the PrfA box in target promoters (35) and the putative leucine zipper motif (amino acids 193 to 237) (24). The second mutation found in the other eight strains was the replacement of the lysine at position 220 by a threonine. It occurred just in front of the leucine at position 221, one of the characteristic amino acids of the putative leucine zipper motif that could predict a dimerization domain (24). Several experiments are in progress to understand the role of the K220T substitution in the formation of homodimers and in the binding to the PrfA boxes.
Overall, the sequencing of virulence genes in low-virulence strains has shown a link between the phenotypic classification and genotypic modifications, at least for groups I and III. These widespread mutations could reflect an evolution of the L. monocytogenes strains as observed with L. innocua, which lost the virulence gene cluster (43). Indeed, 30% of the 26 low-virulence field strains detected in our laboratory had the same nucleotide replacement in prfA (PrfAK220T), and 12% had the same 7-nucleotide insertion in the 3' region of prfA (PrfA
174-237). In addition, 19% of the strains (group III) showed the same 12 mutations in the plcA gene. The common evolution of some low-virulence strains is reinforced by analysis of the DNA macrorestriction profiles, which are different from those of the 623 virulent L. monocytogenes strains tested (A. Kerouanton, personal communication). It now seems important to investigate whether these substitutions are due to a common ancestry or to horizontal transfer, as is the case for the natural atypical L. innocua (21).
Overall, our results show that some L. monocytogenes strains have genetic mutations based on their phenotypes that could be predicted to a certain extent. It should therefore be possible to identify the amino acids relevant for virulence protein activity. Further work could involve carrying out a multiplex PCR assay for the screening of the low-virulence strains, since the genetic mutations appear to be specific to each group.
This work was supported by a grant from the "Ministère de l'Agriculture et de la Pêche" (program Aliment-Qualité-Sécurité S35). P. Gracieux holds a doctoral fellowship from "Arilait-Recherches" and the "Association Nationale de la Recherche Technique." E. Milohanic holds a postdoctoral fellowship from "Soredab SAS."
S. M. Roche and P. Gracieux contributed equally to this work. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»